Nghiên cứu bênh sán dây trên chó tại một số tỉnh ở đồng bằng sông cửu long và biện pháp phòng trị tt tiếng anh

MINISTRY OF EDUCATION AND TRAINING CAN THO UNIVERSITY SUMMARY OF DOCTORAL THESIS Major: PATHOLOGY AND TREATMENT OF ANIMALS Major code: 62 64 01 02 Nguyen Phi Bang Epidemiological investigation of tapeworm parasites in dog in some provinces of Mekong Delta and treatment measures Can Tho- 2020 THIS THESIS WAS COMPLETED AT CAN THO UNIVERSITY Academic supervisor: Assoc Prof DR Nguyen Huu Hung This thesis was defended against the Ph.D dissertation council at the university level Place: ………… Time: …………… 1st Opponent: …………… 2nd Opponent: ……………………… Reviewed Confirmation of Chairman ………… Thesis could be found at: Learning Resource Center, Can Tho University National Library of VietNam.- PUBLISHED ARTICLES Published Articles in journals Nguyen Phi Bang, Nguyen Thi Chuc, Nguyen Huu Hung, Nguyen Ho Bao Tran, 2016 Risk factors affecting helminth infections in dogs in Long Xuyen City, An Giang Province Can Tho University Journal Nguyen Phi Bang, Nguyen Ho Bao Tran, Pham Đuc Phuc, Nguyen Huu Hung, 2016 Tapeworms in dogs in two provinces of An Giang, Dong Thap and other tapeworm species are transmitted to humans Journal of ScienceTechnique of Veterinary Medicine Nguyen Phi Bang, Nguyen Thi Chuc, Nguyen Huu Hung, Nguyen Ho Bao Tran, 2016 Situation of helminth infection in dogs and correlation between risk factors for human infection in Long Xuyen city, An Giang province Journal of Science-Technique of Veterinary Medicine Nguyen Phi Bang, Nguyễn Ho Bao Tran, Nguyễn Huu Hung, 2016 Morphological and molecular biology characteristics of parasitic tapeworms in dogs in some Mekong Delta provinces Can Tho University Journal Nguyen Phi Bang, Nguyen Ho Bao Tran and Nguyen Huu Hung The situation of exogenous infection in dogs in An Giang province and determining the development cycle of dog flea caused by Ctenocephalisdes canis Journal of Malaria and Parasitic diseases control Chapter INTRODUCTION 1.1 Rationale The dog has been domesticated very early which has been widely cultivated all over the world for at least 10,000 years Dogs are close friends of humans, so they are also one of the sources of zoonotic disease In particular, tapeworm disease in dogs is a potential disease that seriously affects the health of dogs and humans The prevention of his pet is very concerned owners and strictly controlled by the vaccine has contributed greatly to limit the outbreak of infectious diseases but parasitic diseases, especially tapeworm cause strings still exist and very little attention Some parasitic tapeworms in dogs that can be transmitted to humans include Dipylidium caninum, Spirometra mansoni, Taenia hydatigena, etc This diseases often latent with low intensity which can lead to neglect and misdianosis if there are no specific diagnostic method At present, the control of veterinary hygiene in dog breeding and control of slaughtering has not been paid much attention by many localities, so the risk of spreading tapeworm and larvae in dogs will be very high The disease also occurs in developing countries and developed countries, which greatly affects the health of people and economies of many countries (Agnieszka Tylkowska et al., 2010; Jahangir Abdi et al., 2013) In Vietnam, especially in rural areas, most dogs are raised by free-release methods so tapeworm is very contagious, tapeworm eggs are widely distributed, tapeworm appears in many places and tends to increase which can seriously affect public health (Le Tran Anh and Nguyen Khac Luc, 2013) Because of the above reasons, the study aims to accurately assess the siatuation of tapeworm infection and provide an effective solution to minimize the damage cause by tapeworm in dog The thesis " Epidemiological investigation of tapeworm parasites in dog in some provinces of Mekong Delta and treatment measures" are conducted 1.2 The aim of thesis - Identifying the species, distribution, biological characteristics and influential factors to the tapeworm infection rate