1. Trang chủ
  2. » Thể loại khác

Clinical, histological characteristics and SFRP2, RNF180 methylation status in gastric carcinoma patients experienced surgical resection at 103 military hospital

7 38 0

Đang tải... (xem toàn văn)

THÔNG TIN TÀI LIỆU

Thông tin cơ bản

Định dạng
Số trang 7
Dung lượng 91,21 KB

Nội dung

To characterize clinical, histological properties and SFRP2 methylation status in patients diagnosed with gastric carcinoma who underwent surgical resection at 103 Military Hospital.

Jourrnal of military pharmaco-medicine n09-2019 CLINICAL, HISTOLOGICAL CHARACTERISTICS AND SFRP2, RNF180 METHYLATION STATUS IN GASTRIC CARCINOMA PATIENTS EXPERIENCED SURGICAL RESECTION AT 103 MILITARY HOSPITAL Nguyen Minh Phuc1; Tran Van Khoa2; Nguyen Thuy Vinh3 SUMMARY Objectives: To characterize clinical, histological properties and SFRP2 methylation status in patients diagnosed with gastric carcinoma who underwent surgical resection at 103 Military Hospital Subjects and methods: Case-control based, and cross-sectional study on 98 gastric carcinoma patients whose surgical resection from December 2015 to December 2018, and 40 chronic gastritis patients diagnosed by endoscopic and histological methods Results and conclusion: Gastric carcinoma prevalence among male patients was greater than that of female patients, with a ratio of 2.27/1 The average age of cancer patients was 61.5 ± 10.88, with the highest incidence was witnessed in 60 - 69 years-old group According to Lauren’s criteria, the intestinal type was more common than the diffuse type (p > 0.05); meanwhile, in the WHO classification system, tubular adenocarcinoma was the major histologic patterns of gastric cancers, followed by undifferentiated carcinoma, signet ring cell carcinoma, and mucinous adenocarcinoma (9.18%) Most of the surgery procedures were performed in II - IV stages (95.92%) SFRP2 methylation was detected in 74.49% of gastric carcinoma group and 25.51% of control group (OR = 6.07; 95%CI: 3.28 - 11.21) SFRP2 methylation is a potential marker for gastric cancer diagnosis * Keywords: Gastric carcinoma; SFRP2 methylation; Clinical characteristics; Histological characteristics INTRODUCTION Gastric cancer (GC) is a common disease in Vietnam and many other countries worldwide The International Agency for Research on Cancer (IARC) in 2018 estimated 17,527 new cases of GC (or 10.6% of all reported cancer cases) in Vietnam, made GC the third most commonly diagnosed malignancy, behind liver and lung cancers [5] Due to many GC are diagnosed at an advanced stage, the 5-year survival rate is very low, at 10 - 20% Epigenetic is heritable changes in gene expression that occurs without changes in DNA sequences, including histone modifications and promoter methylation DNA methylation is a process by which a methyl group is covalently added into the carbon position of the cytosine ring in CpG dinucleotides DNA methylation inactivates the expression of Thai Binh University of Medicine and Pharmacy Vietnam Military Medical University Public Health University Corresponding author: Nguyen Minh Phuc (minhphucytb@yahoo.com) Date received: 08/10/2019 Date accepted: 22/11/2019 270 Jourrnal of military pharmaco-medicine n09-2019 tumor suppressor genes, which is considered as a key step in carcinogenesis and cancer development A study by Zhang X et al (2014) revealed that SFRP2 methylation level detected in plasma was 71.93% of GC patients compared to 42.86% of control group (p = 0.0036) [6] In Vietnam, studies of DNA methylation of genes relating to cancers, including GC, are limited Thus, we conducted a research with aims: To characterize the clinical and histopathological properties as well as to investigate methylation status of SFRP2 among GC patients who were performed surgical resection at 103 Military Hospital from December 2015 to December 2018 SUBJECTS AND METHODS Subjects - Case group: 98 primary GC patients who received surgical treatment at the Abdominal Surgery Department, 103 Military Hospital * Exclusion criteria: Secondary gastric carcinomas or patients who had experienced radio- and/or chemotherapy - Control group: 40 chronic gastritis patients who were diagnosed by gastrointestinal endoscopy and histological examinations Methods - Study design: Case-control based, cross-sectional study - Laboratory instruments and material: DNA Speed vac Eppendorf AG 530 concentrator (Germany); DNA Quikdrop spectrophotometer (USA); Eppendorf ProS PCR cycler (USA); Rotor-Gene Q Qiagen real-time PCR cycler (Germany); mupid-one electrophoresis system (Japan); CV-170 video system (Japan), Qiagen DNeassy Blood & Tisiue (50) 69504, QIA quick PCR Purification Kit 28104, Methylation - Gold D5006 * Study scheme: - Case group: Cancer patients received a clinical examination before the surgery procedure Tumorous specimens were sent to the Department of Pathology, 103 Military Hospital; then specimens were subjected to histological examination and DNA methylation assessment - Control group: Chronic gastritis patients received gastrointestinal endoscopy and endoscopic biopsy specimens were collected and subjected to histological examination and DNA methylation assessment - Histological examinations were conducted at the Department of Pathology, 103 Military Hospital, including: + Gastric carcinoma diagnosis + Histologic demonstration based on Lauren criteria [7] (diffuse and intestinal adenocarcinoma) or the WHO classification system (2000) [1] (9 histologic patterns: Tubular adenocarcinoma, mucinous adenocarcinoma, signet-ring cell carcinoma, adenosquamous carcinoma, squamous cell carcinoma, squamous cell carcinoma, small-cell carcinoma, undifferentiated carcinoma and other carcinoma) The degree of tissue differentiation was divided into highly differentiated, moderately differentiated and poorly differentiated - MSP-based methylation assessments of SFRP2 gene were carried out at the Molecular Biology Laboratory, Department of Biology and Medical Genetics, 271 Jourrnal of military pharmaco-medicine n09-2019 Military Medical University Experiment protocol was performed in the following steps: + DNA isolation: DNA was extracted by using QIAamp DNA Mini Kit (Qiagen) followed to the manufacturer’s instruction Concentration and purity of isolated DNA were evaluated by DNA Quikdrop spectrophotometer, and stored at -20oC for further usage + Bisulfite modification: DNA sample was bisulfite modified by EZ DNA methylation-Gold Kits (Zymo research) followed to the manufacturer’s instruction Ten microliters of modified DNA was stored at -20oC for further usage + MSP (Methylation Specific PCR) amplification: Specific primers were used to analyze the methylation status of SFRP2 promotor (table 1) Technically, if the result of the methyl-specific primer set is positive, then the CpGs of interest are fully methylated; if the result of the unmethyl-specific primer set is positive, then the CpGs of interest are unmethylated; if the methyl-specific and the unmethylspecific primer sets show positive results, these CpGs are partially methylated PCR was carried out in a 25 µL total volume containing: 12.5 µL Mastermix; 0.5 µL of each primer, µL bisulfite-modified DNA; H2O (adjusted) The standardized MSP amplification consisted of minutes at 95oC, followed by 35 cycles of 30s at 95oC, 60s at 55oC, 30s at 72oC and final extension at 72oC Table 1: Primer sequences used for MSP Primer Sequence SFRP2 MF GGGTCGGAGTTTTTCGGAGTTGCGC SFRP2 MR CCGCTCTCTTCGCTAAATACGACTCG SFRP2 UF TTTTGGGTTGGAGTTTTTTGGAGTTGTGT SFRP2 UR AACCCACTCTCTTCACAAATACAACTCA + Electrophoresis: PCR products were run on 2% agarose gel and were applied to 100 V field, 100 mA current within 30 minutes; gels were stained in ethidium bromide and UV imaged, then the electrophoresis results were analyzed - All analysis was performed by SPSS software version 20.0 RESULTS AND DISCUSSION Gender and age characteristics * Gender information: 68 male patients (69.39%); 30 female patients (30.61%) 272 Target product length 138 bp 145 bp GC is associated with gender GC incidence in males was usually higher than that in females, with male/female ratio ranged between - 3/1 This gender difference may be explained by the protective activity of female hormone (estrogen), and by the fact that men are more usually exposed to risk factors In the current study, male/female patient ratio was 2.27/1, which was concordant with results from studies by Le Viet Nho (2.75/1) [2] and Nguyen Quang Bo (2.5/1) [3] Jourrnal of military pharmaco-medicine n09-2019 Table 2: Patients age distribution in the study Gender Age group (n = 98) Male Female Total Number Percentage (%) Number Percentage (%) < 50 70.00 30.00 10.20 50 - 59 19 63.33 11 36.67 30.61 60 - 69 27 79.41 20.59 34.70 ≤ 70 15 62.50 37.50 24.49 GC was less commonly diagnosed under 40 years old, and the percentage increased by age, with the highest percentage belonged to 60 - 70 years-old group [4] In this study, the oldest patient was 85, while the youngest was 35, and the average age of GC patients was 61.5 ± 10.88 Most of them were more than 50 years old, accounted for 89.8% of patients, with the major group was 60 - 69 years old The average age of GC patients in our research was also in line with that in studies by Phan Van Cuong (2017) (59.8 - 61.9 years old) [4] and Zhang X (2014) (61.49 ± 12.02 years old) [6] Clinical characteristics and histological * Clinical characteristics: - The reasons of hospitalization of GC patients: Epigastric pain: 76 patients (77.56%); gastrointestinal bleeding: 11 patients (11.22%); vomiting/nausea: patients (7.14%); weight loss: patient (1.02%); other reasons: patients (3.06%) In our study, none of the GC patients was diagnosed by a regular medical checkup Our result was therefore similar to many other studies, in which the reason for hospitalizing was mainly due to epigastric pain [2, 3] - Systemic and functional symptoms: Epigastric pain: 92 patients (93.87%); weight loss: 50 patients (51.02%); vomiting/nausea: 41 patients (41.84%); gastrointestinal bleeding: 17 patients (17.35%); indigestion, belching, heartburn: 33 patients (33.67%); anemia: 46 patients (46.94%) There were no specific symptoms of GC among patients Meanwhile, in our study, epigastric pain, weight loss, vomiting, nausea was common symptoms; remaining symptoms were less widespread Our research results were in line with other studies [2, 3] - Physical symptoms: In our research, the most common physical symptom amongst gastric carcinoma patients was epigastric pain while palpating (73 patients = 74.49%) and a very limited number of cancer patients had palpable epigastric tumors (11 patients = 11.22%) or enlarged liver (3 patients = 3.06%) There was no patient with lymphadenopathy or ascites Our data thus in concordance with the result of Nguyen Quang Bo’s study, in which most GC patients experienced epigastric pain with palpation but rarely encountered other physical symptoms [3] 273 Jourrnal of military pharmaco-medicine n09-2019 * Histological characteristics: - Histological classification relying on Lauren’s criteria: Intestinal gastric carcinoma (52 patients = 53.06%) was diagnosed more frequently than diffuse gastric carcinoma (46 patients = 46.94%) This result was similar to those of Le Viet Nho’s study [2] and Zhang Zh’s study [8] Table 3: Histological classification relying on the WHO classification system (2000) Characteristics Number Percentage (%) Tubular 51 52.04 Mucinous 8.16 Signet ring cell 17 17.35 Undifferentiated 22 22.45 98 100.0 Highly 31 31.63 Moderately 25 25.51 Poorly 42 42.86 98 100.0 Histologic subtypes: Total Differentiation degree: Total Based on WHO classification system (2000), we noticed that the tubular adenocarcinoma accounted for the largest proportion of total histologic subtypes None of the other subtypes was detected in our studies These indicated the similarity between Le Viet Nho’s and our study, wherein the major percentage belonged to the tubular subtype [2] With regard to differentiation degree, poorly differentiated cancer was the major proportion Table 4: Cancer staging according to AJCC/UICC (2010) Cancer staging T N 274 Number Percentage (%) T2 20 20.41 T3 47 47.96 T4 31 31.63 N0 6.12 N1 18 18.37 N2 63 64.29 N3 11 11.22 Jourrnal of military pharmaco-medicine n09-2019 M0 94 95.92 M1 4.08 Stage I 4.08 Stage II 25 25.51 Stage IIII 65 66.33 Stage IV 4.08 98 100.0 M GC overall stage Total All of the gastric carcinoma patients in this research performed surgical resection when the tumors had invaded via the submucosal route, thus classified into T2 to T4 stages Most of the patients (93.88%) also had lymph node metastases, which belonged to N2 - N4 stages and others were in the status of distant metastasises Hence, nearly almost gastric patients (95.92%) were in advanced stages, who could be sorted into stages II to IV in overall Methylation assessment result Table 5: SFRP2 gene methylation status Case group Methylation status Control group OR Number % Number % (95%CI) Methylation 73 74.49 13 32.5 6.06 Unmethylation 25 25.51 27 67.5 (3.28 - 11.21) 98 100.0 40 100.0 Total DNA methylation resulted in inactivating genes that have roles in cancers, especially tumor suppressor genes, which leads to carcinogenesis, including GC SFRP2 was described to be one of tumor suppressor genes Our data showed that SFRP2 methylation rate in the case group was significantly higher than that in the control group, and SFRP2 methylation caused a 6.06-fold higher risk of gastric carcinoma in relation to SFRP2 unmethylation (OR = 6.06, 95%CI: 3.28 - 11.21) This result was in line with that derived from Zhang X’s study [6] CONCLUSION - Gastric carcinoma incidence among male patients was greater than that of female patients, with a ratio of 2.27/1 The average age of cancer patients was 61.5 ± 10.88, with a large proportion of them was in the 60 - 69 years-old group - According to Lauren’s system: The intestinal type was more common than the diffuse type (p > 0.05) - In the WHO classification system (2000): Tubular adenocarcinoma was the major histologic patterns of gastric cancers, followed by undifferentiated carcinoma, 275 Jourrnal of military pharmaco-medicine n09-2019 signet ring cell carcinoma, and mucinous adenocarcinoma Poorly differentiated tumors occupied the highest percentage - SFRP2 methylation associated with a higher risk of GC (OR = 6.06, 95%CI: 3.28 - 11.21) This result suggests that SFRP2 methylation has a potential to become a diagnosis marker for GC REFERENCES Pham Duy Hien Gastric Cancer Medicine Publisher 2007 Le Viet Nho Investigation of EGFR, HER2 expression and its association with clinical, endoscopy and histopathology in patients with gastric carcinoma Doctor of Medicine Thesis University of Medicine and Pharmacy, Hue University 2014 Nguyen Quang Bo Evaluation for treatment of 1/3 lower GC with radical surgery combined with chemotherapy Doctor of Medicine Thesis University of Medicine and Pharmacy, Hue University 2017 276 Phan Van Cuong Incidence of stomach cancer in the period of 2009 - 2013 The National Science Conference VI on "Prevention of non-infectious diseases" Vietnam Journal of Medicine 2017, pp.25-30 Bray F et al Global cancer statistics 2018: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries CA Cancer J Clin 2018, 68 (6), pp.394-424 Zhang X, Xuesong Zhang et al Detection of aberrant promoter methylation of RNF180, DAPK1 and SFRP2 in plasma DNA of patients with gastric cancer Oncol Lett 2014, Oct, (4), pp.1745-1750 Lauren P The two histological main types of gastric carcinoma: Diffuse and so-called intestinal-type carcinoma An attempt at a histo-clinical classification Acta Pathol Microbiol Scand 1965, 64, pp.31-49 Zhang Zh, Yu W Methylation of claudin-3 promoter predicts the prognosis of advanced gastric adenocarcinoma Oncology Report 2018, 40, pp.49-60 ... characterize the clinical and histopathological properties as well as to investigate methylation status of SFRP2 among GC patients who were performed surgical resection at 103 Military Hospital from... histologic patterns: Tubular adenocarcinoma, mucinous adenocarcinoma, signet-ring cell carcinoma, adenosquamous carcinoma, squamous cell carcinoma, squamous cell carcinoma, small-cell carcinoma, undifferentiated... reasons of hospitalization of GC patients: Epigastric pain: 76 patients (77.56%); gastrointestinal bleeding: 11 patients (11.22%); vomiting/nausea: patients (7.14%); weight loss: patient (1.02%);

Ngày đăng: 15/01/2020, 09:45

TỪ KHÓA LIÊN QUAN

TÀI LIỆU CÙNG NGƯỜI DÙNG

TÀI LIỆU LIÊN QUAN

w