DNA barcoding, an approach for molecular identification of Huyen-sam (Scrophularia L.) samples collected in Northern Vietnam

Huyen-sam (Vietnamese name) which belongs to Scrophularia L. genus is a valuable herb. This medicinal plant is classified as Scrophularia ningpoensis Hemsl. Huyen-sam roots, which contain a large amount of bioactive compounds, have a similar morphology to its relatives. DNA barcodes promise to be a precise and reliable tool for distinguishing the processed Huyen-sam materials from their counterfeits. However, studies about using DNA barcodes for classification of Scrophularia L. in Vietnam are not available. Here, we conducted a taxonomic analysis of eight Scrophularia L. samples collected from the mountain areas of Northern Vietnam. Based on the combined sequence data of ribosomal nuclear ITS, a part of chloroplast rbcL gene and trnL-trnF intergenic spacer, phylograms of Scrophularia L. were generated by both Bayesian inference and maximum likelihood bootstrap method. The phylogenetic analysis showed that the tested samples have a sister relationship to S. ningpoensis. Hopefully, the analysis strategy that we used would contribute to further phylogenetic analyses of medicinal plants of Vietnam in the future.

Life Sciences | Pharmacology, Biotechnology DNA barcoding, an approach for molecular identification of Huyen-sam (Scrophularia L.) samples collected in Northern Vietnam Manh Minh Bui1, Anh Tuan Vu2, Phuong Nhung Vu1, Quang Cu Pham2, Dang Ton Nguyen1,3, Thi Thu Hue Huynh1,3* Institute of Genome Research, Vietnam Academy of Science and Technology General Department of Logistics - Techniques Graduate University of Science and Technology, Vietnam Academy of Science and Technology Received December 2017; accepted 26 March 2018 Abstract: Introduction Huyen-sam (Vietnamese name) which belongs to Scrophularia L genus is a valuable herb This medicinal plant is classified as Scrophularia ningpoensis Hemsl Huyen-sam roots, which contain a large amount of bioactive compounds, have a similar morphology to its relatives DNA barcodes promise to be a precise and reliable tool for distinguishing the processed Huyen-sam materials from their counterfeits However, studies about using DNA barcodes for classification of Scrophularia L in Vietnam are not available Here, we conducted a taxonomic analysis of eight Scrophularia L samples collected from the mountain areas of Northern Vietnam Based on the combined sequence data of ribosomal nuclear ITS, a part of chloroplast rbcL gene and trnL-trnF intergenic spacer, phylograms of Scrophularia L were generated by both Bayesian inference and maximum likelihood bootstrap method The phylogenetic analysis showed that the tested samples have a sister relationship to S ningpoensis Hopefully, the analysis strategy that we used would contribute to further phylogenetic analyses of medicinal plants of Vietnam in the future Scrophularia  L., which is commonly called “figwort” is a plant genus belonging to family Scrophulariaceae The genus comprises about 200-300 species distributed in Central Asia, Europe (Mediterranean), North America and China [1-3] Huyen-sam (Vietnamese name) or Scrophularia ningpoensis Hemsl., whose root is a valuable natural herb, is usually used for the treatment of inflammation, constipation and fever [4-6] The main bioactive compounds present in S ningpoensis’s root are harpagoside, angroside C, acteoside and cinnamic acid, which have anti-inflammatory, antimicrobial and antioxidant effects [3, 6, 7] Sourced from Southeast China, this herb is also domestically grown in some northern districts of Vietnam, such as Lao Cai, Ha Giang and Cao Bang [6] Due to the similarity in the morphology, S ningpoensis’s root can be mistaken for its close relatives, such as S buergeriana Miq or S kakudensis Franch Consequently, the demand for new molecular markers that support the identification of processed S ningpoensis’s samples has become increasingly necessary However, phylogenetic studies based on molecular markers of Scrophularia  L are very limited in Vietnam These discoveries would play an important role in assuring the quality of processed herb in Vietnam market Keywords: Bayesian inference, DNA barcodes, ITS, maximum likelihood, medicinal plants, phylogenetic, rbcL, Scrophularia L., trnL-trnF DNA barcoding is a conventional method for the identification of unknown living organism specimens This approach can be applied to a