in dog the Mekong Delta - Suggesting the treatment methods for infected dog in Mekong Delta 1.3 Scientific significance - This is a systematic research about tapewowm in dog: determining the prevalence of infection and influential factors to the pathogen Species were identified by morphological and molecular characteristics (PCR and sequencing) - The life cycle of canine Dipylidium caninum in Mekong Delta were firstly researched: identifying intermediate host (fleas) Clinical symptoms and anthelminthic testing would be useful for diagnosis and treatment - This thesis provides documentations about tapeworm infected in dog (Mekong Delta), and supplies academic knowledge for veterinary parasitology books to education and training purposes 1.4 Practical significance - The thesis results is a scientific basis to recommend dog owners in the Mekong Delta It helps people to better undertand the epidemiological factor that effect the distribution of tapeworm diseases and treatment measures to minimize the harmful effects of tapeworm diseases causing harm on dogs that these species are capable of transmitting to humans 1.5 Innovative contributions of the thesis This is the first research about Dipylidium caninum of infected pets in Mekong Delta which were identified by applying molecular biology techniques This is also first research about the complete life cycle of Dipylidium caninum tapeworm Gross lesions and histopathological of Dipylidium caninum tapeworm were completely described which were provided background for quickly diagnosis and treatments Chapter II: CONTENTS AND METHODS OF RESEARCH 2.1 The research contents 2.1.1 Determining epidemiological characteristics of tapeworms in dogs in the Mekong Delta provinces - Determining the infection rate of tapeworms of dog in the Mekong Delta provinces by the fecal examination and necropsy methods 2.1.2 Identify some morphological and biological characteristics of Dipylidium caninum tapeworm in dogs in the Mekong Delta provinces - Identify some morphological characteristics of tapeworm D Caninum - Determining the species of D caninum by analyzing molecular biology chacteristics and sequencing 2.1.3 Research to determine the life cycle of tapeworm D caninum - Studying the development cycle of intermediate hosts and the infection rate of tapeworm larvae inside intermediate hosts to the stage of infection - Determining the life cycle of tapeworm in the definitive host through causing infection by larvae 2.1.4 Pathological research in dogs infected with tapeworm D caninum - Determine the clinical symptoms, gross lesions and histopathology on infected Dipylidium caninum dogs 2.1.5 Studing on treatments of D caninum tapeworm infected dogs - Testing the efficacy of tapeworms with niclosamide and praziquantel and suggest the efficient treatment on D caninum infected cattle 2.2 Subject, timeline and researching areas 2.2.1 Subjects: Dogs of six provinces in the Mekong Delta such as Can Tho, An Giang, Dong Thap, Kien Giang, Ben Tre and Soc Trang and Ctenocephalides canis on dogs 2.2.2 Timeline: from December 2014 to August 2018 2.2.3 Rearching areas The canine in provinces (Mekong Delta), slaughter houses, histologic laboratory in the Department of Veterinary Medicine – College of Agricultural and Applied Biology, Can Tho University; Anatomical pathology laboratory - University of medicine and pharmacy of Can tho 2.3 Materials and chemistry Necessary materials and chemistry for diagnosis and molecular biology techniques 2.4 Research methods 2.4.1 Identifying the prevelance of infected dog in Mekong Delta Subjects: - Fecal examination: modified sedimentation of Benedek (1943) - The autospy method: following the method of Skrjabine and Petrov (1963) -Observation targets The overall infected rate of tapeworm in dog, the infection rate of this disease according to seasons, husbandry methods, ages, and ecogeographic areas; the intensity of the infection ( the number of species/ individual) - Statistical analysis: Chi-Square test /Minitab program version to compare