Summary of biologicaldoctoral thesis: Research on species, distribution and intoxicant of Amanitaceae R.Heim ex Pouzar in Highland

Research Objectives: Identify some biological, ecological characterisitics of Amanitaceae in Highland. Analyze intoxicant of some species in Amanita genus.

MINISTRY OF EDUCATION VIETNAM ACADEMY AND TRAINING OF SCIENCE AND TECHNOLOGY GRADUATE UNIVERSITY SCIENCE AND TECHNOLOGY -Name Ph.D Tran Thi Thu Hien RESEARCH ON SPECIES, DISTRIBUTION AND INTOXICANT OF AMANITACEAE R.HEIM EX POUZAR IN HIGHLAND MAJOR: Botany Code: 42 01 11 SUMMARY OF BIOLOGICALDOCTORAL THESIS HA NOI - 2018 This thesis was fulfilled at Graduate University of Science and Technology, VietNam Scientific instructor 1: Assoc Prof Dr Tran Huy Thai Scientific instructor 2: Assoc Prof Dr Le Ba Dung Reviewer 1: Prof Dr Pham Quang Thu Reviewer 2: Assoc Prof Dr Tran The Bach Reviewer 3: Ph.D Ha Minh Tam The thesis will be defended in the Graduate University of Science and Technology (GUST) council at Vietnam Academy of Science and Technology (VAST) at …… on… 2018 This thesis may be found at: - The library of GUST - National Library of Vietnam INTRODUCTION Significance of the research Fungi were a saprophyte in the ecological enviroment They could extract enzyme to the enviroment to resolute complex molecules into simple substances Thus they play the important role into improve the natural cycle of material circulation, mineralization of organic compounds, freshing the ecological environment, increasing the fertility of the soil, so increase crops and forest trees productivity The ecosystem in the Central Highlands is diverse with six main ecosystem types, including tropical evergreen closed forest, deciduous subtropical wet forest, deciduous semi-evergreen tropical forest, coniferous mixed bamboo forest, grass and shrub, residential areas Flora and founain this area is very abundant, has many rare and precious species in Red Data Book of Vietnam Nature condition in Central Highlands is convenient to development of Fungi and Amanita genus The research on large fungi is very little, concentrated on midland area In the Central highlands, there are some research in South of Central highlands, the other areas almost has not researched Amanitaceae play the important role in the Fungi as a diversities and special in poison, theses Fungi are highly toxic and easily confused with some edible fungus The habit of using mushrooms in the wild and from the forest as food is quite common to the people in the locality This areas was difficulties economic areas, living standard of the people is very low, most of them are poor and dependent forest Thus forest is a sources to provide a food for living, among them mushroom is a the food that people say is a specialty Wild mushrooms was delicious and aromatic with very high nutrients food But it is also unfortunate confusion between the poisonous mushrooms and edible mushrooms In the nature, there are alot of poisonous mushroom belong too other genus susch: Amanita, Galerina, Lepiota, inobybe, Agaricus… eg: The genus Amanita have Amanita verna, Amanita virosa, Amanita phalloides… should be a confusion for people when using wild mushrooms as food, in fact, there have been many cases of lethal fungal poisoning due to lack of knowledge about poisonous mushrooms Inoder to provide the knowledge to the people who understand and distinguish between the poisonous mushrooms and edible mushrooms is very necessary Thus, I have chosen the topic “Research on species, distribution and intoxicant of Amanitaceae R.Heim ex Pouzar in Highland” Research Objectives - Identify some biological, ecological characterisitics of Amanitaceae in Highland - Analyze intoxicant of some species in Amanita genus Scientific significance of the research - Research on biological, ecological