To investigate the molecular characteristics and genotype distribution of Pneumocystis jirovecii in HIV/AIDS patients who were admitted to the National Hospital for Tropical Diseases. Subjects and methods: Prospective and cross-sectional description. 31 HIV/AIDS patients infected with P. jirovecii and confirmed by bronchoscopy and realtime PCR from 01 - 2014 to 12 - 2017 were included for this study. Results and conclusions: Nucleotide analysis revealed that no nucleotide alteration occured in the loci β-TUB, CYB, DHFR, DHPS, whereas minor variable positions were observed in the SOD locus. The most frequent nucleotide variation was found in three loci: mt26S, 26S and ITS1. Based on the nucleotide variation, the SOD locus was classified into two genotypes (SOD and SOD6), the mt26S locus was classified into 14 genotypes (2, 7, 8, 11, 12, 15, 16, 17, 18, 19, 20, 21, 22, and 23), the ITS1 locus was classified into 14 genotypes (A1, A2, A3, A4, A5, A6, B1, B2, B3, B7, B8, B9 and B10), and the 26S locus was classified into 4 genotypes (1, 11, 12, and 13). Several new genotypes were only distributed in the P. jirovecii strains circulating in Vietnam.
Journal of military pharmaco-medicine no7-2019 MOLECULAR CHARACTERISTICS AND GENOTYPE DISTRIBUTION OF Pneumocystis jirovecii IN HIV/AIDS PATIENTS IN NATIONAL HOSPITAL FOR TROPICAL DISEASES FROM 2014 - 2017 Nguyen Tuan Anh1; Do Quyet2; Nguyen Huy Luc3 SUMMARY Objectives: To investigate the molecular characteristics and genotype distribution of Pneumocystis jirovecii in HIV/AIDS patients who were admitted to the National Hospital for Tropical Diseases Subjects and methods: Prospective and cross-sectional description 31 HIV/AIDS patients infected with P jirovecii and confirmed by bronchoscopy and realtime PCR from 01 - 2014 to 12 - 2017 were included for this study Results and conclusions: Nucleotide analysis revealed that no nucleotide alteration occured in the loci β-TUB, CYB, DHFR, DHPS, whereas minor variable positions were observed in the SOD locus The most frequent nucleotide variation was found in three loci: mt26S, 26S and ITS1 Based on the nucleotide variation, the SOD locus was classified into two genotypes (SOD and SOD6), the mt26S locus was classified into 14 genotypes (2, 7, 8, 11, 12, 15, 16, 17, 18, 19, 20, 21, 22, and 23), the ITS1 locus was classified into 14 genotypes (A1, A2, A3, A4, A5, A6, B1, B2, B3, B7, B8, B9 and B10), and the 26S locus was classified into genotypes (1, 11, 12, and 13) Several new genotypes were only distributed in the P jirovecii strains circulating in Vietnam * Keywords: Pneumonia; Pneumocystis jirovecii; HIV/AIDS; Genotype; Locus INTRODUCTION Pneumocystis jiroveci is an abnormal opportunistic pathogen that causes severe pneumonia in immunocompromised people with high mortality rates [1] Until the 1980s, P jirovecii was not common and mainly infected people with immunodeficiency syndrome or individuals using prolonged immunosuppressive drugs, especially cancer chemotherapy [2] However, in the regions with HIV/AIDS epidemic, P jirovecii emerged as the most common infectious pathogen in HIV/AIDS patients In the past, there was no specific preventive regimen for P jirovecii, this infectious pathogen was found in more than 60% of HIVinfected patients and over 80% of patients with less than 200 CD4 cells were infected by P jirovecii [11, 12] After the introduction of the first- and the secondline prophylaxis for P jirovecii in the early 1990s, the incidence of P jirovecii in HIV/AIDS patients decreased significantly, National Hospital for Tropical Diseases Vietnam Military Medical University 103 Military Hospital Corresponding author: Nguyen Tuan Anh (dranhnhtd@gmail.com) Date received: 22/07/2019 Date accepted: 27/08/2019 107 Journal of military pharmaco-medicine no7-2019 and continued to decline after