Thông tin tài liệu
MINISTRY OF EDUCATION AND TRAINING MINISTRY OF AGRICULTURE AND RURAL DEVELOPMENT VIETNAM ACADEMY OF AGRICULTURAL SCIENCES *** TRAN THI BINH NGUYEN EVALUATING GENETIC RESOURCES AND ANALYZING MOLECULAR MARKERS RELATED TO EGG YIELD TRAITS IN LIEN MINH CHICKEN BREED Specialization: Biotechnology Code number: 9420201 SUMMARY OF AGRICULTURAL DOCTORAL THESIS Hanoi, 2019 The dissertation has been completed at: Vietnam Academy of Agricultural Sciences Supervisors: Dr Nguyen Thi Dieu Thuy Dr Nguyen Huu Duc Reviewer 1: Reviewer 2: Reviewer 3: The dissertation will be defended at the Dissertation committee at the National level Vietnam Academy of Agricultural Sciences, on Date month year The full text of the dissertation can be found in the following libraries: - The National Library of Vietnam; - The Library of Vietnam Academy of Agricultural Sciences DANH MỤC CƠNG TRÌNH CƠNG BỐ LIÊN QUAN ĐẾN LUẬN ÁN Tran Thi Binh Nguyen, Nguyen Huu Duc, Do Vo Anh Khoa, Nguyen Thi Dieu Thuy (2018), “Effect of nucleotide polymorphism of candidate genes on egg production traits in native Lien Minh chicken”, Livestock Research for Rural Development 30(6) Tran Thi Binh Nguyen, Nguyen Huu Duc, Vu Duc Quy, Pham Thu Giang, Nguyen Manh Linh, Dinh Thi Ngoc Thuy, Nguyen Thi Dieu Thuy (2018) “Polymorphism in candidate genes of Lien Minh chicken”, Vietnam Journal of Agricultural Sciences 1(2), tr 174-182 Tran Thi Binh Nguyen, Nguyen Hung Cuong, Vu Thi Tien, Ta Thi Loan, Do Vo Anh Khoa and Nguyen Thi Dieu Thuy (2018).,“Association of neuropeptide gene polymorphism with egg production trait in Lien Minh chicken”, National Biotechnology conference 2018, Hanoi 26/10/2018, pp 1828-1833 Tran Thi Binh Nguyen, Nguyen Huu Duc and Nguyen Thi Dieu Thuy (2018), ,“Association of prolactin gene polymorphism with egg production trait in Lien Minh chicken”, Vietnam Journal of Biotechnology, 16(2), pp 1-8 Tran Thi Binh Nguyen, Do Thi Lieu, Nguyen Huu Duc, Hoang Thi Yen, Vu Cong Quy, Nguyen Hung Cuong and Nguyen Thi Dieu Thuy (2016), , “Reproductive characteristics and preliminary analysis on polymorphism of candidate genes concerning with egg production traits of Lien Minh chicken breed”, Journal of Animal Husbandry Sciences and Technics, 212, pp 2-8 INTRODUCTION The necessity of research Lien Minh chicken is an indigenous breed with several favorable properties, such as good meat quality and associated with the economic development of the people in the Lien Minh village, Cat Hai, Hai Phong Such breed comes in beautiful physical appearance with its nice feather color, yellow skin and produces high-quality meat with thinfat under the skin The source of the Lien Minh chicken gene was assessed at the level of dangerous threat (FAO, 2007), and has been listed on the conservation list since 2008 The conservation and efficient use of Lien Minh chicken were developed in 2013 Research results from more than 30 households studied in Tran Chau commune, Cat Hai district, Hai Phong city the grazing revealed that, aAge of first egg laying in Lien Minh chickens was quite late (197.5 days of age) and low egg yield 75.6 eggs/chicken/year (Doan BH et al, 2016) It is therefore essential to increase Lien Minh chicken egg production in order to conserve, exploit, and develop such poultry breeds Chicken egg production can be affected by a number of factors such as genetics, nutrition, light, and veterinary care regimes Among these factors, Genetic polymorphism is currently studied in order to improve economic characteristics of indigenous chickens The polymorphisms of PRL (Prolactin), VIP (Vasoactive Intestinal Peptide), VIPR1 (Vasoactive Intestinal Peptide Receptor 1), NPY (Neuropeptide Y), GH (Growth hormone) and GHR (Growth hormone receptor) have been defined to