infection rates 2.4.2 Method of identification 2.4.2.1 Identification Method of tapeworm by morphology based on documents written by Soulsby (1982), Nguyen Thi Ky (1994) 2.4.2.2 Method of identification of D caninum tapeworms by molecular biology techniques (PCR) and sequence genes Collecting and storing DNA extraction samples Randomly select 12 D caninum tapeworm samples collected from small intestine of dog with tapeworm disease from six surveyed provinces The speciments was stored in physiological saline and brought to DNA laboration DNA extraction DNA concentration measurement PCR reaction: Primers for specific PCR reaction on the ITS gene were designed by an open source program with Primer3 software provided by Phusa Biochem, for Gene 28S primers designed according to research published by Beugnet et al., (2014) Table 3.1 3.1 Primer sequence corresponding to the target gene Gene Priming Temperature Priming sequence (5 '- 3') -Tm (oC) name name ITS1F/ITS1-R DC-1R:5'-CGTCCACTGTGCGTGGATCT-3' DC-1F:5’- CCATGGTATAGCCTCAGCC-3' 56 28S DC28S-1R DC28S-1R:5’CACATTCAACGCCCGACTCCTGTAG -3’ DC28S-1F:5’GCATGCAAGTCAAAGGGTCCTACG-3’ 56 ITS1 * Observation targets: - Identification of D caninum were done by morphological and molecular biology chacteristic - Comparasion the nucleotide sequence of target gene ITS-1 of D caninum among surveyed provinces and D caninum Collected worldwide in GenBank * Analyzing data: - BLAST the ITS-1 sequence (in NCBI) was used to identify the specific species, and comparing the level of similarity among multisequence by CLUSTAL OMEGA, analyzing Pairwise alignment/Calculate identity /Similarity for sequences (Bioedit) 2.4.3 Observe the life cycle of tapeworms D caninum 2.4.3.1 Studies of life cycle of Ctenocephalides canis and determine the infection rate of cysticercoid inside Ctenocephalides canis Methods for identifying flea species (Ctenocephalides canis) The method of identification of flea classification based on the description of the classification key of the authors Phan Trong Cung et al (1977), Bownman (2009), Pedro and Juliana, (2012), Krista and Phillip, (2014) Based on the basis of identification of flea classification and development stage of the larvae of flea to raise tapeworm infection, thereby determining the tapeworm development cycle from intermediate hosts to adulthood Determination of infection rate of oncosphere to cysticercoid inside Ctenocephalides canis Preparation for the experiment: Catch flea bites on dogs that have been tested for faeces but have not found Dipylidium caninum to feed and collect flea eggs, hatch into first stage larva Crushing and extract tapeworm proglottid, collecting tapeworm eggs, counting eggs determination of oncosphere (6-hook embryo) in tapeworm eggs infecting flea larvae (larva 1) Infecting flea larvae with oncosphere and collecting fleas for cysticercoid Flea scattering and visualization under a microscope with magnification of 100 and 400 find and collect cysticercoid The experiment tracked the oncosphere to cysticercoids ratio in intermediate hosts The experiment was divided into separate episodes, each infected with 100 larvae of Ctenocephalides canis stage Noting the rate of oncosphere transformed into cysticercoid inside Ctenocephalides canis maturation Observation targets: Appropriate temperature and humidity to the hatching rate of Ctenocephalides canis eggs, morphological characteristics and size of larvae, duration of morphological changes of Ctenocephalides canis through stages 2.4.3.2 Observing the length of time of larva stage of Dipylidium caninum in the final host Cysticercoid growth rate of adult tapeworm and proglottid excretion time of dog after cysticercoid infection Experimental survey of proglottid excretion time in dogs by Cysticercoid larvae of Dipylidium caninum was conducted on dogs> 24 months of breeds and tested without the tapeworm by Benedek (1943) method (Nguyen Thi Kim Lan, 2008) Observation targets: Proglottid excretion time and determination of the rate of cysticercoid developing into