characterisitics Amanita genus - Supplement large mushroom list particulary in Highland and Vietnam in general, simultaneously provide data basic for the other research fields Practical significance of the research Identify the poisonous mushrooms in the nature to prevent fungal poisoning New result of the research It is the first time to have a research on Amanitaceae, establish the list of species of Amanitaceae in Highland Identify the scienctific name of 23 species among 33 species and uses molecular biology to identify 16 species of this family in the Central Highlands Introduce 15 species as a new record for large fungi list of Vietnam and species could be a new species Research on biological, ecological characterisitics Amanita genus - Establish the multivariate regression equation to focast the distribution of Amanita species was Tansoxuathien = C + a*l + b*m + c*h - d*t - Determined the intoxicant of Amanita sp.1 to causing death of experiment animal by oral with LD50 was 4750 mg/kg weight Chapter layout of thesis This thesis is including 159 pages, 12 tables, 37 figures, map and index The sections of the thesis were: Index, list of tables, list of figures, list of abbreviations, list of charts Introduction (5 pages); Chapter 1: Overview of publications (30 pages); Chapter 2: Subject, location, content and research methods (23 pages); Chapter 3: Research results (90 pages); Conclustion and recommend (2 pages); List of published by the author related to the thesis (2 pages); Refefences (8 pages); Index CHAPTER OVERVIEW OF PUBLICATIONS 1.1 Fungi classification system 1.1.1 History of Fungi taxonomy 1.1.2 Basidiomycete and taxonomy system 1.1.3 Trinh Tam Kiet system Div Basidiomycota R T Moore (1980) Fam Amanitaceae R.Heinn ex Puozar (1983): genus (+23 syns) Characteristic: Fruit body is fleshy, easy to putrid Cap is umbrella shape, stalk central attached, easy to separate Spore radiation produce in the gill Gill free Spores glabrescent, no colour in the microscope, pink when concentrated Young fruit body has cover by two membrance, scar when adult * Gen Amanita Pers (1987): Large distriobution, many species were rooting mushrooms, some saprophyte Characteristic of Amanita genus: - Many colours like: red, orange, yellow - Cap fleshy, umbrella shape - Gill large, white or yellow - Stalk fleshy, central attached, easy separate - Spore no colour, globose to elippsoidal, glabrescen - Saprophyte on land - When the fruit body is immature, young body volva and skirt connect from cap margin to stalk Then tear to ring and volva – these are particular characteristic of Amanita genus * Gen Limacella Murrill (1911): including species * Gen Catatrama Franco-Mol 1991: inculuding 02 species According to Trinh Tam Kiet, Le Ba Dung, Ngo Anh, Le Van Lieu there are 37 species (among them 33 species was identified and 04 species was not identified) in Amanitaceae family, 12 species has been described 1.1.4 Fungal poisoning from Amanitaceae situation Mycetism was a toxic effects from eating the intoxicant in the mushroom The symptoms are from disorders digestive to death The toxins contained are secondary metabolites produced by the distinct biochemical in the fungi cell Mushroom poisoning was a result by eating wild mushroom which not exactly identify Mushroom poisoning sometimes happened with experience mushroom picker Vietnam was a country which had abundant biodiversity in the wold Recently, there are 3000 fungi species had been recorded in Vietnam in which 1800 species lare fungi, among them there are 50 species has intoxicant Most of the poision mushroom was not lethal poision mushroom, but the lethal poision mushroom almost was Amanitaceae such as Amanita phalloides, Amanita virosa, Amanita verna Amanita species are confusing to other mushroom species, specially