have significant association with fertility in some in some indigenous chicken breeds around the world Therefore, genetic polymorphism can be used as DNA markers to improve egg production in indigenous chickens Additionally, little research has been carried out on the evaluation of the genetic diversity based on the nucleotide sequence of D-loop mitochondrial genes in Lien Minh chickens The results of these studíe can be used to provide information on genetic diversity, to support for registering the copyright of the Lien Minh chicken breed Furthermore, this work is a solid foundation for building the panorama of Lien Minh chicken’s genetic diversity levels Therefore, "Evaluating genetic resources and analyzing molecular markers related to egg yield traits in Lien chicken breed” was implemented to provide genetic information of the D-loop region of mitochondrial genes and candidate genes improving egg production as well as support conservation, exploitation and development of Lien Minh chicken Research objectives - Evaluate genetic diversity of Lien Minh chickens based on sequences of mitochondrial DNA D-loop region - Determine the genetic relationship and the origin of Lien Minh chickens - Identif genetic relationships between candidate genes and egg yield traits in Lien Minh chickens Scientific and practical significance * Scientific significance - Provides the initial information about the sequence of mitochondrial D-loop region in Lien Minh chickens The first scientific publication to study the frequency of allele / genotype occurrence at the polymorphisms of PRL, VIP, VIPR1, NPY, GH, and GHR in Lien Minh chickens; - results on candidate genetic polymorphism with egg yield traits are the scientific database for the study of the application of molecular markers to support the selection of Lien Minh chickens that have high egg yield Provide information molecular markers of indigenous chickens Lien Minh for breeders, reference for researchers, students * Practical significance: Provide scientific information to promote and develop the market for indigenous chickens Lien Minh products Provide scientific information to promote and develop the market for indigenous chickens Lien Minh products Provide information for the Hai Phong Center for Science and Technology Application, companies and livestock farms to select the line Lien Minh chickens with high egg production Object and scope of the study - The thesis applied bioinformatics tools to assessing the genetic resource of Lien Minh chickens: Analyzing the nucleotide sequence of mtDNA D-loop region of Lien Minh chicken to assess the diversity of genetic resources - Determine genotypic and allelic frequency of at PRL, VIP, VIPR1, NPY, GH, and GHR genes in Lien Minh chickens - Assess the relationship between polymorphisms of PRL, VIP, VIPR1, NPY, GH, and GHR genes and egg production traits Subject of research and scope of research Subjects of research: Lien Minh indigenous chickens in Tran Chau commune, Cat Hai district, Hai Phong city Scope of research: The Thesis applied biotechnology and bioinformatics tools to analyze the genetic diversity of Lien Minh chicken, and to support conservation, exploitation and development of Lien Minh chickens The Thesis focused on candidate genes related to egg production ability, so that the target genes could be identified, Contributing to the selection of Lien Minhchicken with high egg yield Structure of the thesis The thesis comprises of 107 pages (apart from references and appendices), including: Introduction (5 pages); chapter 1: Literature review (37 pages); chapter 2: Materials contents and methods (8 pages); chapter 3: Results and discussion (50 pages); Conclusion and recommendations (2 pages) The paper uses 180 