tapeworm maturation in experimental dog digestive system 2.4.4 Clinical symptoms and gross and histopathological changes on dog infected with D caninum 2.4.4.1 Clinical symptoms study in dogs infected with D caninum Observevational study of the condition and clinical manifestations of 60 dogs infected with D caninum in nature and dogs in experimental infection with D caninum Collect basic symptoms of tapeworm infection (Pham Sy Lang and Dao Huu Thanh, 1990; Heinz Mehlhorn, 2012; Nguyen Thi Kim Lan, 2017) 2.4.4.2 Researching about the gross lesions and histopathology in liver tissue causing by D caninum infection Investigation of gross lesions: The survey subjects were dogs that were infected with D caninum in experiments and 30 dogs infected with tapeworms from dog in Thoai Son district, An Giang province with the intensity of infection > 15 tapeworms D caninum/dogs, the study noted major lesions in the digestive system of tapeworm infected dogs (Heinz, 2012; Nguyen Thi Kim Lan et al , 2017) Observe and detect major lesions such as: localized hemorrhage, catapults, intestinal mucosa with inflammatory secretions, nodules and ulcers and especially dogs with severe gross lesions, typical intestinal lesions Investigation of microscopic changes: Perform microscopic lesions on dogs in infectious experiments: Cut intestinal samples, lymph nodes with visible changes or lesions from gross lesions for histological specimens Microscopic lesions are determined by the method of making the template according to paraffin casting, Hematoxilin - Eosin dyeing process (Ministry of Health, 2016) Observation targets: determining the frequency of clinical symptoms, gross and microscopic lesions 2.4.5 The effectiveness of Dipylidium caninum for tapeworm treatment of tapeworm treatment of drugs and ivermectine in flea treatment 2.4.5.1 Effect of treating tapeworm Dipylidium caninum of some drugs to treat tapeworm disease Prepare for the experiment Select dogs with tapeworm infection D caninum by testing methods of feces belonging to domestic and hybrid breed, at the age of> 24 months, average weight of 13.17 ± 1.91 kg Experimental drugs are praziquantel and niclosamide in different doses b Method of implementation Examination of feces to find mature proglottid of tapeworm 7, 14 and 21 days after drug administration The therapeutic effect is determined by checking the tapeworm clearance rate at different times after treatment, comparing the intensity of infection before and after treatment c Experimental setup to determine the effectiveness of D caninum treatment of praziquantel and niclosamide Experiments to determine the effectiveness of D caninum eradication of praziquantel and niclosamide in accordance with Table 3.8 Table 3.8 Determination of disease clearance rate of D caninum-infected dogs after treatment with praziquantel and niclosamide Experiments Methods Dosage Number of drug (mg/kg TT) of dog supply the number of dogs cured after Reduction rate (%) treatment (con) 14 21 14 21 Ngày Ngày ngày Ngày ngày Ngày Experiments Experiments Experiments Experiments Experiments 5 10 100 150 Oral Oral Oral Oral Không 10 10 10 10 - - - - - The eficacy of drugs after 7.14.21 days of treatment and observed the adverse effects of those drugs in treated cattle CHAPTER RESULTS AND DISCUSSION 3.1 The prevalence of tapeworm infected dog in Mekong Delta 3.1.1 Results of fecal examination Table 3.1 The prevalence of tapeworm infection in the Mekong Delta Local No of samples No of positive Prevalence % Can Tho 267 52 19.48a An Giang 414 108 26.09b Đong Thap 328 77 23.48ab Kien Giang 303 83 27.39b Soc Trang 339 54 15.93a Ben Tre 348 76 21.84bc Total 1999 450 22.51 Note: the values on the same column with different letters were statistically different P 24 months of age TLN SCKT SCN % 15 15,79 23 18.40 31 23.85 16 19.28 22 11.64 26 20.63 133 17.78a 124 130 130 127 105 67 683 36 41 39 49 47 25 237 TLN % 29.03 31.54 30.00 38.58 44.76 37.31 34.70b Note: the values on the same column with different letters were statistically different P