when young, boddy ovoid has volve is similar to Volvariella esculenta, Volvariella bombycina or other species Bovista, Lycoperdon… CHAPTER SUBJECT, LOCATION, CONTENT AND RESEARCH METHODS 2.1 Subject, location, content and research methods 2.1.1 Subject Amanitaceae species has distribution in the Highland 2.1.2 Material - Olympus microscope (Japan), Olympus magnifying glass (Japan), colour table, KOH liquid… - Tools: + In the field: Chisel, knives, plastic bags, cameras … + On tha laboratory: the pick, razor, lamen, … + Needle, eppendof, aseptic water, analysis scale and other chemistries, some of molecular chemistries of Sigma, Merck, CTAB, Tris base, acid Boric , NaCl, dNTPs, EDTA, 6X orange loading dye solution, Taq Polymeraza, Ethanol, 2-propanol, Acetic acid glacial, Phenol, Chloroform, isoamyalcohol, Agarose and ITS primer Animal: BALB/c thoroughbred mouse was healthy in animal shelter of Institute of Biotechnology, Vietnam Academy of Science and Technology Mouse has feed by standard food and free water ITS primer list (White et al 1989) No ITS1 Mồi ITS4 Nucleotide sequence TCCGTAGGTGAACCTGCGG TCCTCCGCTTATTGATATGC 2.1.3 Location Highland area (Chu Yang Sin National park, Yok Don National park, Ea Sô Nature conserve, Bidoup Núi Bà National Park, Chư Mom Ray National park, Kon Ka Kinh National park) 2.2 Contents - Investigate and collect the specimen of Amanataceae in the Highland - Analyse biological, ecological characteristic of Amanitaceae collected species in Highland - Identify the species of specimen was collectd and establish the List of Amanataceae species in Highland - Analyse intoxic of one species of Amanataceae family 2.3 Research Methodology 2.3.1 Collecting method for fungi in the Field work - Collect Amanataceae specimen by line survey that go through the different representations (broadleaved forest, coniferous forest, mixed forest ) in Highland - The time to collect specimen: in rainy season (from June to November) The specimen was collected base on main characteristic of Amanitaceae family 2.3.2 Processing and preservation specimen method Specimen was preserve in air and cool place Change the cover when wet or dirty Describe the characteristic of species on the field book such: size, colour, cap surface, merge characteristic, spore, stalk, gill, ….the species was not identified or have enough standard sould be soaked 2.3.3 Specimen analyze method 2.3.3.1 Morphology 2.3.3.2 Microscopic characteristics 2.3.4 Identify 2.3.4.1 Comparative morphologic method Base on document of Trinh Tam Kiet (2012,2013), Le Ba Dung (2003), Teng (1964), Singer R.(1986), Jiri Baier (1991), Denis R Benjamin (1995) 2.3.4.2 Moleculare identifying method Some of the species had similar characteristic, thus we use moleculare indentifying method to analyze the distent between them 2.3.5 Toxicity test method Toxicity test method is to Confirm the toxicity at different doses of the test substance when tested on animals Animalswas divided to other goups, in which group animals has one dose, and increase the dose from one group to another Note the death animals in the group, the dose and number of death animals in the group is an important parameter in Toxicity test method DoTrung Dam, Dodehe Yeo et al (2012), N’dia Kouadio Frédéri et al (2013), Aristide Traore et al (2014) 2.3.6 Determined ecological factors method Determined ecological factors method (temperature, humidity, light, altitude) by using Tiger Direct HMAMT-110 (USA), TigerDirect LMLX1010B (USA), GPS Garmine Trex Vista HCx (USA) 2.3.7 Analyze the interrelation of ecological factors method MS TAT 2009 and Excel software used for statistical processing Statgraphic Centurion XV software to to establish multivariate regression and to analyze the relationship of density, frequency of occurrence of species Mushrooms