wide range of species from microbes to higher animals By analysing the evolutionary rate of small genome fragments as substitutes for morphology aspects, the method provides a quick and cost-effective species identification, especially for higher plant taxons [8, 9] The searching for universal DNA Classification numbers: 3.3, 3.5 *Corresponding author: Email: hthue@igr.ac.vn 56 Vietnam Journal of Science, Technology and Engineering JUne 2018 • Vol.60 Number Life Sciences | Pharmacology, Biotechnology barcodes for plants is still ongoing; however, there is a common agreement that more than one region is needed for performing the taxonomy consensus analysis [10, 11] The selected plant DNA barcodes are usually the genome regions which have a suitable evolutionary rate for generating enough changes in various nucleotide sites during generations The majority of plant DNA barcoding studies have utilized the DNA regions located on the plastid genome, e.g ribulose 1,5-bisphosphate carboxylase large subunit (rbcL), maturase K (matK) and multiple intergenic regions such as tRNA Leucine - tRNA Phenylanaline (trnL-trnF), tRNA Histidine - photosystem binding protein A (trnH-psbA), tRNA Glutamine - ribosomal protein S16 (trnQ-rps16), tRNA Cysteine - tRNA Asparagine (trnCtrnD), and tRNA Alanine - tRNA Histidine (trnA-trnH) [11-15] In addition, the nuclear internal transcribed spacer (ITS) and 18s RNA can also perform as useful barcodes for classifying flower plants [11, 16-18] During the last decade, taxonomy studies of Scrophularia  L based on the DNA barcodes have been gradually conducted The phylogenetic relationships among Scrophularia L taxa collected from different parts data set from these DNA regions are objects for generating the phylogenetic tree by Bayesian inference (BI) and maximum likelihood (ML) analysis The main aim of this project is to contribute to the molecular classification study of genus Scrophularia L in Vietnam Materials and methods Plant materials Eight leaf samples of Scrophularia L were collected from the cultivated gardens located in different mountain districts in Northern Vietnam namely HSa-1A, HSa-1B, HSa-2A, HSa-3A, HSa-3B, HSa-4B, HSa-5A, HSa-8A All the samples were preserved in silica gel for a completed desiccation DNA extraction, amplification and sequencing Total DNA was extracted from about 100 mg of the dried leaf following the CTAB extraction method [19] The extracted DNA was resuspended in 50 µl miliQ water, and standard 50 ng of the DNA was used for amplification The primers for amplification of target regions were designed based on the reference sequence on Genbank (Table 1) Table List of primers used in the study Primer ITS-AB-101 ITS-AB-102 rbcL-F rbcL-R TrnL-PF TrnL-PR DNA regions ITS rbcL TrnL-trnF Primer sequences (5’3’) ACGAATTCATGGTCCGGTGAAGTGTTCG TAGAATTCCCCGGTTCGCTCGCCGTTAC ATTTGAACTGGTGACACGAG CGAAATCGGTAGACGCTACG AGTGTTGGATTCAAGCTGGTG TGGTTGTGAGTTCACGTTCT of American continent were analysed from the combined data from the sequence of ITS, the chloroplast trnQ-rps16 and psbA-trnH intergenic spacers [2] Another study on the evolutionary relationships of Scrophularia  L species in Western Mediterranean and Macaronesia was completed by the data of ITS and trnQ-rps16 by Bayesian binary MCMC (BBM) analysis [17] In this paper, we perform a phylogenetic analysis of Scrophularia L samples in Northern Vietnam More particularly, the analysis is based on the sequence data from nuclear ITS, chloroplast rbcL, and trnL-trnF The combined Amplicon size (bp) 800 600 1100 The condition of amplification was optimized for 20 µl of PCR, including 50 ng extracted DNA, 2.5 µM of each primer, 0.75 unit of Phusion polymerase (Thermo Scientific), mM of each dNTP and Phusion PCR buffer The amplification thermocycles were performed as follows: cycle of denaturing at 94oC for minutes, 35 cycles of amplification including 94oC/30s followed by annealing at 52oC/30s (trnL-trnF and rbcL) or 54oC/30s (ITS) and extension 72oC/1 30s; ending with a final extension step of 72oC/7 mins The PCR products were checked by electrophoresis on 0.8% agarose gel Successful PCR products were purified by Thermofisher Scientific DNA JUne 2018 • Vol.60 Number Vietnam Journal of Science, Technology and Engineering 57 Life Sciences | Pharmacology, Biotechnology purification kit (K0512) Sequencing was carried out using the BigDyeTM terminator v3.1 cycle sequencing kit (Applied Biosystems) in a final