treatment with high activity antiretroviral drugs (HAART) in the mid-1990s [9, 10] However, P jirovecii continues to be a common opportunistic pathogen with high morbidity and mortality rates in the era of industrialization P jirovecii is still one of the common threats to HIV/AIDS-infected patients [9], especially in patients who did not know they were infected with HIV or did not receive medical check regularly Because P jirovecii is difficult to detect, the infection with this fungus is almost undiagnosed in developing countries [3] Therefore, molecular characterization and genotyping of P jirovecii pathogen circling in Vietnam are highly necessary in order to improve understanding of pathogenic characteristics of this fungus In this study, we aim: To molecularly characterize and to determine the genotype distribution of P jirovecii in HIV/AIDS patients in the National Hospital for Tropical Diseases during the period from January 2014 to December 2017 SUBJECTS AND METHODS Subjects A total of 31 bronchial lavage specimens from HIV/AIDS patients infected with P jirovecii confirmed by realtime PCR were collected from - 2014 to 12 - 2017 Methods * Study design: Prospective and cross-sectional description * Procedure of the study: - Materials: Qiagen Kit (USA) was used for DNA extraction and PCR amplification and Applied Biosystem Kit (USA) was use nucleotide sequencing - Primers for PCR and sequencing [13] (table 1): Target gene mt26S 26S rDNA ITS1 β-TUB SOD CYB DHPS DHFR 108 Primer Nucleotide sequence (5’-3’) PCR (bp) mt26S-F GATGGCTGTTTCCAAGCCCA 347 mt26S-R GTGTACGTTGCAAAGTACTC 26S-F GAAGAAATTCAACCAAGC 26S-R ATTTGGCTACCTTAAGAG ITS1-F CTGCGGAAGGATCATTAGAAA ITS1-R CGCGAGAGCCAAGAGATC β-Tubulin-F TCATTAGGTGGTGGAACGGG β-Tubulin-R ATCACCATATCCTGGATCCG MnSODFw GGGTTTAATTAGTCTTTTTAGGCAC MnSODRw CATGTTCCCACGCATCCTAT CytbFw CCCAGAATTCTCGTTTGGTCTATT CytbRw AAGAGGTCTAAAAGCAGAACCTCAA Ahum GCGCCTACACATATTATGGCCATTTTAAATC Bhs’ ACCTTCCCCCACTTATATC FR208 GCAGAAAGTAGGTACATTATTACGAGA FR1018 AAGCTTGCTTCAAACCTTGTGTAACGCG 426 204 309 652 638 318 610 Journal of military pharmaco-medicine no7-2019 - Equipment: ProLex PCR machine (Applied Biosystem, USA), MuPis (Japan), 3130 sequencer (Applied Biosystem, USA) - PCR amplification was done according to the method of Céline Maitte et al [13], PCR component to amplify 08 target loci includes 0.5 µL of primers, X Qiagen Multiplex PCR master mix and µL of DNA template The thermal cycle begins by activating HotStarTaq DNA Polymerase at 95°C for 15 minutes, repeating 35 cycles of denaturation at 94°C for 30 seconds, 60°C for 45 seconds and 72°C for minute PCR products were then run on 1.5% agarose gel - The PCR products were then purified by using Qiagen PCR purification kit and purified products were used as template for sequencing PCR using BigDye™ Terminator v.3.1 (Applied Biosystems, Foster City, CA, USA) according to the manufacturer’s instructions The forward and reverse primers for the mt26S, 26S, ITS1, SOD, β-TUB, DHPS, and DHFR genes were used for sequencing PCR - Genotyping: The DNA sequences of the loci were compared with the reference sequences of the mt26S, 26S, ITS1, SOD, β-TUB, DHPS, and DHFR genes from GenBank (GenBank - NCBI) using ATGC software 7.2 (Japan) to identify genetic variations of P jirovecii RESULTS AND DISCUSSION Genetic variations of 08 loci Table 2: The determination of nucleotide variation of 08 loci from 31 P jirovecii strains Sample ID Genotype of each locus mt26S 26S β-TUB ITS1 CYB SOD DHFR DHPS β-TUB A3 CYB1 SOD Wt Wt β-TUB A3 CYB1 SOD Wt Wt 11 β-TUB A3 CYB1 SOD Wt Wt β-TUB A2 CYB1 SOD Wt Wt β-TUB A6 CYB1 SOD Wt Wt β-TUB A1 CYB1 SOD Wt Wt 7 β-TUB A1 CYB1 SOD Wt Wt 12 β-TUB A1 CYB1 SOD Wt Wt 12 β-TUB B7 CYB1 SOD Wt Wt 10 15 13 β-TUB A2 CYB1 SOD Wt Wt 11 16 11 β-TUB A2 CYB1 SOD Wt Wt 109 Journal of military pharmaco-medicine