with ecological factors CHAPTER RESULT AND DISCCUSION 3.1 Amanitaceae R.Heinn ex Puzar (1983) morphology Fam Amanitaceae R.Heinn ex Puozar (1983): genera Fruit body fleshy, easy to putrid Cap is umbrella shape, stalk central attached, easy to separate Spore radiation produce in the gill Gill free ,Spores glabrescent, no colour in the microscope, pink when concentrated Young fruit body has cover by two membrances, scar when adult Gen Amanita Dill ex Boehm 1760 Including the most poision mushroom distribution in hold the world Characteristic: - Many colour like: red, orange, yellow - Cap fleshy, umbrella shape - Gill large, white or yellow - Stalk fleshy, central attached, easy separate - Spore no colour, globose to elippsoidal, glabrescen - Spore from 5-7 x 10-12 µm - Saprophyte on land - Hole 20 - 300 - Young body Volva and skirt connect from cap margin to stalk Then tear to ring and volva – these are particular characteristic of Amanita genus Gen Limacella Murrill 1911: 03 species rarely distribute in Asia Gen Catatrama Franco-Mol 1991: there are 02 species in the world 3.2 Amanitaceae species list in Highland This thesis was investigated, described, identified and established 25 species of Amanita, Amanitaceae (table 3.1) (V) Chu Mon Ray NP (Kon Tum): 14°18′ - 14°38′ N, 107°29′ 107°47′ E (IV) KonKa Kinh NP (Gia Lai): 14°09′ 14°30′ N; 108°16′ 108°28′ E (II) Yok Don NP: 12°45′ - 13°10′ N; 107°29′30″ 107°48′30″ E (III) Chu Yang Sin NP: 120°14′16″ 130°30′58″ N; 108°17′47″ 108°34′48″ E (I) (VI) Bidoup Núi Bà NP: 12°00'00" 12°30'00" N; 108°35'00" 108°75'00" E Ea sô NC: 12O53’18” 13O02’12” N; 108O28’48” 108O43’54” E Map of collection Amanitaceae speciemen in Central Highlands 3.3 Key to species of genus Amanita Stalk complete, volva receptacle Stalk complete, volva not receptacle Stalk collar shape 11 Stalk not nectar shape 12 Volva bulb shape, stalk ring Volva bulb shape, stalk not ring Cap and stalk dark yellow to ferruginous, ring collar shape connect to 1/3 stalk above Spore 5-7 x 8-10 µm Amanita flavoconia Cap and stalk dirty white, minute scales in surface, ring connect 1/3 stalk basal Spore 6-8 x 8-10 µ Amanita concentrica 11 Stalk withou scales Stalk scales, cap verrucose smaller than cm Cap verucose saller cm Cap verucosecó larger than cm Cap light brown, spore smaller μm, verucose sparse, concentrate in a central, spore oblong- ellipsoid, 5-6×7-9 μm, endorsperm yellow Amanita excelsa Spore larger than μm 10 Cap flat, slightly concave Ring stalk distintc; Spore globose, 7-9 x 10-12 µm, endorsperm seed oil of floating Amanita pilosella Cap tan colour, stalk cylindiric,light whight, fiber system crystal, baffled, ring stalk indistintc, spore 5-8 x 9-12 µmAmanita multisquamosa Cap dark brown, rings on the central of stalk, surface mucusly, spore 6-8 x 8-10 µm .Amanita pantherina Cap convex, white, around the cap have folds, fiber system light yellow, wall, spore 6-8 x 9-12 µm, endorsperm green seedsAmanita hesleri Cap umbrella shape, white, scaly white; Stalk white, ring distinct Fiber system crystal, whithout wall, spore - 10m in diameter, endorsperm green without seeds Amanita cokeri 10 Verucose denserly on cap surface, spot many colour: from white to black, ring collar shape distinct, spore 6-9 x 8-11 µm, endorsperm seed oil of floating Amanita sp.DL274 10 Verucose denserly on cap surface, white; Stalk bulge in the middle, Spore 7-9 x 8-12 µm, endorsperm seed oil Amanita abrupta 10 Verucose sparse, spore thick, globose, 6-8 x 9-11 µm, endorsperm yellow to green seeds, Cap light grey-brownAmanita sp DL89 11 Cap capanulate, light grey to brown-grey, stalk cylindric, ring white, scar shape Spore 6-8 x 8-10 µm Fiber system without wallAmanita Phalloides 11 Cap smooth, orange yellow 14 11 Cap is not smooths 13 12 Fruit body conical 16 12 Fruit body capanulate 