volume of 20 µl Sequence runs were performed on an ABI 3500 genetic analyser following Sanger’s principle Alignment and phylogenetic construction All the DNA sequences generated from this study were assembled, edited and aligned manually using Bioedit v7.0.5.9 which embedded the ClustalW v1.8 [20] To access the closeness of the relationships between tested plant samples and the species of Scrophularia L., the DNA sequences of examined regions namely ITS, rbcL and trnL-trnF of species involving in genus Scrophularia L and some other genera of Lamiales as outgroup were downloaded from Genbank (www.ncbi.nlm.nih.gov) and aligned (Table 2) Table Taxons included in this study, with Genbank accession numbers GenBank accession numbers Species ITS rbcL trnL-trnF Scrophularia ningpoensis FJ609731.1 GQ436721.1 AY695886.1 Scrophularia buergeriana JQ065663.1 NC031437.1 KP718626.1 Scrophularia takesimensis JQ065681.1 KP718628.1 AY695886.1 Scrophularia kakudensis JQ065674.1 - KM979600.1 Scrophularia zvartiana KY067618.1 - - Scrophularia arguta - - AJ430936.1 Scrophularia californica - - HQ412946.1 Orobanche gracilis JX193303.1 AY582198.1 - Orobanche californica KC480368.1 AY582178.1 - Phelipanche ramosa AY209315.1 AY582252.1 - Conopholis americana AY209289.1 - - Epifagus virginiana AY209290.1 - - Lathraea squamaria KC480353.1 - - Plantago maritima AY101879.1 KR297244.1 AY101934.1 Plantago media AJ548964.1 KF602241.1 AY101920.1 Coffea canephora MF417755.1 NC030053.1 AF102405.2 Coffea arabica MF417758.1 EF044213.1 DQ153829.1 Jasminum nudiflorum AF534817.1 DQ673255.1 EU281146.1 Olea europaea KF805102.1 DQ673304.1 AF231866.1 Olea woodiana JX862658.1 NC015608.1 LN515476.1 Utricularia macrorhiza - NC025653.1 AF482657.1 Utricularia gibba - NC021449.1 AF482657.1 Ajura reptans EF508061.1 Z37385.1 GU381470.1 Salvia miltiorrhiza DQ132863.1 KC473307.1 DQ667523.1 Pogostemon stellatus KP718621.1 NC031434.1 NC031434.1 Phyllostegia velutina KF529547.1 NC029820.1 KU724134.1 Stachys sylvatica JN680361.1 AF502022.1 NC029824.1 -: the sequence is unavailable 58 Vietnam Journal of Science, Technology and Engineering JUne 2018 • Vol.60 Number Life Sciences | Pharmacology, Biotechnology The phylogenetic taxonomy analysis was conducted with a BI and an ML approach from datasets (ITS, chloroplast and combined data) The BI was calculated by MrBayes 3.2.6 using a Metropolis-coupled Markov Chain Monte Carlo (MCMCMC) algorithm [21, 22] The certainty of the node generated by BI were supported by the posterior probability (PP) value, which ranged from to The Combined chloroplast partition evolution was assumed to follow the general time reversible model with a proportion of the sites invariable and the rate for the remaining sites drawn from a gamma distribution (GRT+Γ+I model), while ITS region follows a SYM model (SYM+Γ model) [23] The MrBayes was executed with runs and four chains (3 hot - cold) with the default temperature of hot chain t = 0.2 for 10 million generations, sampling every 2000th generation to generate 10,000 trees A burn-in ratio of 10% of sampled trees was discarded and the BI consensus tree were generated from 80% of the remainders Besides, the alignment of the combined dataset (ITS, rbcL and trnLtrnF) and ML was performed by the software MEGA 6.06 with the bootstrap method of 1,000 replications [24] The consensus tree was drawn using Figtree v.1.2.3 For controlling the incongruence between phylogenetic trees generated by BI and ML bootstrap method, the phylograms received from the chloroplast and nuclear datasets were analysed separately before combining The incongruence taxons and nodes with a high level of BS (70%) or surpassing the Bayesian support of 85% were discarded [25, 26] Results DNA extraction and amplification The extracted DNA from examined samples were used as templates for amplification of ITS, rbcL and trnL-trnF regions using designed primers The size of PCR products was checked by electrophoresis on Agarose gel 0.8% The correct PCR products were purified and sequenced for generating the DNA sequences afterward (Fig 1) Fig Gel electrophoresis image of PCR products from Scrophularia samples on 0.8% agarose gel 1A, 2A, 3A, 5A, 8A, 1B, 3B, and 4B are correspondent to HSa-1A, HSa-2A, HSa-3A, HSa-5A, HSa-8A, HSa-1B, HSa-3B and HSa-4B, respectively The sample ITS, rbcL and trnL-trnF fragments have the size 800, 600 and 1,100 bp, respectively The PCR products clearly showed the DNA bands with the correct