Lung cancer is one of the most commonly diagnosed cancers with survival much lower in patients diagnosed with distal metastases. It is therefore imperative to identify pathways involved in lung cancer invasion and metastasis and to consider the therapeutic potential of agents that can interfere with these molecular pathways.
Frugtniet et al BMC Cancer (2017) 17:224 DOI 10.1186/s12885-017-3219-3 RESEARCH ARTICLE Open Access Neural Wiskott-Aldrich syndrome protein (nWASP) is implicated in human lung cancer invasion Bethan A Frugtniet1, Tracey A Martin1*, Lijian Zhang2 and Wen G Jiang1 Abstract: Lung cancer is one of the most commonly diagnosed cancers with survival much lower in patients diagnosed with distal metastases It is therefore imperative to identify pathways involved in lung cancer invasion and metastasis and to consider the therapeutic potential of agents that can interfere with these molecular pathways This study examines nWASP expression in human lung cancer tissues and explores the effect of nWASP inhibition and knockdown on lung cancer cell behaviour Methods: QPCR has been used to measure nWASP transcript expression in human lung cancer tissues The effect of wiskostatin, an nWASP inhibitor, on A-549 and SK-MES-1 lung carcinoma cell growth, adhesion, migration and invasion was also examined using several in vitro functional assays, including ECIS, and immunofluorescence staining The effect of nWASP knockdown using siRNA on particular behaviours of lung cancer cells was also examined Results: Patients with high levels of nWASP expression in tumour tissues have significantly lower survival rates nWASP transcript levels were found to correlate with lymph node involvement (p = 0.042) nWASP inhibition and knockdown was shown to significantly impair lung cancer cell growth nWASP inhibition also affected other cell behaviours, in SK-MES-1 invasion and A-549 cell motility, adhesion and migration Paxillin and FAK activity are reduced in lung cancer cell lines following wiskostatin and nWASP knockdown as shown by immunofluorescence and western blot Conclusions: These findings highlight nWASP as an important potential therapeutic target in lung cancer invasion and demonstrate that inhibiting nWASP activity using the inhibitor wiskostatin can significantly alter cell behaviour in vitro Keywords: nWASP, Lung, Cancer, Invasion, Wiskostatin Background Lung cancer is one of the most commonly diagnosed cancers accounting for 13% of total cases worldwide [1] It is also one of the leading causes of cancer death globally with survival rates much lower in patients diagnosed with distal metastases [2, 3] This highlights the importance of understanding the mechanisms involved in lung cancer metastasis and considering how molecular pathways involved in this process could form novel potential therapeutic targets * Correspondence: martinta1@cf.ac.uk Cardiff China Medical Research Collaborative, School of Medicine, Cardiff University, Cardiff CF14 4XN, UK Full list of author information is available at the end of the article The critical initial steps in lung cancer metastasis involves the detachment and invasion into the surrounding tissues of tumour cells which requires changes to their adhesive and migratory properties [4] This is achieved partly through cell polarisation and the extension of actin-rich membrane structures in the direction of movement such as filopodia, lamellipodia or invadopodia which are found in invasive cancer cells Focal adhesions on the leading edge of these protrusions connect the actin cytoskeleton in the migrating cells to their surroundings through the coordination of numerous signalling and structural proteins, such as integrins, focal-adhesion kinase (FAK) and paxillin, allowing them to gain traction and move [5] The formation of membrane © The Author(s) 2017 Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated Frugtniet et al BMC Cancer (2017) 17:224 protrusions, which are crucial for cell motility, is controlled by the rearrangement of the actin cytoskeleton [6–10] nWASP is a 65kDa cytoplasmic protein which responds to several cellular signalling molecules to mediate actin polymerisation through interactions with the Actin-related protein 2/3 (Arp2/3) complex When inactive, nWASP exists in an auto-inhibited, folded confirmation whereby the main catalytic domain, the VCA domain on the C-terminus, is shielded by the Nterminus regions Signalling molecules, such as the small GTPase Cdc42, bind to and activate nWASP by destabilising the auto-inhibited state and exposing the VCA region allowing interactions with the Arp2/3 complex which, when bound to nWASP in conjunction with an actin monomer, becomes activated and actin polymerisation can be initiated [11–15] Through this role, as a reorganiser of the actin cytoskeleton, nWASP has been implicated in the control of many cellular