17 12 Fruit body umbrella shape 18 13 Cap umbrella shape, white verucose on cap surface, spore elipsoid starch granules, 4-6 x 8-10 µm Pore with pink colour, ring closed to cap, fiber system without wall (4-6µm in diameter) Amanita Sp.1 13 Stype cream white 15 12 14 Cap umbrella shape, yellow on the top Spore yellow, without endorsperm, 5-7 x 9-12 µm, fiber system without wall Amanita cacsarea 14 Cap umbrella shape, yellow on the top; stalk ligh yellow or scream white; Spore has yellow endorsperm, 5-7 x 8-10 µm; fiber system has wall Amanita Levistriata 15 Cap umbrella shape, cream white, brown verucose on cap surface, central of cap brown yelow, ring ¼ from top of stalk, stype slabs free, gill not equal, closed, cream white; fiber system without wall, spore elipsoid, 67 x 10-13 µm Amanita sp.2 15 Cap umbrella shape, dark greyin the centre, from centre to the edge scattered grey spot; Ring cream white, stype slabes cream white, ring from /2 of stalk, spore ellipsoid, 5-7 x 9-12 µm Amanita Sp CĐ 279 15 Cap umbrella shape, white to light pink, spore ellipsoid, endorsperm green seed, 5,4-7 x 9-11µm, fiber system has wallAmanita Eliae 16 Cap parts distinct: outer dark brown have rough, inner white without rough, spore ellipsoid, endorsperm yellow seed oil, 8,2-10,5 x 6-8µm, fiber system crystal, wall, 3-4 µm Amanita fulva 16 Cap unicolour 19 17 Cap yellow brown, Stalk scabrous, many small scale, spore ellipsoid has endorsperm, Spore 6-8 x 9-12µm .Amanita Sp.DH048 17 Spore geometry 21 18 Cap merge radiation have roughs 22 18 Cap merge not radiation without rough of rays 23 19 Cap light brown, spore globes, green, endorsperm oil seed Spore 5,5-7 x 8-9µm Calyptroderma 19 Spore ellipsoid 20 20 Cap light honey yellow, spore ellipsoid, endorsperm light green oil seeds, 6,5-7,5 x 10-12,8µm Amanita sp.DL 127 20 Cap dirty white, scabrous, merge are closely packed Spore ellipsoid, 79x 10-12µm, endorsperm seed oil Amanita Sp.DL 001 21 Cap red, smooth, Stalk yellow, merge deep Spore globose, endorsperm oil seeds, 6-7 x 8-9µm, fiber system crystal (3-4 µm), wallAmanita caesareoides 21 Cap dirty white in centre, merge folds, spore globose, 7.5-8 x 9-10µm, without endorsperm, hệ fiber system light yellow, without wall Amanita punctata 13 22 Cap dirty white, centre light yellow, slightly concave, spore globose, glabrescen, without endorsperm (8-12 µm in diameter), fiber system has wall, branched (2,2-4 µm) Amanita Sp.PR 421 22 Spore ellisoid 24 23 Cap brown, white scales, Stalk from white to brown; spore oval or obvoid (6-8 x 8-10µm), endorsperm green hạt dầu, fiber system branhed, has wall (3-4 µm) Amanita Pachycolea 23 Spore ellisoid 26 24 Cap yellow, centre dark yellow, Stalk straw yellow, deep concave, scabrous, spore ellipsoid, endorsperm brown seed oil, 6-8 x 10-12µm, fiber system without wall, 5-6 µm Amanita similis 24 Fiber system branched 25 25 Cap grey brown, centre dark grey, spore ellisoid, endorsperm light yellow, 5-7x 10-12µm, fiber system branched Amanita battarrae 25 Cap cream, centre light brown, spore ellipsoid, endorsperm seed oil, 6-8 x 8-10µm, fiber system light yellow, branched, has wall Amanitas spreta 26 Cap yellow, central orange lighter than merge, Stalk yellow, yellow scales, Spore ellipsoid, 7,5- x 8-10 µm, endorsperm seed oil, fiber system has wall Amanita Crocea 26 Fiber system not branched 27 27 Cap umbrella shae, flatt or slightly concave in the centre, white to cream yellow, spore 2,3 – 3,5 x 4- 6µm, has endosperm, fiber system not branched Amanita Sp.DL019 27 Cap cream yellow, centre concave, darker, Stalk cream Spore ellipsoid, 5-7x 9-11µm, endorsperm seed oil, fiber system crystal, not branched (4-6 µm) Amanita amanitoides 3.4 Describe the species in Amanita genera in Highland 3.5 Effect of ecological factors on the distribution of Amanita 3.5.1 