size of desired fragments DNA sequence alignment In this study, a total of 24 sequences were generated from tested Scrophularia samples including each for the nuclear ITS regions, chloroplast rbcL genes and trnL-trnF intergenic spaces The sequences obtained from examined samples were aligned with correspondent references for creating separated alignment datasets namely ITS, Chloroplast combination (rbcL+trnL-trnF) and Mixed combination (ITS+rbcL+trnL-trnF) The Chloroplast combination is a merger of plastid sequence, while the Mixed combination was generated by adding the ITS sequence to the Chloroplast combination The mixed combined data matrix contained 2,065 aligned characters with the average sequence length of 1,826.1 bp The average sequence length was 544.9 bp for ITS alignment data, 551.7 bp for rbcL and 729.8 bp for trnL-trnF We also estimated the mean of evolution distance between the taxons included in each dataset using the Maximum composite likelihood model with Gamma distribution and assuming rate variation and pattern heterogeneity among sites The trnL-trnF showed the highest overall mean of evolution distance (0.414) followed by the ITS regions (0.374), which indicates that these regions have relatively high evolution rates on Scrophularia L genus The detailed statistic information about the aligned dataset, including mean G+C content, number of conserved nucleotides and parsimony-informative sites, were provided in Table JUne 2018 • Vol.60 Number Vietnam Journal of Science, Technology and Engineering 59 Life Sciences | Pharmacology, Biotechnology Table Alignment characteristics and statistics for ITS, rbcL region, trnL-trnF intergenic space, combined chloroplast, and combined dataset ITS rbcL trnL-trnF Comb Chloroplast Combined Number of taxa 32 26 23 Average sequence length (bp) 544.9 551.7 729.8 1277.6 1826.1 Aligned sequence length 608 580 1019 1457 2065 Conserved characters 228 376 223 788 1109 Parsimony-informative characters 298 112 538 383 601 Overall mean evolution distance 0.347 0.08 0.414 0.111 0.09 %G+C content 38.7 45.6 31 33 61.5 45.2 35.2 The table contains the number of conserved characters, parsimony - informative characters and mean % GC content of aligned sequences Overall mean evolution distance was estimated through maximum composite likelihood model with Gamma distribution and assuming rate variation and pattern heterogeneity among sites Phylogenetic tree construction In this study, we generated phylogenetic trees for three separately aligned datasets For all the BI consensus trees, the average standard deviations of split frequencies when 2-run coverage at stationary distribution remained at lower than 0.002 The low split frequency indicated an increasing similarity of runs, and the results were adequate for the next analysis The phylogenetic trees were obtained from 9,002 sampled trees after the Bayesian runs The BI and ML analyses of each dataset showed high congruence on topologies, especially on the Scrophulariaceae family Therefore, we plotted the BS value of ML analysis onto the respective BI consensus tree Individual phylogenetic trees generated from the nuclear barcode ITS and Chloroplast combination dataset (rbcL+trnL-trnF) were shown in Figs and 3, respectively The clades of the examined sample in both consensus trees are highly similar in branch length with each other and grouped with Scrophularia ningpoensis, suggesting a close relationship However, the node between S ningpoensis and HSa-8A was not well-supported by the BI analysis (PP: 0.53, BS: 97) The BI and ML analyses also did not support the node of S takesimensis and S zvartiana (PP: 0.68, BS: 43) and the node of outgroup and tested samples (PP: 0.5, BS: 7), indicating the uncertainty of the ITS trees (Fig 2) On the outgroup clades, the Lathraea squamaria was incorrectly ordered into the clade of Orobanchaceae instead HSa-3B-ITS 0.71 HSa-4B-ITS HSa-1A-ITS 0.97 HSa-2B-ITS HSa-1B-ITS HSa-2A-ITS 0.99 HSa-3A-ITS HSa-5A-ITS HSa-8A-ITS 0.53 Fig Bayesian consensus tree of Scrophularia L., generated from the ITS dataset and reference sequences from other genera values are tree givenofin Scrophularia black number next to each node, while BS values are Fig.of2.Lamiales BayesianPPconsensus L , generated from the the ITS corresponding dataset given in red numbers PP values are obtained from 9,002 trees The scale bar indicates the average expected changes and reference sequences from other