no7-2019 12 17 β-TUB A5 CYB1 SOD Wt Wt 13 18 β-TUB A2 CYB1 SOD Wt Wt 14 19 β-TUB B8 CYB1 SOD Wt Wt 15 β-TUB ND CYB1 SOD Wt Wt 16 11 β-TUB B9 CYB1 SOD Wt Wt 17 20 12 β-TUB B2 CYB1 SOD Wt Wt 18 17 12 β-TUB A1 CYB1 SOD Wt Wt 19 21 β-TUB B CYB1 SOD Wt Wt 20 11 12 β-TUB B CYB1 SOD Wt Wt 21 21 β-TUB B1 CYB1 SOD Wt Wt 22 β-TUB A4 CYB1 SOD Wt Wt 23 22 β-TUB A2 CYB1 SOD Wt Wt 24 23 β-TUB B3 CYB1 SOD Wt Wt * 25 12 β-TUB ND CYB1 SOD Wt Wt 26 21 β-TUB B10 CYB1 SOD Wt Wt * 27 13 β-TUB ND CYB1 SOD Wt Wt 28 22 β-TUB B3 CYB1 SOD Wt Wt 29 11 β-TUB A2 CYB1 SOD Wt Wt 30 11 β-TUB B3 CYB1 SOD Wt Wt 31 12 12 β-TUB A3 CYB1 SOD Wt Wt We analyzed sequences the 08 loci of 31 P jirovecii strains and the results revealed that no nucleotide alteration in the β-TUB, CYB, DHFR, and DHPS loci was observed, whereas SOD locus had two changes at C/110 and A/215 and was classified into SOD6 genotype The data indicated that the most frequent nucleotide alterations were in the mt26S, 26S and ITS1 loci and these changes were grouped into different genotypes In this 110 * study, we not only found major mutations (genotypes) reported previously by Maitte et al [13], Hauser et al [6], Esteves et al [5], Ma et al [8], Kazanjian et al [7], and Costa et al [4], but also identified several new genotypes (mutations) that only found in P jirovecii strains circulating in Vietnam This result indicated that P jirovecii in the study had different variants in the genome suggesting a high genetic diversity Journal of military pharmaco-medicine no7-2019 New genotype found in the P jirovecii circulating in Vietnam Table 3: New nucleotide variation identified in the P jirovecii strains Locus Genotypes Position of nucleotide alteration Mt26S 15 CGAA/54-57, C/85, C/248, A/288 16 GAT/54-57, A/85, C/248, A/288 17 AAAA/54-57, A/85, T/248, A/288 18 AGTG/54-57, A/85, C/248, A/288 19 GAAA/54-57, C/85, C/248, A/288 20 GCG/54-57, T/85, C/248, A/288 21 GAA/54-57, A/85, C/248, A/288 22 GCAA/54-57, T/85,C /248, A/288 23 GAAA/54-57, A/85, T/248, A/288 A6 T/2, TTT/8-10, A/11, T/17, T/22, TC/46-47, 10xT/54-62, GAGG/71-72, TTA/111-113 B7 T/2, TT/8-10, A/11, T/17, T/22, TC/46-47, 10xT/54-62, GAGG/71-72, TTA/111-113 B8 C/2, TT/8-10, C/11, T/17, C/22, TC/46-47, 9xT/54-62, GAGG/71-72, TTA/111-113 B9 C/2, TT/8-10, A/11, T/17, T/22, TC/46-47, 10xT/54-62, GAGG/71-72, TTA/111-113 B10 T/2, TT/8-10, C/11, T/17, C/22, TC/46-47, 10xT/54-62, GAGG/71-72, TTA/111-113 C/110, A/215 ITS1 SOD Genotyping was based on previous studies of Maitte et al [13], Hauser et al [6], Esteves et al [5], Ma et al [8], Kazanjian et al [7], and Costa et al [4] The nucleotide variants of the mt26S, ITS1 and SOD were consistent with several new genotypes that only distributed in Vietnamese P jirovecii strains The reason for the difference between these pathogenic P jirovecii strains may be derived from various geographical and climate regions, host, and exposure to different drugs In addition, the preventive treatment for HIV/AIDS patients by HAART and other infectious pathogens can be also created nucleotide alterations, which may be associated with disease symptoms and the risk of mortality 111 Journal of military pharmaco-medicine no7-2019 Genotype distribution of P jirovecii circulating in Vietnam Table 4: Genotype distribution of P jirovecii circulating in Vietnam Loci Number of genotypes Number of P jirovecii with genotype A1 (4) ITS1 14 A2 (6) A3 (4) A4 (1) A5 (1) A6 (1) B (2) B1 (1) B2 (1) B3 (3) B7 (1) B8 (1) B9 (1) B10 (1) ND (3) (5) Mt26S 14 (6) (2) 11 (3) 12 (2) 15 (1) 16 (1) 17 (2) 18 (1) 19 (1) 20 (1) 21 (3) 22 (2) 23 (1) 26S (20) 11 (3) 12 (6) 13 (2) SOD SOD1 (30) SOD6 (1) CYB CYB1 (31) β-TUB Β-TUB (31) DHPS DHPSwt (1) DHFR DHFRwt (1) 112 Journal of military pharmaco-medicine no7-2019 Data showed that ITS1 locus was classified into 14 genotypes, of which the major strains