Effect of temperature on the distribution of Amanita 14 From the result, we found that temperature was a ecologica factor has effec to the appearance of Amanita species In a temperature as 19220C, frequency appears has dominated, take 68% from all the temperature levels, take 24% from the lower 190C and 8% from 220C 3.5.2 Effect of humidity on the distribution of Amanita Base on the percentage of Amanita species from the figure, show that humidity could impact on the appearance of Amanita species In 8590% humidity, frequency appears take 78%, this humidity is the best for grow and development of Amanita In more than 90% humidity and less than 85% frequency appears take 5%, 17% This becaused of in less than 90% humidity with temperature more than 22 0C is not a otimal condition 15 for grow and development of Amanita In more than 90% humidity, the water in the cell inconvenient to decay and gowth of fiber system In more than 90% humidity and less than 85% is inconvenient to development of Amanita species, thus frequency appears is low Central Highlands has 85-90% humidity, so this area has convenient condition to the development of Amanita 16 3.4.3 Effect of altitude on the distribution of Amanita From the result of research, altitude effect to frequency appears of Amanita species show that from 200 to more than1100m from sea level, altitude effect has descending by evelation In 500 - 800m frequency appears take 74%, then 17% in 200 - 500m, faster descending follow 7% in in 800-1100m to 2% in 1100m This is explained by in morer than 800m from sea level, vapor is higher, oxygen content is lower cause to humidity in the air is to 95-100%, this condition is inconvenient for development of Amanita Thus in 500-800 m e altitude is the convenient for development of Amanita 17 3.5.4 Effect of light indensity on the distribution of Amanita The result of research shows that the light has been efected to the appearance of fruit body of Amanita Amanita species in Highland has distributed in area which has light less than 8000 -10000 lux (take 66%), 22% in 8000 lux and 6% in more than 10000 lux The fruit body developmet of Amanita the best in 8000-10000 lux Thus, this result also consistent with the investigation in the field, Amanita species appear in coniferous forest an scattered forest 3.5.5 Effect of habitat on the distribution of Amanita 18 The result of research shows that habitat has been efected to the appearance of fruit body of Amanita Amanita species distribute almost in coniferous forest, mixed forest, grass and shrub 3.5.6 Model predicts multivariable regression to forecast the frequency of occurrence (density) of species based on ecological factors (temperature, humidity, altitude and light intensity) Data base from 99 investigated points synthetic in Excel programme, using Statgraphic Centurion XV software to set of multivariate regression and analysis relationship, frequency of occurrence of Amanita species whith the ecological factors Data base of 99 investigated points of species, multivariate regression with ecological factors, the variables that have not satisfied the condition of relationship with frequency of Amanita species occurrence was excluded in P > 0,05 Detecting relationships from simple to complex functions, from single to combinations variable, the results of the establised multivariate regression for the mushroom species are as follows: Table 3.7 The value of the multivariate regression equation Parameters a Anhsang Doam Docao Nhietdo Value Error T -1.98314 6.81899 -0.290825 0.00207615 0.000191312 10.8521 0.283289 0.0470994 6.01471 0.00764196 0.00112211 6.81033 -0.298556 0.134036 -2.22744 P-value 0.7718 0.0000 0.0000 0.0000 0.0281 With 05 ecological factor variables, 04 factors has importance effect to the Amanita species frequency of