genera of Lamiales PP values are given in per site of sequences in the study 60 black number next to each node,while the corresponding BS values are given in red numbers PP values are obtained from 9,002 trees The scale bar indicates the average expected changes per site of sequences in the study Vietnam Journal of Science, Turning to Combined chloroplast consensus tree (Fig 3), all the nodes were Technology and Engineering JUne 2018 • Vol.60 Number well supported by the BI analysis (i.e PP values are larger than 0.9) and the clade of outgroups hadhigh values of both BS and PP The branch length of taxons HSa-A1, Life Sciences | Pharmacology, Biotechnology 0.5 0.99 1 Fig.Fig Bayesian consensus tree Scrophularia L., generated from Chloroplastfrom combination dataset (rbcL and trnL3 Bayesian consensus tree Scrophularia L the , generated the Chloroplast trnF intergenic spacers) of tested samples and reference sequences from other genera of Lamiales PP are given in combination (rbcL trnL -trnF BS intergenic spacers) testedPPsamples black number next todataset each node, while and the corresponding values are given in redof numbers values are obtained reference sequences other of Lamiales PP site areofgiven in black fromand 9,002 sampled trees The scale from bar indicates the genera average expected changes per sequences in the study number next to each node,while the corresponding BS values are given in red of Lamiaceae; however, PPobtained and BS values this sampled nodes received good scale supportbar fromindicate BI analysis numbers PP valuestheare fromfor9,002 trees.a The s theThe clades classification were quite low (PP: 0.57, BS: 23), indicating including average expected changes per site of sequences in theexamined study samples (HSa-3A, HSa-1B, HSa-1A, uncertainty HSa-4B, HSa-2A) were highly supported to be the sister The topologies involving the phylogram generated from the mixed combination of S.ningpoensis (PP: 1, BS: 91), while it is quite weak on Turning Combined chloroplast consensuswith tree (Fig datasettowere relatively congruent the Chloroplast combination tree (Fig 4) All ITS tree (PP: 0.53, BS: 97) The HSa-5A and HSa-8A were 3), all thenodes nodes were well supported by the BI analysis (i.e.BI analysis the received a good support from The clades including examined classified into a separated clade with high PP and BS value PP values are larger than 0.9) and the clade of outgroups had samples (HSa-3A, HSa -1B, HSa -1A, HSa -4B, HSa -2A) were highly supported to be (PP: 1, BS: 100), suggesting that they belong to a completely highthe values of both BS and PP The branch length taxons sister of S.ningpoensis (PP: 1, BS: of91), while it is quite weak on ITS tree (PP: 0.53, HSa-A1, HSa-AB1, HSa-A2, HSa-B3, HSa-B5 were similar different group involved in the tested samples In addition, BS: 97) The HSa -5A and HSa -8A were classified into a separated clade with high PP and grouped together on a clade of the consensus tree This all the outgroup clades showed a consistency with the APGII and BS value (PP: 1, BS: 100), suggestingthatclassification they belong to a complete ly different (Angiosperm Phylogeny Group, 2003) with a clade also had a close relationship with S buergeriana and group involved in the tested samples In addition, all the outgroup clades showedThis a result high support from BI and ML bootstrap analysis S ningpoensis Nevertheless, the node between the tested consistency with the APGII classification (Angiosperm Phylogeny Group, 2003) withdataset for indicated the high efficiency of using Combined group and S buergeriana received a weak BS value from a high support from BI and ML bootstrap analysis This result high building phylogenetic treesindicated not only forthe Scrophulariaceae, ML bootstrap analysis (BS: 31) A similar circumstance but also phylogenetic other families of Lamiales efficiency of using Combined dataset for building trees not only for occurred with the node between the outgroups and tested Scrophulariaceae, but also other families ofLamiales samples (BS: 26) Discussion and conclusions The topologies involving the phylogram generated from the mixed combination dataset were relatively congruent with the Chloroplast combination tree (Fig 4) All the Scrophularia L is one small genus which belongs to Scrophulariaceae family The genus includes a relatively small number of species (about 200-300) in comparison JUne 2018 • Vol.60 Number Vietnam Journal