were in A6, A1, A3 B, and B3, the minor strains were distributed in the rest of genotypes Genetic variation in the mt26S locus was also divided into 14 genotypes, of these the genotypes 15 - 23 were only found in Vietnamese P jirovecii strains The 26S locus was classified into four genotypes, the majority of strains were genotype The nucleotide variation in the SOD locus was classified into main genotypes, SOD1 genotype and SOD6 The CYB, β-TUB, DHPS, DHFR loci revealed no mutation Thus, 31 P jirovecii strains circulating in Vietnam indicate a high level of genetic variation, mainly at the ITS1, mt26S, 26S and SOD loci CONCLUSIONS The most frequent nucleotide variation of 31 P jirovecii strains was found in ITS1, mt26S, 26S and SOD loci Several mutations were only distributed in the P jirovecii strains circulating in Vietnam No nucleotide alterations were found in the CYB, β-TUB, DHPS, DHFR loci of the 31 P jirovecii strains REFERENCES Nguyễn Kim Thư TCD4 mối liên quan với nhiễm trùng hội bệnh nhân HIV/AIDS điều trị nội trú Bệnh viện Bệnh Nhiệt đới Trung ương Tạp chí Y học Thực hành 2011, 842, tr.112-116 Lê Mạnh Hùng Nghiên cứu đặc điểm dịch tễ, lâm sàng trường hợp viêm phổi nhiễm trùng người nhiễm HIV Thành phố Hồ Chí Minh Luận án Tiến sỹ Y học 2008 Nguyễn Tiến Lâm Căn nguyên nhiễm trùng hội bệnh nhân HIV/AIDS điều trị nội trú Bệnh viện Bệnh Nhiệt đới Trung ương Tạp chí Y học Thực hành 2011, 781, tr.135-138 Costa M.C et al Genetic characterization of the dihydrofolate reductase gene of Pneumocystis jirovecii isolates from Portugal J Antimicrob Chemother 2006, 58 (6), pp.1246-1249 Esteves F et al Population structure of Pneumocystis jirovecii isolated from immunodeficiency virus-positive patients Infect Genet Evol 2010, 10 (2), pp.192-199 Hauser P.M et al Typing of Pneumocystis carinii f sp hominis by single-strand conformation polymorphism of four genomic regions J Clin Microbiol 1997, 35 (12), pp.3086-3091 Kazanjian P et al Pneumocystis carinii mutations are associated with duration of sulfa or sulfone prophylaxis exposure in AIDS patients J Infect Dis 2000, 182 (2), pp.551-557 Ma L et al Pneumocystis carinii dihydropteroate synthase but not dihydrofolate reductase gene mutations correlate with prior trimethoprim-sulfamethoxazole or dapsone use J Infect Dis 1999, 180 (6), pp.1969-1978 Mocroft A et al AIDS across Europe, 1994 - 1998: The EuroSIDA study Lancet 2000, 356 (9226), pp.291-296 10 Palella F.J Jr et al Declining morbidity and mortality among patients with advanced human immunodeficiency virus infection HIV outpatient study investigators N Engl J Med 1998, 338 (13), pp.853-860 11 Selik R.M, Starcher E.T, Curran J.W Opportunistic diseases reported in AIDS patients: Frequencies, associations, and trends AIDS 1987, (3), pp.175-182 12 Crum N.F et al Comparisons of causes of death and mortality rates among HIVinfected persons: Analysis of the pre-, early, and late HAART (highly active antiretroviral therapy) eras J Acquir Immune Defic Syndr 2006, 41 (2), pp.194-200 13 Maitte C, Leterrier M, Le Pape P, Miegeville M, Morio F Multilocus sequence typing of Pneumocystis jirovecii from clinical samples: How many and which loci should be used? J Clin Microbiol 2013, 51 (9), pp.2843-2849 113 ... genotype distribution of P jirovecii in HIV/AIDS patients in the National Hospital for Tropical Diseases during the period from January 2014 to December 2017 SUBJECTS AND METHODS Subjects A total of. .. symptoms and the risk of mortality 111 Journal of military pharmaco-medicine no7-2019 Genotype distribution of P jirovecii circulating in Vietnam Table 4: Genotype distribution of P jirovecii. .. circling in Vietnam are highly necessary in order to improve understanding of pathogenic characteristics of this fungus In this study, we aim: To molecularly characterize and to determine the genotype