references, 33 of which are in Vietnamese and 147 others are in English The thesis includes 32 tables, 44 figures, appendices and publications CHAPTER LITERATURE OVERVIEW The thesis has used to and analyzed 33 reference materials in Vietnamese and 147 materials in English, which relate to the following contents: The mitochondrion is a double-membrane-bound organelle found in most eukaryotic organisms Mitochondrial genomes are about 16 kb in almost all animals Mitochondrial DNA is the DNA located in mitochondria with characteristics: i) multiple number of copies; ii) exist in a haploid form and have almost no recombination; iii) relatively fast mutation rates and iv) mother line genetics in most species, so it is used as a tool in analysis between evolutionary relationships and evaluation of genetic variation within and between species (Harpending et al, 1998) The nucleotide sequence in D-loop region is the fastest evolving region compared to that of mtDNa, Making it an appropriate region in in analyzing population genetic diversity, especially internal changes of the same species To study the low reproductive rate in Lien Minh chickens, the loci associated with reproductive traits (candidate genes) were selected derived from the knowledge of reproductive physiology and reports as to whether these genes showed an association with reproductive performance in commercial poultry lines Prolactin is a polypeptide hormone secreted by the anterior pituitary gland, which is involved in many physiological pathways: osmotic regulation, luteolysis (regressive ovary) and the maintenance of incubation behavior in hens Studies have shown that the PRL is present in the hypothalamus, the pituitary gland, the oviduct, and the egg, with the highest levels found in the pituitary gland (Li et al, 2009a) In chickens, the hormone prolactin is one of the hormones that plays an important role in egg production Prolactin concentrations increase sharply in plasma, may induce broody behavior (Sockman et al, 2000), and results in reduced egg production (Reddy et al, 2002) A mutation that occurs in the promoter region can affect the expression of the PRL gene, so it may affect egg production Prolactin secretion in birds is predominantly regulated by releasing factors, one of which is a vasoactive intestinal peptide (Kagya-Agyemang et al, 2012) Vasoactive intestinal peptide (VIP) is a prolactin-releasing factor in birds (El Halawani et al, 1990; 1997) VIP increases PRL secretion from pituitary glands, especially when the pituitary gland responsiveness is enhanced with estrogen pretreatment (Sharp et al, 2005) VIP binds with the vasoactive intestinal peptide receptor to give rise to the secretion and release of PRL (El Halawani et al, 1990) Neuropeptide Y (NPY) is an important neuromodulator, which is associated with gonadal function in birds and mammals (Hilal et al, 1996) NPY may affect the egg production rate through its role in controlling ovulation (Dunn et al, 2004) Genetic encoding for the neuropeptide Y gene is associated with the age of having the first egg and the number of eggs laid (Xu et al, 2011a, Xu et al, 2011b, Dunn et al, 2004, Li et al, 2009b) The NPY gene might produce markers for the age of the onset of lay, and through its role in the control of ovulation, influence the egg production rate Injections of NPY change the plasma concentration of the luteinizing hormone and growth hormone (Pierroz et al, 1996), suggesting that it may play a significant role in the secretion of these hormones (Wang et al, 2001) Growth hormone (GH), when combined with the growth hormone receptor in the liver and when forming the GHGHR-IGFs signal pathway, affects chicken development (Lau et al, 2007) The identified alleles of the GH gene of