of Science, Technology and Engineering 61 Life Sciences | Pharmacology, Biotechnology 1 Fig Bayesian consensus tree Scrophularia L., generated from a mixed combination dataset (ITS, rbcL and trnL-trnF intergenic spacers) of tested samples and reference sequences from other genera of Lamiales PP are given in black number next to each node, while the corresponding BS values are given in red numbers PP values are obtained from 9,002 sampled trees The scale bar indicates the average expected changes per site of sequences in the study Fig Bayesian consensus tree Scrophularia L , generated from a mixed combination dataset (ITS, rbcL and trnL -trnF intergenic spacers) of tested samples and reference sequences from other genera of Lamiales PP are given in black number toofeach node,whilefamily; the corresponding areapplicable given in redsamples with the total numbernext species Scrophulariaceae barcoding is the BS widevalues range of plant however, as lot of them are utilized as traditional medicine The method couldThe be scale appliedbar for indicate DNA samples number PP values are obtained from 9,002 sampled trees s theobtained In Vietnam, the first study on Scrophularia L was instituted from different parts of the plant (e.g leaf, root, flower ) changes site ofplants sequences in thekinds study byaverage Do Tat Loiexpected in 1962 under a catalogueper of medical in in various of preservation conditions (fresh, dry…) Vietnam The study classified Huyen-sam as S buergeriana Upon DNA barcode analysis, the taxon identification can Discussion and s for human health, be processed without a detailed description of morphology Miq or S oldhami withconclusion numerous benefits such as pulse-quickening, anti-inflammation, and antibiotic [28] In addition, DNA barcode information could support L isCentre, one small genus which belongs toScrophulariaceae [27] In theScrophularia Vietnam Plant data the classification the finding of new species from a collectionfamily or confirmation ofThe Scrophulariaceae is largely a based on the morphology genus includes relatively small number of plant species (about 200 -300) in of preserved materials [29] ofcomparison reproductive trait; e.g.the stamen exsertion, corolla shape with total number species of Scrophulariaceae however, a lot Here, we followedfamily; a general pipeline of taxonomic or leaf organization structure (www.botanyvn.com) analysisInof Vietnam, Scrophularia the L genus three controversial of them are utilized as traditional medicine firston study on However, the morphology knowledge for distinguishing barcode regions (ITS, rbcL and trnL-trnF) For more details, Scrophularia L wasroots instituted Do Tat Scrophularia L’s processed which areby valuable herbsLoi in 1962 under a catalogue of medical ITS is well-known as one of the most importance barcodes is plants unavailable this study, The we aim to develop a strategy in In Vietnam study classified Huyen-sam as S buergeriana Miq.includes or S.2 more for plant classification This region using DNA barcoding, a molecular approach, to support the ITS1, ITS2 and a conserved oldhami with numerous benefits forhuman variable health,partitions such asnamely pulse-quickening, anti- 5.8S classification of Scrophularia L samples in Vietnam sequence Due to the convenience of amplification, the ITS inflammation, and antibiotic [27].In the Vietnam Plant data Centre, the classification DNA barcode is versatile and cost-effective for the plant regions are widely used for performing taxonomy analysis of Scrophulariaceae is largely of reproductive trait ; However, e.g the taxonomist The most remarkable advantagebased of using on DNAtheofmorphology the fungi, monocot and dicot [10, 11] stamen exsertion, corolla shape or leaf organizationstructure (www.botanyvn.com) However, the morphology knowledge for distinguishingScrophularia L’s processed Vietnam Journal of Science, JUne 2018 • Vol.60 Number 62 roots Technology whichandare valuable herbs is unavailable In this study, we aim to develop a Engineering strategy using DNA barcoding, a molecular approach, to support the classification of Life Sciences | Pharmacology, Biotechnology ITS has a quite complex evolution pattern that correlates with nuclear genome and causes difficulties for analysis [8] In this study, we applied a SYM + Γ substitution model which was suggested by Scheunert and colleagues [23] for generating the phylogram from the ITS data The utilization