occurrence, follows: Tansoxuathien = C + a*l + b*m + c*h - d*t (C, a,b,d were constant) With n = 99 and all the variables has been checked by t condition as P < 0,05; shows that light intensity (l), air humidity (m), altitude (h) and air temperature (t), has importance effect to the dentity and Amanita species frequency of occurrence At the same time, with R2 = 72.7894% and P < 0,05 the relationship of frequency of occurrence and ecological factors is 19 very tight, and interacting with each other as follows: The frequency is inversely proportional to the temperature, which suggests that as the temperature rises it will reduce the Amanita species frequency of occurrence The Amanita species frequency of occurrence is proportional to the relative humidity, light intensity and altitude, which means that when the higher the air temperature decreases, the air humidity increases, the number of mushroom species appears to increase This model help for understanding of ecological request of Amanita species, provide data base for find out the Amanita species distribution areas and species’s planting and growing 3.6 The result of intoxic research of Amanita sp.1 3.6.1 The result of intoxic research of Amanita sp.1 by oral With the experimental layout above, the result was in 3.8 table Table 3.8 Number of death mouse, external appearance of mice when drinking Lot Sample (mg/kgP) The numbe r of death mouse among 72 hours (indivi dual) The number of death mouse after 72 hours (individual) 3500 0 4000 4500 (after days) 20 External appearance mouse among 0-72 hours After hours from drinkin, mouse move and eat normally, after 24-72 hours mouse has increased nerve impulsivity, reduced diet After hours from drinkin, mouse move and eat normally, after 24-72 hours mouse has increased nerve impulsivity, reduced diet After hours from drinkin, mouse move and eat normally, after 24-72 hours 5000 (after days) 5500 (after days) 6000 10 7000 10 21 mouse has increased nerve impulsivity, reduced diet, some individuals have eyes protruding After hours from drinkin, mouse move and eat normally, after 24-72 hours mouse has increased nerve impulsivity, reduced diet, some individuals have eyes protruding The diet individuals have been weekens and dead After hours from drinkin, mouse move and eat normally, after 24-72 hours mouse has increased nerve impulsivity, diet, eyes protruding After hours from drinkin, mouse move and eat normally, after 24-72 hours mouse has increased nerve impulsivity, diet, eyes protruding After hours from drinkin, mouse move and eat normally, after 24-72 hours mouse has increased nerve impulsivity, diet, eyes protruding Dose (mg/kgP) 3500 4000 4500 5000 5500 6000 Table 3.9 Data synthesized The N a b number of (mg) death mouse among 72 hours (individual) 10 10 500 10 500 10 500 10 500 10 10 500 Σa×b/N a×b 500 1500 2500 3500 4500 a×b/ N (mg) 50 150 250 350 450 1250 Dose of 7000mg causing death of 100% animals, however, the new dose of 6000mg is the lowest dose causing death of 100% animal, thses dose is a basis for calculating the lethal dose was caused of 50% of the experimental animals Thus the data of 7000 mg dose was ignore N (number of individuals in sample): 10 (individuals/sample) a: Distance from consecutive doses was: 500 mg b: Average mortality of two consecutive groups Base on result from table 3.9, has been determined LD50 (the dose was caused of 50% of the experimental animals death) LD50 value such follows: = LD100 - Σa×b/N = 6000 – 1250 = 4750 The result shows that: The mushroom sample was caused animal death by oral with the 50% death dose LD50 = 4750 mg/kg LD50 LD50 LD50 22 CONCLUSION AND RECOMMEND Conclusion This research was recorded that in the Central Highlands there are only genus Amanita of Amanitaceae family 913 have been collected and identified by comparative morphologic method and moleculare identifying method, 25 species was identified, among them: 13 species has been identified science mame and 12 species determined as Amanita spp 13 species included species was a new record for Vientmam, such as: Nam A caesareoides, A crocea, A flavoconia, A multisquamosa, A pilosella, A Similis Inculding 12 species determined as Amanita spp There are species have been research on nucleotide sequences.They sould be a new species Identify convenient ecological factors of development of Amanita species as follows: temperature: 19-22 0C, humidity: 85-90%, altitude: 500-800 m and and light intensity: 8000 -10000 lux Establish the multivariable regression prediction model to forcast the frequency of occurrence of Amanita species was Tansoxuathien = C + a*l + b*m + c*h - d*t Analyze intoxic of Amanita sp1, dose was caused animal death by oral with the 50% death is LD50 = 4750 mg/kg Recomend - Extensive research on the diversity of mushroom Amanitaceae families - Research detail on active ingredients in mushrooms for use in the field of medicine - Protect the living enviroment of fungy and forest LIST OF PUBLISHED BY THE AUTHOR RELATED TO THE THESIS 23 Tran Thi Thu Hien, Le Ba Dung, Nguyen Phuong Dai Nguyen, Tran Huy Thai, Thai Van Tai, Preliminary assessment of poisonous mushrooms in Nam Ka nuture reserve Dak Lak Province, VietNam, Proceeding of the 6th National Scientific Conference on Ecology and Biological resources, 2015, 1124-1129 Tran Thi Thu Hien, Nguyen Phuong Dai Nguyen, Preliminary results of Amanita genus in Buon Ma Thuot City, Dak Lak Province, Proceeding of the 2nd National Scientific Conference on Biological research and teaching in Viet Nam, 2016, 573-580 Tran Thi Thu Hien, Nguyen Phuong Dai Nguyen, Tran Thi Ngoc Thien, Five new record species of Amanita genus in Amanitaceae family for the macrofungi of Chu Yang Sin National Park, Dak Lak province, Proceeding of the 2nd National Scientific Conference of Viet Nam natural museum system, 2016, 446-451 Tran Thi Thu Hien, Nguyen Phuong Dai Nguyen, Three newly recorded species of genus Amanita Dill Ex Boehm 1760 for the macrofungi flora of Vietnam mushroom list, Proceeding of the 7th National Scientific Conference on Ecology and Biological resources, 2017, 297-302 Tran Thi Thu Hien, Tran Huy Thai, Le Ba Dung, Nguyen Phuong Dai Nguyen, Diversity Amanita genus in Kon Ka Kinh National Park, Gia Lai Province – VietNam, Proceeding of the 7th National Scientific Conference on Ecology and Biological resources, 2017, 702- 709 Tran Thi Thu Hien, Tran Thi Kim Thi, Le Ba Dung, Tran Huy Thai, Recording of three new species of the genus Amanita Dill Ex Boehm 1760 addition to the macrofungi index of Viet Nam, Tay Nguyen Journal of science, volume 27, December of 2017, 36-40 Tran Thi Thu Hien, Tran Thi Kim Thi, The diversity of Amanita Dill ex Boehm 1760 Genus in Chu Yang Sin National Park, Dak Lak Province, Tay Nguyen Journal of science, Accepted the post 24 Tran Thi Thu Hien, Tran D Khanh, Nguyen.P.D Nguyen, species diversity of the genus amanita dill ex boehm (1760) in chu yang sin national park, Đaklak, Viet Nam,Journal of scientific and Engineering research, Accepted the post 25 ... understand and distinguish between the poisonous mushrooms and edible mushrooms is very necessary Thus, I have chosen the topic ? ?Research on species, distribution and intoxicant of Amanitaceae R.Heim. .. Amanitaceae R.Heim ex Pouzar in Highland? ?? Research Objectives - Identify some biological, ecological characterisitics of Amanitaceae in Highland - Analyze intoxicant of some species in Amanita genus... layout of thesis This thesis is including 159 pages, 12 tables, 37 figures, map and index The sections of the thesis were: Index, list of tables, list of figures, list of abbreviations, list of charts