White leghorn have been linked to the egg production phenotype (Kuhnlein et al, 1997) The growth hormone receptor (GHR) controls the number of follicles in animals that are recruited to the rapid growth phase (Roberts et al, 1994; Monget et al, 2002) Lien Minh breed comes in beautiful physical appearance with its nice feather color, yellow skin and produces high-quality meat with thin subcutaneous fat layer, crispy and chewy skin It also possesses long legs and neck silky fur The rooster has a good appearance, colorful feathers and it can weigh up to 5kg, and a hen has 3kg The market demand for Lien Minh chicken is very large, but in the small-scale farming conditions and extensive farming methods, Lien Minh hamlet and surrounding areas only meet a very small part of market demand in Cat Hai district and Hai Phong city, typically in Cat Ba Therefore, the study evaluated the genetic diversity of Lien Minh chickens by using the D-loop nucleotide sequence, at the same time using genes related to fertility to find gene polymorphisms can improve egg yield in Lien Minh chickens CHAPTER MATERIALS, CONTENTS AND METHODS 2.1 MATERIALS 2.1.1 Animal materials 2.1.1.1 Chicken population Blood samples of Lien Minh chicken raised in households in Lien Minh village were collected for genetic diversity analysis Lien Minh chickens were selected based on the following criteria: Limiting blood ties (from different farming households in Lien Minh village, Tran Chau commune, Cat Hai district, Hai Phong), roosters (n = 12 individuals) and hens (n = 12 individuals), mature individuals with typical characteristics of the breed, confirmed by breeders participating in the project "Exploitation and development of Lien chicken Minh in Hai Phong "at Decision No 2398 / QD-BKHCN dated August 31, 2012 of the Minister of Science and Technology In addition, two indigenous chicken breeds are Dong Tao chicken - GDT (n = 18) and Chicken Many Finger - G9C (n = 6) were sampled from the locality where they originated (Khoai Chau District, Hung Yen and Xuan Son National Park, Phu Tho) 2.1.1.2 Sample collection (or Egg collection) We collected Lien Minh chicken eggs at households in Lien Minh hamlet Then eggs were hatched, tended, vaccinated and monitored at Hai Phong City of Science and Technology Application Center in an individual form from hatching (01 day old) to 44 weeks of age Lien Minh chickens received the same veterinary cared, nutrition, environment and evaluated characteristics egg production traits 1.1.1.3 Primer sequences used for amplification in thesis Table 2.2 Primer sequences used for amplification of the D-loop region Locus Polymophism mtDNA D-loop Primer sequences [5’ -3’] F: AGGACTACGGCTTGAAAAGC R: CATCTTGGCATCTTCAGTGCC Ta (oC) PCR size ([bp] 56 1321 References Oka et al, 2007 Table 2.3 Primer used in candidate gene analysis Locus PRL Polymophism Primer sequences [5’ -3’] C-2402T (PRL5) 358/indel 24bp(PRL24) F: AGAGGCAGCCCAGGCATTTTAC R: CCTGGGTCTGGTTTGGAAATTG F:TTTAATATTGGTGGGTGAAGAGACA R: ATGCCACTGATCCTCGAAAACTC F: AGAGGCAGCCCAGGCATTTTAC R: CCTGGGTCTGGTTTGGAAATTG F:GCTTGGACTGATGCGTACTT R:GTATCACTGCAAATGCTCTG F: GCTTGGACTGATGCGTACTT R: GTATCACTGCAAATGCTCTG C2161G C+338T VIP G5138982T Ta (oC) PCR size ([bp] References 56 439 Cui et al, 2006 54 154/130 Xu et al, 2011 56 439 Cui et al, 2006 55 520 Zhou et al, 2010 55 520 Xu et al, 2011a C1715301T (VIPR1/TaqI) C1704887T (VIPR1/ HhaI) Indel bp 3139135 VIPR1 NPY C31394761T GH C2983T GHRi2 A294-541G GHRi5 C571T F:CTCCTCAGGCAGACCATCATG R:CTTGCACGTATCCTTGGGTAGC F:CCCCGTTAAACTCAGCAGAC R:CCCAAAGTCCCACAAGGTAA F: TCTCAGAGCTCCAACGTATGA R: ATATTTCTGTGCCTGAACAACA F:CGTGGCTGCTTTGCTTCCTTTC R:GGGGTACGAGGCAAGGACATG F: CTAAAGGACCTGGAAGAAGGG R: AACTTGTCGTAGGTGGGTCTG F: GGCTCTCCATGGGTATTAGGA R: GCTGGTGAACCA ATCTCGGTT F: ACGAAAAGTGTTTCAGTGTTGA R: TTTATCCCGTGTTCTCTTGACA 61 486 Xu et al, 2011 61 434 Xu et al, 2011 56 248 Xu et al, 2011a 58 324 Xu et al, 2011 62 1164 Makhsous et al, 2013 58 718 Li et al, 2008 60 750 Li et al, 2008 F: Forward primer; R: Reverse primer; T (a): Annealing temperature Components of the cut reaction (total volume of a 15 µl reaction): deionized water (2,5 µl), 10X cutting buffer (1,5 µl), PCR product (10 µl), restriction enzyme (1 µl), the incubation time is 16 hours, the incubation temperature is corresponding to each enzyme cut (Table 2.4) Table 2.4 Information for polymorphisms and restriction enzyme (RE) Polymophism RE GenBank accession number PCR-RFLP size [bp] Ta [oC] C-2402T (PRL5) AluI AB011438 439/304/160/144/81/54 37 - AF288765 154/130 37 C2161G Csp6I AB011438 439/405/34 37 C+338T HinfI NC_006090 520/480/40 37 G5138982T ApoI NC_006090 520/486/34 37 C1715301T TaqI NC_006089 486/310/176 65 C1704887T HhaI NC_006089 434/253/181 37 Indel bp 3139135 DraI M87298 248(252) 167/81 37 C31394761T KpnI GI:35797382 GH C-2983T SacI JN675393 1164/1020/ 570/450/144 37 GHR C571T (intron 5) NspI NC_006127 750/550/200 37 GHR A294-541G (intron 2) HinIII NC_006127 718/428/290 258/170/290 37 Locus PRL VIP VIPR1 NPY – 358/ indel 24 bp (PRL24) 324/200/124 200/124 37 Manufacturer Themo, America Themo, America Themo, America Themo, America Themo, America Themo, America Themo, America Themo, America Themo, America Themo, America Themo, America Themo, America 2.1.2 The chemicals Chemicals used in molecular biology research of Sigma (Germany), Merck (Germany), and Thermo (USA) 2.1.3 Machinery used PCR machine eppendorf AQ mastercycle 5332YN056927 (Germany), horizontal electrophoresis machine FCIE-PLAS-HU1030012479 (UK), water bath (JSRJSWB22T-Korea), storage refrigerator 40C (Panasonic - Japan), gel scanner (UVP-M6 26V / P / N95-0458-02, USA), centrifuge (HETTICH-UNI version 320R, Germany), egg pressure gauge, Nano Drop Spectrophotometer 2.2 RESEARCH CONTENT - Content 1: Assessing genetic diversity of Lien Minh chicken based on mitochondrial DNA - Content 2: Analyzing the relationship between genetic markers and egg production traits in Lien Minh chicken + Experiment 1: Identifying indicators related to egg production traits in 90 Lien Minh hens; + Experiment 2: Determining genotypic and allelic frequency in candidate genes (PRL, VIP, VIPR1, NPY, GH and GHR) related to egg yield traits; Identifing the relationship between candidate genes and egg yield traits in Lien Minh chickens 2.3 METHODS 2.3.1 Blood sampling The blood samples from Lien Minh chickens were taken with a ml syringe from the vein of the wing vein, then quickly transferred to a blood tube containing EDTA-K anticoagulant Blood tube was stored at 4ºC, and -20ºC in the lab 2.3.2 DNA extraction Genomic DNA was extracted by a standard procedure using Proteinase K digestion followed by phenol-chloroform extraction and precipitation with ethanol (Ausubel et al, 1995) A nanodrop spectrometer and agarose gel electrophoresis were used to estimate DNA concentration and purity DNA samples were stored at -20oC until analysis 2.3.3 PCR amplification The PCR primers were designed based on the chicken candidate gene sequences using Primer 3.0 software PCR was performed in a 25 µl reaction containing 1x PCR Buffer, 1.5 mM MgCl2, 1.25 mM each dNTPs, pM primer, 1U Taq-polymerase (Fermentas), and 100 ng genomic DNA In PCR amplification, an initial denaturation at 94oC for three minutes followed by 35 cycles of denaturation at 94oC for 45 seconds, annealing for 45 seconds and extension at 72oC for 90 seconds, and an additional extension of 72oC for seven minutes was set 2.3.4 PCR purification and gene sequencing Purification of DNA fragments for sequencing: The purification process was used with the QIAquick PCR Purification Kit (QIAGEN) The purified product was MH425591 to MH425608 3.1.4 Analysis of nucleotide polymorphism in D-loop region of Lien Minh chickens and other native chickens with code on Genbank 3.1.4.1 Diversity analysis in D-loop region DnaSP was used to analyze the nucleotide polymorphism in mtDNA D-loop region of Lien Minh chicken The analytical parameters include: Number of polymorphic sites (S); number of haplotype (h); haplotype diversity (Hd); nucleotide diversity (Pi); Tajima test (D) The analysis results of the nucleotide polymorphic parameters (1050 bp) in Lien Minh chickens, other native chickens in Vietnam were shown in Table 3.2 Table 3.2: Polymorphic sites, haplotype and nucleotide diversity of chicken breeds Breeds Lien Minh Dong Tao Nhieu Ngon N 24 18 S 23 11 h 12 Hd 0.913 0.856 0.867 Pi 0.007 0.004 0.002 NC 1 D 0.187* 1.721* 0.562* N: number of samples, S: number of polymorphic sites (excluding sites with gaps), h: Number of haplotypes, Hd: Haplotype diversity, Pi: nucleotide diversity, NC: number of clades, D:Tajima’s test 3.1.4.2 Polymorphic nucleotide sequence in D-loop region a Analysis of D-loop nucleotide polymorphisms between Lien Minh chickens and native Vietnamese chicken breeds (455 bp) The analysis results indicate, there were 21 nucleotide substitution sites and no nucleotide insert/deletion polymorphism when compared to a native Vietnamese chicken coded GU564373 (Dong Tao chicken) Figure 3.4 showed that among 21 nucleotide substitution sites there are 11 T→C substitutive positions, four A→G substitutive positions, five substitutive positions C→T, but only one G→A substitutive nucleotide sites Especially, T→C substitution at position 241 appeared in all Lien Minh chickens, in addition this substitution at position 206 appeared in 17 of 24 studied samples b Analysis of D-loop nucleotide polymorphisms between Lien Minh chickens and native breeds in the world (in Genbank) The results showed that from 24 nucleotide sequences were identified by 23 nucleotide polymorphic positions between Lien Minh chicken and the branch E breed with code AB268540 (Gallus gallus domesticus), including 22 nucleotide substitution sites and a nucleotide insert site Special nucleotide G insertion at position 860 appears in all Lien Minh chickens Besides, nucleotide substitution T→C appears in 10 positions (167, 199, 217, 243, 246, 256, 270, 315, 367, 888) and substitutions C→T appears only in position 225, 261, 310 and 446 10 3.1.4.3 Nucleotide identity of D-loop region a Analysis nucleotide identity of D-loop region between Lien Minh chickens and native Vietnamese chicken breeds (455 bp) Mostly, genetic diversity of indigenous chicken was analyzed by using 455 bp Dloop region (Le Tien et al, 2009; Cuc et al, 2011) Therefore, 455 bp D-loop region was used to compare the level of nucleotide diversity of D-loop between Lien Minh chicken and other Vietnam native chickens The analytical results indicated that the nucleotide identity among Lien Minh chickens reached 97.5% - 100%, in which 14 Lien Minh individuals of Group I have the nucleotide identity of 100% (GLM 01, GLM02, GLM03, GLM06, GLM 07, GLM 08, GLM 09, GLM 11, GLM12, GLM13, GLM14, GLM15, GLM16 GLM18) have Nucleotide identity index that reaches 100% The above Lien Minh chickens have a nucleotide identity to the Lien Minh chickens group II (GLM10 and GLM17) reaching 97.5% As demonstrated from the pairwise comparison that the Lien Minh chickens shared high nucleotide identity with their native counterparts in Vietnam, ranging from 96.8 to 99.7% Particularly, the percent nucleotide identity of group I Lien Minh chicken (n=14) compared to branch B native chicken ranged from 99.3 to 