of ITS dataset was also integrated into a large number of Scrophulariaceae family classification studies [2, 17, 30] We also did the taxonomy analysis with the two-locus barcode located on chloroplast (rbcL and trnL-trnF) which are also widely used as plant DNA barcodes for Scrophulariaceae [28, 31, 32] By merging the Chloroplast dataset with the ITS data, we have improved the reliability level of the analysis with a higher value of BI and ML bootstrap analysis The combination of multi-loci for generating phylogenetic trees is a controversial method for reducing the inconsistency from different single locus analyses and creating a ‘total evidence’ approach [25] In addition, the utilization of ITS locus combined with two plastid loci is proposed as the silver standard method for land plant classification [10] The adding of a locus which has lower rates of evolution in plant plastids such as spacer regions (trnH-psbA, trnL-trnF…) and rbcL has shown more effective and precise results in separating closely related plants [33] In conclusion, we have identified a close relationship between the Huyen-sam samples HSa-3A, HSa-1B, HSa1A, HSa-4B, HSa-2A with the S ningpoensis using combined DNA barcodes generated from loci namely ITS, rbcL and trnL-trnF The sequence data generated from this project could enhance the further studies about the diversity of medicinal plant in Vietnam or confirmation of plant material in Vietnam herb market The phylogenetic analysis followed a general pipeline with BI and ML bootstrap analysis This strategy could be promisingly applied for not only Scrophularia L., but also other valuable herbs of the other genera in Vietnam ACKNOWLEDGEMENTS This study was supported by the Preservation of Vietnamese Herbarium genetic resources for medicine development project All the experiments and analysis in the research were performed at Institute of Genome Research, Vietnam Academy of Science and Technology, Hanoi, Vietnam REFERENCES [1] E Fischer (2004), Scrophulariaceae (in The families and genera of vascular plants), Springer, 7, pp.333-432 [2] A Scheunert, G Heubl (2011), “Phylogenetic relationships among new world Scrophularia L (Scrophulariaceae): New insights inferred from DNA sequence data”, Plant Systematics and Evolution, 291(1-2), pp.69-89 [3] J Tian, X Ye, Y Shang, Y Deng, K He, X Li (2012), “Preparative isolation and purification of harpagoside and angroside C from the root of Scrophularia ningpoensis Hemsley by high-speed counter-current chromatography”, Journal Separation Science, 35(19), pp.2659-2664 [4] T Kajimoto, M Hidaka, K Shoyama, T Nohara (1989), “Iridoids from Scrophularia ningpoensis”, Phytochemistry, 28(10), pp.2701-2704 [5] A.P Sagare, C.L Kuo, F.S Chueh, H.S Tsay (2001), “De novo regeneration of scrophularia yoshimurae Yamazaki (Scrophulariaceae) and quantitative analysis of harpagoside, an iridoid glucoside, formed in aerial and underground parts of in vitro propagated and wild plants by HPLC”, Biological and Pharmaceutical Bulletin, 24(11), pp.1311-1315 [6] Nguyen Tien Ban (2005), Scrophulariaceae (in Plant category of Vietnam), Agricultural Publisher, 3, p.233 [7] S Yang, J Li, Y Zhao, B Chen, C Fu (2011), “Harpagoside variation is positively correlated with temperature in Scrophularia ningpoensis Hemsl”, J Agricultural Food Chemistry, 59(5), pp.16121621 [8] O Seberg, G Petersen (2009), “How many loci does it take to DNA barcode a crocus?”, PloS one, 4(2), p.e4598, doi: 10.1371/ journal.pone.0004598 [9] L.T.T Hien, H.D Boer, N.V Hai, L.T Huong, N.M Huong, L Bjork (2012), “DNA molecule bar code and bar code data system”, Journal of Biotechnology (VN), 10, pp.393-405 [10] M.W Chase, et al (2005), “Land plants and DNA barcodes: short-term and long-term goals”, Philosophical Transactions of the Royal Society, Biological Sciences, 360(1462), pp.1889-1895 [11] W.J Kress, et al (2005), “Use of DNA barcodes to identify flowering plants”, in Proceedings of the National Academy of Sciences of the United States of America, 102, pp.8369-8374 [12] D.Y Wang, et al (2017), “Evaluation of DNA barcodes in Codonopsis (Campanulaceae) and in some large angiosperm plant genera”, PloS one, 12(2), p.e0170286, doi.org/10.1371/journal.pone.0170286 [13] J.M Saarela, et al (2013), “DNA barcoding the Canadian Arctic flora: core plastid barcodes (rbcL + matK) for 490 vascular plant species”, PloS one, 8(10), p.e77982, doi.org/10.1371/journal.pone.0077982 [14] X Guo, X Wang, W Su, G Zhang, R Zhou (2011), “DNA barcodes for discriminating the medicinal plant Scutellaria baicalensis (Lamiaceae) and its adulterants”, Biological and Pharmaceutical Bulletin, 34(8), pp.1198-1203 [15] C Garcia Robledo, et al (2013), “Tropical plant-herbivore networks: reconstructing species interactions using DNA barcodes”, PloS one, 8(1), p.e52967, doi.org/10.1371/journal.pone.0052967 [16] L.T Hương, N.N Linh, B.M Minh, H.H Hạnh, H.T.T Hue, N.V Hai, H.V Huan, L.T.T Hien (2017), “Applied DNA barcode assists JUne 2018 • Vol.60 Number Vietnam Journal of Science, Technology and Engineering 63 Life Sciences | Pharmacology, Biotechnology in the identification of some ginseng species in the genus ginseng (Panax L.)”, Journal of Biotechnology (VN) 15, pp.63-72 [17] A Scheunert, G Heubl (2014), “Diversification of Scrophularia (Scrophulariaceae) in the western mediterranean and macaronesiaphylogenetic relationships, reticulate evolution and biogeographic patterns”, Molecular Phylogenetics and Evolution, 70, pp.296-313 [18] G.N Feliner, J.A Rosselló (2007), “Better the devil you know? Guidelines for insightful utilization of nrDNA ITS in species-level evolutionary studies in plants”, Molecular Phylogenetics and Evolution, 44(2), pp.911-919 [19] J.D Clarke (2009), “Cetyltrimethyl ammonium bromide (CTAB) DNA miniprep for plant DNA isolation”, Cold Spring Harbor Protocols, 2009(3), doi: 10.1101/pdb.prot5177 [20] T.A Hall (1999), “BioEdit (version 7.0.5.1): a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT”, Nucl Acids Symp Ser., 41, pp.95-98 [21] F Ronquist, J.P Huelsenbeck (2003), “MrBayes 3: Bayesian phylogenetic inference under mixed models”, Bioinformatics, 19(12), pp.1572-1574 [22] F Ronquist, et al (2012), “MrBayes 3.2: efficient Bayesian phylogenetic inference and model choice across a large model space”, Systematic Biology, 61(3), pp.539-542 [23] A Scheunert, et al (2012), “Phylogeny of tribe Rhinantheae (Orobanchaceae) with a focus on biogeography, cytology and reexamination of generic concepts”, Taxon, 61(6), pp.1269-1285 [24] K Tamura, et al (2013), “MEGA6: molecular evolutionary genetics analysis version 6.0”, Molecular Biology and Evolution, 30(12), pp.2725-2729 64 Vietnam Journal of Science, Technology and Engineering [25] J.P Huelsenbeck, J.J Bull, C.W Cunningham (1996), “Combining data in phylogenetic analysis”, Trends in Ecology & Evolution, 11(4), pp.152-158 [26] M.A Perez Gutierrez, et al (2012), “Phylogeny of the tribe Fumarieae (Papaveraceae s.l.) based on chloroplast and nuclear DNA sequences: evolutionary and biogeographic implications”, American Journal of Botany, 99(3), pp.517-528 [27] D.T Loi (2004), Vietnamese medicinal plants and herbs, Medical Publishing House [28] D Do, L.Z Drábková (2017), “Herbarium tale: The utility of dry specimens for DNA barcoding Juncaceae”, Plant Systematics and Evolution, 304(2), pp.1-14 [29] D.E Schindel, S.E Miller (2005), “DNA barcoding a useful tool for taxonomists”, Nature, 435, p.17, doi:10.1038/435017b [30] A Scheunert, G Heubl (2017), “Against all odds: Reconstructing the evolutionary history of Scrophularia (Scrophulariaceae) despite high levels of incongruence and reticulate evolution”, Organisms Diversity & Evolution, 17(2), pp.323-349 [31] K.L Bell, V.M Loeffler, B.J Brosi (2017), “An rbcL reference library to aid in the identification of plant species mixtures by DNA metabarcoding”, Applications in Plant Sciences, 5(3), doi: 10.3732/ apps.1600110 [32] J.H Chau, N O’Leary, W.B Sun, R.G Olmstead (2017), “Phylogenetic relationships in tribe Buddlejeae (Scrophulariaceae) based on multiple nuclear and plastid markers”, Botanical Journal of the Linnean Society, 184(2), pp.137-166 [33] E Pennisi (2007), “Wanted: a barcode for plants”, Science, 318(5848), pp.190-191, doi: 10.1126/science.318.5848.190 JUne 2018 • Vol.60 Number ... tested plant samples and the species of Scrophularia L., the DNA sequences of examined regions namely ITS, rbcL and trnL-trnF of species involving in genus Scrophularia L and some other genera of Lamiales... pulse-quickening, anti- 5.8S classification of Scrophularia L samples in Vietnam sequence Due to the convenience of amplification, the ITS inflammation, and antibiotic [27] .In the Vietnam Plant data... resources for medicine development project All the experiments and analysis in the research were performed at Institute of Genome Research, Vietnam Academy of Science and Technology, Hanoi, Vietnam