processes such as vesicle trafficking, pathogen infection and neurite extension to name a few However, more interestingly with respect to cancer studies, nWASP has been shown to be involved in changes to cell morphology, such as invadopodium formation, growth and also correlates with certain cancer phenotypes Hence, nWASP has been highlighted as a potential therapeutic target in a range of contexts, particularly in the control of cancer progression [11, 15–23] The primary aim of this investigation is to explore the role and therapeutic potential of targeting nWASP with reference to lung cancer This is achieved by examining the activity of nWASP in human lung cancer tissues and by studying the effects of nWASP knockdown and the nWASP inhibitor wiskostatin [24] on lung cancer cell behaviour, with particular focus towards migratory, invasive, adhesive and proliferative properties Page of 11 were collected immediately after surgical resection and stored in the Tissue Bank of Peking University Oncology School Clinicopathological factors, including age, sex, histological types of tumours, TNM stage, lymph node metastasis and survival were recorded and stored in the patients’ database siRNA transfection Cells were seeded in a 24-well plate in serum-free DMEM (no antibiotics) at × 105 cells/well After 24 h cells were transfected with 0.17 μg nWASP siRNA (sc36006, Santa Cruz Biotechnology Inc., USA), or non-targeting siRNA (NT), delivered in antibiotic free DMEM supplemented with 5% FBS with μl Lipofectamine 3000 reagent (ThermoFisher Scientific, MA, USA) per well After a further 24 h cells were then used for RNA/protein extraction or functional assays RNA isolation and QPCR Total RNA was isolated from the homogenized tissues (150 pairs of specimens) or from cultured cells using Total RNA Isolation Reagent (ABgene™) Reverse transcription was performed using the Reverse Transcription kit (Primer design) QPCR was performed on the Icycler IQ5 system (Bio-Rad, Hammel Hemstead, UK) to quantify the level of nWASP transcripts in the samples (shown as copies/μl from internal standard normalised to actin) The QPCR technique utilised the Amplifluor system™ (Intergen Inc., England) and QPCR master mix (BioRad) nWASP QPCR primers: Forward: 5’AGTCCCTCTTCACTTTCC TC’3 and Reverse: 5’ACTGAACCTGACCGTACAACAT CTCTGTGGATTGTCCT’3 Real-time QPCR conditions were 95 °C for 15 min, followed by 60 cycles of 95 °C for 20 s, 55 °C for 30 s and 72 °C for 20 s nWASP transcript expression was then analysed and correlated with patient’s pathological and clinical information Methods Cell lines, culture conditions and tissue samples PCR and Gel Electrophoresis A-549 and SK-MES-1 lung carcinoma cell lines were purchased from ATCC (VA, USA) in October 2014 and were cultured in Dulbecco’s Modified Eagle Medium (DMEM) (Sigma-Aldrich, Dorset, UK) supplemented with 10% foetal bovine serum (FBS) Authentication of both cell lines took place using STR profiling techniques and regular testing for mycoplasma contamination was also carried out PCR was carried out using the following cycling conditions: 94 °C for min, then 32 cycles of 94 °C for 30s, 55 °C for 40s, 72 °C for 60s with a final extension of 10 at 72 °C nWASP primers used: Forward: 5’AGTCCCTCTT CACTTTCCTC’3 and Reverse: 5’GCTTTTCCCTTCT TCTTTTC’3 GAPDH primers: Forward: 5’GGCTGCT TTTAACTCTGGTA’3 and Reverse: 5’GACTGTGGT CATGAGTCCTT’3 The products were run on a 2% agarose gel and visualised using SYBR safe (Abnova, Taiwan) Ethics, consent and permissions Fresh frozen lung carcinoma tissues at TNM stages of to 3, with matched normal tissues, were obtained from 150 patients who received curative resection in Peking University Cancer Hospital from January 2001 to December 2006 Ethical approval was provided by hospital’s Ethics Committee at Peking University Cancer hospital Tissues Reagents and treatments Wiskostatin (Enzo Life Sciences, Exeter, UK) was dissolved in 30% dimethyl sulfoxide (DMSO, Sigma-Aldrich) in normal cell culture medium to a stock concentration of 300 μM Control reactions received appropriate DMSO treatments For immunofluorescence and western blot Frugtniet et al BMC Cancer (2017) 17:224 assays, the following primary antibodies were used: paxillin BD610052 (BD Biosciences, Oxford, UK), FAK BD610058 (BD Biosciences, Oxford, UK), pFAK sc11766 (Santa Cruz Biotechnology Inc., USA), nWASP NBP182512 (Novus Biologicals, Abingdon, UK) and GAPDH sc32233 (Santa Cruz Biotechnology Inc., USA) The secondary antibodies, AlexaFluor 594 and AlexaFluor 488 (donkey IgG; Life Technologies, Paisley, UK) were used to conjugate to primary antibodies in immunofluorescence assays DAPI (Merck Millipore, Watford, UK) was used to visualise nuclei Anti-goat/−mouse/−rabbit IGG whole molecule peroxidase antibodies (Sigma Aldrich) were used to conjugate to primary antibodies in Western blot assays Protein extraction, SDS-PAGE and Western Blot Lysis buffer was used to extract protein from cells which was then used for SDS-PAGE Proteins were transferred onto Immobilon® PVDF membranes (Merck Millipore, Watford, UK) which were blocked and probed with primary antibodies and then incubated with the corresponding peroxidase conjugated secondary antibodies (1:1000) Proteins were visualised using EZ-ECL Kit (Biological Industries, Israel) In vitro growth assay Cells were seeded into a 96-well plate with appropriate treatments at a density of 3000 cells in each well with 10 replicates per treatment After 1, 2, and day incubation periods, cells were fixed using 4% formalin (Sigma-Aldrich) and stained with 1% crystal violet (Sigma-Aldrich) After washing, crystal violet was extracted from cells using 10% acetic acid (Sigma-Aldrich) in distilled water (v/v) Absorbance was determined at 540 nm wavelength on an absorbance plate reader (Biotek ELx800) In vitro cell adhesion assay Wells on 96-well plates were pre-coated with Matrigel basement membrane matrix (BD Biosciences) at 50 μg/ ml in normal culture medium Following rehydration, × 105 cells, which had been incubated overnight in treatments, were then seeded into each well onto the Matrigel membrane in 200 μl of normal medium containing treatments with at least replicates per sample and incubated for 25 Adherent cells fixed and stained as described above and visualised under the microscope at ×5 magnification In vitro scratch assay × 105 cells were seeded in appropriate treatments into each well on a 24-well plate with at least replicates per experiment Upon reaching confluence the monolayer was scratched to create a linear wound The plate was placed in an EVOS® FL Auto Imaging System (Life Technologies, Paisley, UK) which maintained the plate in Page of 11 normal culture conditions throughout the experiment Images were captured of the wound every 30 for up to 24 h ECIS assay Z-theta models of the ECIS (electric cell-substrate impedance sensing) instruments (Applied Biophysics Inc., NJ, USA) were used to electrically monitor coverage of gold electrodes on the base of a 96W1E+ arrays by measuring the capacitance at 64 kHz The plate was stabilised and × 104 cells/well were seeded in treatments where appropriate At least replicate well were used for each sample in every experiment An electrical wound was applied after 35 h with settings: 20s, current of 2400 μA and frequency of 60,000 Hz Cytodex-2 bead motility assay Cells were incubated at a density of × 105 cells/ml in normal culture medium, containing 100 μl of cytodex-2 beads (Sigma-Aldrich at 20 mg/ml in BSS), for h to allow the cells to adhere to the beads Following washes, 100 μl of the cell/bead suspension was added to a 96well plate and incubated for 18 h in treatments with replicates Cells which had migrated from the beads to the plate were fixed, stained and counted according to absorbance as above In vitro invasion assay Cell culture inserts (8 μm pore ThinCert™ 24-well plate inserts, Greiner Bio-One GmbH, Austria) were placed into a 24-well plate and coated with Matrigel basement membrane matrix (BD Biosciences) at 50 μg/ml in normal culture medium Cells were seeded into inserts at a density of × 104 cells per insert in 200 μl containing treatments with replicates After days cells which had invaded through the Matrigel and migrated through the pores on the inserts were fixed, stained and counted according to absorbance as above Immunofluorescence staining For immunofluorescence staining, cells were cultured in Millicell EZ 8-well chamber slides (Merck Millipore, Watford, UK) for 18 h at a seeding density of × 104 cells per well Cells were fixed in 500 μl of ice cold 100% ethanol at −20 °C Cells were permeabilised with 0.1% Triton X 100 (Sigma Aldrich) Primary antibodies (diluted to 1:100) and secondary antibodies (1:500 for Alexa secondary antibodies and 1:1000 for DAPI) were prepared in blocking buffer in blocking buffer and applied Slides were washed and mounted using FluorSave (Calbiochem, Nottingham, UK) and visualised using an Olympus BX51 microscope with a Hamamatsu Orca ER digital camera at × 40 Integrated density was measured using ImageJ Frugtniet et al BMC Cancer (2017) 17:224 Page of 11 Statistical analysis Statistical analysis of patient qPCR data was performed using SPSS software (SPPS Inc.) The relationship between nWASP and patient clinicopathological information was assessed using student’s unpaired t-tests Multivariate analysis was carried out using Minitab Survival curves were produced and analysed using the Kaplan-Meier method and Wilcoxon (Gehan) statistics Other data are presented as mean ± SD Each experiment was conducted at least times and representative data are presented Unpaired ttests and 2-way ANOVA tests were used to statistically analyse other experimental data A p-value