99.7% Also, Lien Minh chickens in this group have a high nucleotide identity coefficient when compared to Dong Tao and Multi-Finger chickens (99.1-99.7) On the contrary, when compared to Vietnamese native chicken breeds in branches C, D, E, G, I, the percent nucleotide identity of Lien Minh chickens in group I reaching only from 97,3 % to 97,9% Lien Minh chickens of group II (GLM10 and GLM17) shared a high percent nucleotide identity compared to native chickens in branch B8 (99.1%), while the nucleotide identity of Lien Minh chickens in group III (GLM04, GLM19, GLM23), GLM24) reached 99,1% of nucleotide identity whenc compared with the Vietnamese native chickens in D1 branch Lien Minh chickens in group IV (GLM20) and group V (GLM05) had high nucleotide identity with Vietnamese native chickens of branch C1 (99.5-99.7%) Lien Minh chickens of groups VI (GLM21) and VII (GLM22) had high percent nucleotide identity to those of E1 branched chickens (99.3-99.5%) b Analysis of D-loop nucleotide identity between Lien Minh chickens and domestic chickens in the world (1050 bp) 1050 nucleotides in the D-loop region of Lien minh chicken were used to compare with the native chickens of the world (Oka et al, 2007) Result analysis illustrated that the nucleotide identity coefficient among Lien Minh chickens reached 11 98.7% - 100% In particular, Lien Minh chickens in groups I (GLM 01, GLM 07, GLM 08, GLM 09, GLM 11), group II (GLM02, GLM18), group III (GLM12, GLM13, GLM14, GLM15), group IV ( GLM06) and group V (GLM03, GLM16) shared a fairly high nucleotide identity from 99.7% to 99.9%, Lien Minh chickens in the same group have a nucleotide identity of 100% The nucleotide identity of Lien Minh chickens and domestic chickens according to research results of Oka et al (2007) reached 98.2% - 100% Lien Minh chickens of groups I, II, III, IV and V shared nucleotide identity with chickens of branch E1, E2, E3, E4 (Oka et al, 2007) reaching 99.6% - 100.0% Lien Minh chickens GLM10, GLM17, GLM21, GLM22 shared a high nucleotide identity with chicken in branch A (99.6% - 100.0%),Lien Minh chickens of group VIII (GLM04, GLM19, GLM23, GLM24) shared a high nucleotide identity with domestic chickens in branch C, reaching 99.5% The nucleotide identity between GLM05, GLM20 with branch D chicken is 99.8-99.9% On the other hand, the nucleotide identity is lower when compared Lien Minh chicken breed to the domestic chicken in branches G, F, merely ranged 98.2 to 99.2% 3.1.4.4 Distribution Haplotype Lien Minh chickens Using DnaSP software version 5, determine haplotype on 1050 bp and 455 bp Dloop region A total of 12 haplotypes in 24 Lien Minh chickens based on 1050 bp of mtDNA D-loop sequence, with in are focused most on three haplotypes (1, and 8) Beside this, a total of haplotypes in 24 Lien Minh chickens based on 455 bp of mtDNA D-loop sequence, with in are focused on haplotype (14 chickens) 3.1.4.5 The Phylogenetic analysis of the Lien Minh chicken is based on the Dloop nucleotide sequence a Phylogenetic analysis between Lien Minh chicken and native Vietnamese chicken breeds (455 bp) Phylogenetic tree was constructed based on 48 D-loop sequences (24 GLM sequences, six G9C sequences and 18 GDT sequences) along with 11 reference sequences that corresponded to the nine clades defined by Liu et al, (2006) and 37 sequences of indigenous Vietnamese chickens distributed seven branches (Cuc et al, 2011) Using 455 bp D-loop mitochondrial DNA to determine the genetic relationship between Lien Minh chickens and native Vietnamese chicken breeds (Figure 3.10) 12 Figure 3.10 The phylogenetic tree in Lien Minh chicken with native Vietnamese chickens The phylogenetic tree was generated by the neighbor‐joining method using MEGA6.1 with bootstrap values for interior clades after 1,000 replications Different clades and haplotypes are indicated GLM, GNN, and GDT breeds are marked (circle●, triangular▲, and square■, respectively) Numbers in bracket are number of samples that appeared at identical haplotype 13 As can be seen from the Phylogenetic tree which was constructed based on Dloop, Lien Minh chickens were distributed on seven haplotypes of clades (A, B, C, D, E) In general, 58,3% of the Lien Minh chickens were presented in clade B that has also known as the dominant clade of indigenous Vietnamese chickens and Southeast Asia In this study, no samples of Lien Minh, Dong Tao, Many Finger chicken breeds were distributed in clades G, H, I and F This result was consistent with the study of Cuc et al (2011) b Phylogenetic analysis between Lien Minh, Dong Tao, Many Fingers chicken breeds and the world native chicken breeds (455 bp) Figure 3.11 Phylogenetic tree in Lien Minh chicken with native chickens in the world The phylogenetic tree was generated by the neighbor‐joining method using MEGA6.1 with bootstrap values for interior clades after 1,000 replications Different clade and haplotype are indicated GLM, GNN and GDT breeds are marked (circle●, triangular▲ and square■, respectively) Numbers in bracket are number of samples appeared at identical haplotype Phylogenetic tree was constructed based on 48 D-loop sequences (24 GLM sequences, six G9C sequences and 18 GDT sequences) along with 11 reference 14 sequences that corresponded to the seven clades defined by Oka et al (2007) Using 1050 bp of D-loop region and using NJ method to build Phylogenetic tree for Lien Minh chicken, Multi Finger chicken, Dong Tao chicken and domestic chicken in the world Results showed that, 24 GLM samples were observed in five clade A, B, C, D and E Specifically, 14 samples (58.3%) of Lien Minh chickens belonging to haplotype 1, 2, and were distributed in clade E Previous studies have shown that chickens of clade E were observed in indigenous chickens in Asia, China, Laos, Japan and India (Liu et al, 2006, Oka et al, 2007, Cuc et al, 2011, Kawabe et al, 2014) and were not observed in native African chickens (Miao et al, 2013) 3.2 ANALYSIS POLYMORPHISM IN CANDIDATE GENES RELATED WITH EGG PRODUCTION TRAITS IN LIEN MINH CHICKEN 3.2.1 Track five egg production traits related to egg yield traits of 90 Lien Minh chickens Experiment was conducted on 90 hens which were kept in separate cages for the period of egg laying (25-44 weeks old) All hens were fed with same diet and veterinary indicators during the experiment aiming to evaluate the correlation between candidate genes and egg yield traits in Lien Minh chickens During the 20-week spawning period, each Lien minh chicken individual was evaluated on a daily basis against five egg production traits which are as follows age at first egg, first egg’s weight, number of eggs, eggs’ weight, and egg’s shape index (D/d) 3.2.2 The frequencies of the alleles and genotypes of polymorphisms of PRL, PRLR, VIP, VIPR1, NPY, GH and GHR; analyze the relationship with egg yield traits in Lien Minh chickens 3.2.2.1 DNA extraction 3.2.2.2 The frequencies of the alleles and genotypes of polymorphisms of PRL and its association with egg yield traits a PCR amplification of gen PRL b Polymorphic analysis of PRL gene by restriction enzyme c Identification of PRL polymorphism by nucleotide sequencing d Analysis of the frequencies of the alleles and genotypes of polymorphisms of PRL Table 3.6 illustrates polymorphisms of PRL24, PRL/2161genes were not significantly different from the distribution expected under the assumption of Hardy Weinberg equilibrium (P>0.05) The PRL/2402 polymorphism did not follow the Hardy-Weinberg equilibrium (P
Ngày đăng: 22/01/2020, 20:06
Xem thêm:
