1. Trang chủ
  2. » Thể loại khác

kupdf com lehninger principles of biochemistry test bank ch 25pdf

12 418 0

Đang tải... (xem toàn văn)

Tài liệu hạn chế xem trước, để xem đầy đủ mời bạn chọn Tải xuống

THÔNG TIN TÀI LIỆU

Thông tin cơ bản

Định dạng
Số trang 12
Dung lượng 191,64 KB

Nội dung

Chapter 25 DNA Metabolism Multiple Choice Questions DNA replication Page: 950 Difficulty: Ans: C The Meselson-Stahl experiment established that: A) B) C) D) E) DNA polymerase has a crucial role in DNA synthesis DNA synthesis in E coli proceeds by a conservative mechanism DNA synthesis in E coli proceeds by a semiconservative mechanism DNA synthesis requires dATP, dCTP, dGTP, and dTTP newly synthesized DNA in E coli has a different base composition than the preexisting DNA DNA replication Page: 951 Difficulty: Ans: D When a DNA molecule is described as replicating bidirectionally, that means that it has two: A) B) C) D) E) chains independently replicating segment origins replication forks termination points DNA replication Page: 952 Difficulty: Ans: D An Okazaki fragment is a: A) B) C) D) E) fragment of DNA resulting from endonuclease action fragment of RNA that is a subunit of the 30S ribosome piece of DNA that is synthesized in the 3' → 5' direction segment of DNA that is an intermediate in the synthesis of the lagging strand segment of mRNA synthesized by RNA polymerase DNA replication Pages: 952-958 Difficulty: Ans: C Which one of the following statements about enzymes that interact with DNA is true? A) B) C) D) E) E coli DNA polymerase I is unusual in that it possesses only a 5' → 3' exonucleolytic activity Endonucleases degrade circular but not linear DNA molecules Exonucleases degrade DNA at a free end Many DNA polymerases have a proofreading 5' → 3' exonuclease Primases synthesize a short stretch of DNA to prime further synthesis 290 Chapter 25 DNA Metabolism DNA replication Page: 955 Difficulty: Ans: C E coli DNA polymerase III: A) B) C) D) E) can initiate replication without a primer is efficient at nick translation is the principal DNA polymerase in chromosomal DNA replication represents over 90% of the DNA polymerase activity in E coli cells requires a free 5'-hydroxyl group as a primer DNA replication Page: 955 Difficulty: Ans: E The proofreading function of DNA polymerase involves all of the following except: A) B) C) D) E) a 3' → 5' exonuclease base pairing detection of mismatched base pairs phosphodiester bond hydrolysis reversal of the polymerization reaction DNA replication Page: 956 Difficulty: Ans: D The 5' → 3' exonuclease activity of E coli DNA polymerase I is involved in: A) B) C) D) E) formation of a nick at the DNA replication origin formation of Okazaki fragments proofreading of the replication process removal of RNA primers by nick translation sealing of nicks by ligase action DNA replication Pages: 956-957 Difficulty: Prokaryotic DNA polymerase III: A) B) C) D) E) Ans: C contains a 5' → 3' proofreading activity to improve the fidelity of replication does not require a primer molecule to initiate replication has a β subunit that acts as a circular clamp to improve the processivity of DNA synthesis synthesizes DNA in the 3' → 5' direction synthesizes only the leading strand; DNA polymerase I synthesizes the lagging strand DNA replication Page: 961 Difficulty: Ans: E At replication forks in E coli: A) B) C) D) E) DNA helicases make endonucleolytic cuts in DNA DNA primers are degraded by exonucleases DNA topoisomerases make endonucleolytic cuts in DNA RNA primers are removed by primase RNA primers are synthesized by primase Chapter 25 DNA Metabolism 291 10 DNA replication Pages: 964-965 Difficulty: Ans: D In contrast to bacteria, eukaryotic chromosomes need multiple DNA replication origins because: A) B) C) D) eukaryotic chromosomes cannot usually replicate bidirectionally eukaryotic genomes are not usually circular, like the bacterial chromosome is the processivity of the eukaryotic DNA polymerase is much less than the bacterial enzyme their replication rate is much slower, and it would take too long with only a single origin per chromosome E) they have a variety of DNA polymerases for different purposes, and need a corresponding variety of replication origins 11 DNA replication Page: 965 Difficulty: Ans: B The function of the eukaryotic DNA replication factor PCNA (proliferating cell nuclear antigen) is similar to that of the β-subunit of bacterial DNA polymerase III in that it: A) B) C) D) E) facilitates replication of telomeres forms a circular sliding clamp to increase the processivity of replication has a 3' → 5' proofreading activity increases the speed but not the processivity of the replication complex participates in DNA repair 12 DNA repair Page: 967 Difficulty: The Ames test is used to: A) B) C) D) E) Ans: D detect bacterial viruses determine the rate of DNA replication examine the potency of antibiotics measure the mutagenic effects of various chemical compounds quantify the damaging effects of UV light on DNA molecules 13 DNA repair Page: 967 Difficulty: Ans: E In a mammalian cell, DNA repair systems: A) B) C) D) E) are extraordinarily efficient energetically are generally absent, except in egg and sperm cells can repair deletions, but not mismatches can repair most types of lesions except those caused by UV light normally repair more than 99% of the DNA lesions that occur 292 Chapter 25 DNA Metabolism 14 DNA repair Pages: 967-969 Difficulty: Ans: A Which of these enzymes is not directly involved in methyl-directed mismatch repair in E coli? A) B) C) D) E) DNA glycosylase DNA helicase II DNA ligase DNA polymerase III Exonuclease I 15 DNA repair Page: 968 Difficulty: Ans: B The role of the Dam methylase is to: A) B) C) D) E) add a methyl group to uracil, converting it to thymine modify the template strand for recognition by repair systems remove a methyl group from thymine remove a mismatched nucleotide from the template strand replace a mismatched nucleotide with the correct one 16 DNA repair Page: 968 Difficulty: Ans: D When bacterial DNA replication introduces a mismatch in a double-stranded DNA, the methyldirected repair system: A) B) C) D) E) cannot distinguish the template strand from the newly replicated strand changes both the template strand and the newly replicated strand corrects the DNA strand that is methylated corrects the mismatch by changing the newly replicated strand corrects the mismatch by changing the template strand 17 DNA repair Pages: 971-972 Difficulty: Ans: C In base-excision repair, the first enzyme to act is: A) B) C) D) E) AP endonuclease Dam methylase DNA glycosylase DNA ligase DNA polymerase 18 DNA repair Pages: 972-973 Difficulty: Ans: D The ABC excinuclease is essential in: A) B) C) D) E) base-excision repair methyl-directed repair mismatch repair nucleotide-excision repair SOS repair Chapter 25 DNA Metabolism 293 19 DNA repair Page: 974 Difficulty: Ans: C The repair of cyclobutane pyrimidine dimers by bacterial DNA photolyase involves the cofactor: A) B) C) D) E) coenzyme A coenzyme Q FADH– pyridoxal phosphate (PLP) thiamine pyrophosphate (TPP) 20 DNA repair Pages: 976-977 Difficulty: Ans: E An alternative repair system by error-prone translesion DNA synthesis can result in a high mutation rate, because: A) B) C) D) E) alternative modified nucleotides can be incorporated more readily interference from the RecA and SSB proteins hinders the normal replication accuracy replication proceeds much faster than normal, resulting in many more mistakes the DNA polymerases involved cannot facilitate base-pairing as well as DNA polymerase III the DNA polymerases involved lack exonuclease proofreading activities 21 DNA recombination Page: 982 Difficulty: Ans: D In homologous recombination in E coli, the protein that moves along a double-stranded DNA, unwinding the strands ahead of it and degrading them, is: A) B) C) D) E) chi DNA ligase RecA protein RecBCD enzyme RuvC protein (resolvase) 22 DNA recombination Pages: 982-983 Difficulty: Ans: D In homologous recombination in E coli, the protein that assembles into long, helical filaments that coat a region of DNA is: A) B) C) D) E) DNA methylase DNA polymerase histone RecA protein RecBCD enzyme 294 Chapter 25 DNA Metabolism 23 DNA recombination Pages: 982-983 Difficulty: Ans: A In homologous genetic recombination, RecA protein is involved in: A) B) C) D) formation of Holliday intermediates and branch migration introduction of negative supercoils into the recombination products nicking the two duplex DNA molecules to initiate the reaction pairing a DNA strand from one duplex DNA molecule with sequences in another duplex, regardless of complementarity E) resolution of the Holliday intermediate 24 DNA recombination Page: 983 Difficulty: Ans: E Which of the following statements is false? In vitro, the strand-exchange reaction: A) B) C) D) E) can include formation of a Holliday intermediate is accompanied by ATP hydrolysis may involve transient formation of a three- or four-stranded DNA complex needs RecA protein requires DNA polymerase 25 DNA recombination Page: 987 Difficulty: Ans: C The bacteriophage λ can lysogenize after infecting a bacterium, i.e integrate into the host bacterial chromosome by site-specific recombination, and may reside there for many generations before an excision event regenerates the viral genome in an infective form Which one of the following is not a component of these events? A) B) C) D) E) Excision requires two host proteins and two virally-encoded proteins Integration requires a viral-specific protein, called integrase RecA protein is required to catalyze the insertional recombination event The excision event relies on different sequences than the integration event The virus and the host DNAs share a 15 bp “core” region of perfect homology Short Answer Questions 26 DNA replication Pages: 950-951 Difficulty: Describe briefly how equilibrium density gradient centrifugation was used to demonstrate that DNA replication in E coli is semiconservative Ans: Equilibrium density gradient centrifugation separates DNA molecules of slightly different buoyant density For example, molecules containing 15N-labeled (“heavy”) DNA are separable from identical molecules containing 14N (“light”) DNA Meselson and Stahl grew E coli for many generations in a medium containing 15N, producing cells in which all DNA was heavy These cells were transferred to a medium containing 14N, and the buoyant density of their DNA was determined (by equilibrium density gradient centrifugation) after 1, 2, 3, etc., generations After one generation, all DNA was of a density intermediate between fully heavy and fully light, indicating that each double-stranded DNA molecule had one heavy (parental) and one light (newly synthesized) strand; Chapter 25 DNA Metabolism 295 replication was semiconservative (See Fig 25-2, p 950.) 27 DNA replication Page: 952 Difficulty: The DNA below is replicated from left to right Label the templates for leading strand and lagging strand synthesis (5')ACTTCGGATCGTTAAGGCCGCTTTCTGT(3') (3')TGAAGCCTAGCAATTCCGGCGAAAGACA(5') Ans: The polarity of the strands indicates that the top strand is the template for lagging strand synthesis, and the bottom strand is the template for leading strand synthesis (See Fig 25-4, p 952.) 28 DNA replication Page: 952 Difficulty: All known DNA polymerases catalyze synthesis only in the 5' → 3' direction Nevertheless, during semiconservative DNA replication in the cell, they are able to catalyze the synthesis of both daughter chains, which would appear to require synthesis in the 3' → 5' direction Explain the process that occurs in the cell that allows for synthesis of both daughter chains by DNA polymerase Ans: During DNA replication, one strand is synthesized continuously and the other is synthesized by a discontinuous mechanism The daughter chain, which appears to be growing in the 3' → 5' direction (the “lagging strand”), is actually being synthesized by continual initiation of new chains and their elongation in the 5' → 3' direction 29 DNA replication Pages: 952, 960 Difficulty: What is an Okazaki fragment? What enzyme(s) is (are) required for its formation in E coli? Ans: An Okazaki fragment is an intermediate in DNA replication in E coli It is a short fragment of newly synthesized DNA, attached to the 3' end of a short RNA primer Such fragments are produced by the combined action of primase (part of the primosome) and DNA polymerase III during replication of the lagging strand (See Fig 25-13, p 960.) 30 DNA replication Page: 953 Difficulty: Diagram the reaction catalyzed by DNA polymerase that occurs between deoxyribose at the end of a DNA chain and the 5' phosphates of a deoxyribonucleoside triphosphate Include the chemical structure of the phosphate group, indicate the locations of the sugar and base, and show the rearrangements of electrons that occur Ans: See Fig 25-5, p 953 31 DNA replication Page: 953 Difficulty: Nucleotide polymerization appears to be a thermodynamically balanced reaction (because one phosphodiester bond is broken and one is formed) Nevertheless, the reaction proceeds efficiently both in a test tube and in the cell Explain Ans: Base-stacking and base-pairing interactions in the polymerized DNA product stabilize it and tend 296 Chapter 25 DNA Metabolism to make the overall reaction more exergonic In the cell, pyrophosphatase may make a contribution by coupling polymerization to the highly exergonic hydrolysis of the pyrophosphate product 32 DNA replication Pages: 953-954 Difficulty: A suitable substrate for DNA polymerase is shown below Label the primer and template, and indicate which end of each strand must be 3' or 5' To observe DNA synthesis on this substrate in vitro, what additional reaction components must be added? Ans: The top strand (the primer) has its 5' end to the left; the bottom (template) strand has the opposite polarity For DNA synthesis with this substrate in vitro, one would have to add DNA polymerase, the four deoxynucleoside triphosphates, Mg2+, and a suitable buffer 33 DNA replication Pages: 954, 958 Difficulty: All known DNA polymerases can only elongate a preexisting DNA chain (i.e., require a primer), but cannot initiate a new DNA chain Nevertheless, during semiconservative DNA replication in the cell, entirely new daughter DNA chains are synthesized Explain the process that occurs in the cell that allows for the synthesis of daughter chains by DNA polymerase Ans: In the cell, initiation of DNA chains occurs via the synthesis of an RNA primer by an RNA polymerase type of enzyme (primase) This primer is elongated by DNA polymerase to produce the daughter DNA chain The RNA is removed by 5' exonucleolytic hydrolysis before replication is completed 34 DNA replication Pages: 958-962 Difficulty: DNA replication in E coli begins at a site in the DNA called the (a) _ At the replication fork the (b) _ strand is synthesized continuously while the (c) _ strand is synthesized discontinuously On the strand synthesized discontinuously, the short pieces are called (d) fragments An RNA primer for each of the fragments is synthesized by an enzyme called (e) , and this RNA primer is removed after the fragment is synthesized by the enzyme (f) _, using its (g) _ activity The nicks left behind in this process are sealed by the enzyme (h) _ Ans: (a) origin; (b) leading; (c) lagging; (d) Okazaki; (e) primase; (f) DNA pol I; (g) 5' → 3' exonuclease; (h) DNA ligase 35 DNA replication Pages: 958-961 Difficulty: Briefly describe the biochemical role of the following enzymes in DNA replication in E coli: (a) DNA helicase; (b) primase; (c) the 3' → 5' exonuclease activity of DNA polymerase; (d) DNA 1igase; (e) topoisomerases; (f) the 5' → 3' exonuclease activity of DNA polymerase I Chapter 25 DNA Metabolism 297 Ans: (a) Helicase unwinds double-stranded DNA during replication (b) Primase synthesizes short RNA primers during lagging strand replication (c) The 3' → 5' exonuclease activity of DNA polymerase proofreads newly synthesized DNA, removing mismatched nucleotides (d) DNA ligase seals nicks in the DNA at the boundaries between Okazaki fragments (e) Topoisomerases relieves the topological stress produced by the unwinding of double-stranded DNA at the replication fork (f) The 5' → 3' exonuclease activity of DNA polymerase I removes RNA primers 36 DNA replication Pages: 961-962 Difficulty: DNA synthesis on the lagging strand in E coli is a complex process known to involve several proteins Initiation of a new chain is catalyzed by the enzyme (a) _, and elongation is catalyzed by the enzyme (b) Synthesis is discontinuous, yielding short segments called (c) _, which are eventually joined by the enzyme (d) , which requires the cofactor (e) _ Ans: (a) primase; (b) DNA pol III; (c) Okazaki fragments; (d) DNA ligase; (e) NAD+ 37 DNA replication Page: 962 Difficulty: List two proteins or enzymes, other than DNA polymerase III, that are found at the replication fork in E coli; describe each of their functions with no more than one sentence Ans: The proteins are listed in Table 25-4, p 962 They include (a) DNA polymerase I, which fills gaps and excises RNA primers; (b) primase (the DnaG protein), which synthesizes short RNA primers; (c) DNA ligase, which seals nicks; and (d) proteins that aid in DNA unwinding and supercoiling 38 DNA replication Pages: 963-964 Difficulty: In the bacterial cell, what are catenated chromosomes, when they arise, and how does the cell resolve the problem posed by their structure? Ans: Catenanes are topologically interlinked circular chromosomes, which are the normal end result of DNA replication of the parental circular genome when the bidirectional replication forks meet They are unlinked by the bacterial topoisomerase IV (a type II enzyme), and thus become free to segregate into daughter cells upon cell division (See Fig 25-17, p 964.) 39 DNA replication Page: 966 Difficulty: Why is the drug acyclovir effective against the herpes simplex virus? Ans: Acyclovir is a guanine nucleoside with an incomplete ribose ring, which can be phosphorylated much more efficiently by the viral thymidine kinase than the host enzyme Further conversion forms acyclo-GTP, which competitively inhibits the viral DNA polymerase more strongly than the host enzyme, and when incorporated into DNA is a chain terminator, because it lacks a 3' hydroxyl group 298 Chapter 25 DNA Metabolism 40 DNA repair Page: 966-967 Difficulty: The high fidelity of DNA replication is due primarily to immediate error correction by the 3' —> 5' exonuclease (proofreading) activity of the DNA polymerase Some incorrectly paired bases escape this proofreading, and further errors can arise from challenges to the chemical integrity of the DNA List the four classes of repair mechanisms that the cell can use to help correct such errors Ans: The four classes are listed in Table 25-5 (p 967), and consist of (1) mismatch repair, (2) baseexcision repair, (3) nucleotide-excision repair, and (4) direct repair 41 DNA repair Page: 967 Difficulty: List three types of DNA damage that require repair Ans: The defects in DNA that require repair include (a) mismatches that occur during replication; (b) abnormal bases; (c) pyrimidine dimers produced by UV irradiation Other answers are possible 42 DNA repair Pages: 967-975 Difficulty: Match the damage type or repair step at the left with a related enzyme at right Only one answer will be the most direct for each _ cytosine deamination _ base loss _ adenine deamination _ binds to GATC sequences _ binds to mismatch in DNA _ DNA synthesis in gaps _ seals nicks _ O6-methylguanine _ direct chemical reversal of pyrimidine dimer formation _ double-strand break _ excision of a lesioncontaining oligonucleotide (a) hypoxanthine-N-glycosylase (b) AP endonuclease (c) mutH protein (d) DNA polymerase I (e) uracil N-glycosylase (f) mutS-mutL complex (g) ABC excinuclease (h) DNA photolyase (i) O6-methylguanine methyltransferase (j) DNA ligase (k) λ integrase (l) RecA protein (m) restriction endonuclease Ans: e; b; a; c; f; d; j; i; h; m; g 43 DNA repair Pages: 971-972 Difficulty: Explain the role of DNA glycosylases in DNA repair Ans: When spontaneous deamination converts cytosine in DNA to uracil, or adenine to hypoxanthine, DNA glycosylase breaks the N-glycosidic bond to the defective base, creating an “abasic” or “AP” site The region containing the AP site is then excised by AP endonuclease, and the resulting gap is closed by DNA polymerase I and sealed by DNA ligase (See Fig 25-23, p 972.) Other DNA glycosylases recognize other types of modified or damaged bases Chapter 25 DNA Metabolism 299 44 DNA repair Page: 971-973 Difficulty: Briefly explain the difference between base-excision repair and nucleotide-excision repair Ans: Base excision involves removing only the defective base from the DNA by cleavage of the Nglycosidic linkage of the base to deoxyribose This leaves an apurinic or apyrimidinic site, which must then undergo additional repair processes Nucleotide excision involves removing the defective base together with its deoxyribose and phosphate (as well as some neighboring nucleotides) by cleavage of phosphodiester bonds in the DNA chain 45 DNA repair Page: 972-973 Difficulty: Describe the process of nucleotide-excision repair of lesions like pyrimidine dimers in E coli Ans: DNA lesions such as pyrimidine dimers are repaired by the excision of a 12- or 13-nucleotide fragment of the defective strand The ABC excinuclease makes single-strand cuts on both sides of the defect The fragment between the cuts is removed by the UvrD helicase This leaves a gap in the DNA, which is filled in by DNA polymerase I and sealed by DNA ligase (See Fig 25-24, p 973.) 46 DNA repair Page: 975 Difficulty: Why does DNA damage that causes alkylation of nucleotides sometimes lead to transition mutations? Ans: When guanine is alkylated to O6-methylguanine, it can base pair better with thymine than with guanine’s normal partner, cytosine This results in G-C to A-T transition mutations when this erroneous pairing is replicated into the daughter chromosomes (See Fig 25-26, p 975.) 47 DNA Recombination Pages: 980-981 Difficulty: Outline the four key features of the current model for homologous recombination during meiosis in a eukaryotic cell Ans: (1) Homologous chromosomes are aligned (2) A double-strand break is enlarged by an exonuclease, leaving a single-strand extension with a free 3' hydroxyl end (3) The exposed 3' ends invade the homologous intact duplex DNA, followed by branch migration to create a Holliday junction (4) Cleavage of the two crossover products creates the two recombinant products (See Fig 25-31, p 981.) 48 DNA recombination Pages: 986-987 Difficulty: Name the three possible outcomes or consequences (at the DNA level) of a site-specific recombination event For each of these explain concisely (in one sentence) how the relative location and orientation of the recombination sites determines the outcome of the recombination event Do not describe specific examples of site-specific recombination systems Ans: When two sites on a single DNA have the same orientation, a piece of DNA will be deleted by recombination When two sites on a single DNA have opposite orientations, inversion results When two separate DNAs (one or both circular) recombine, an insertion will occur (See Fig 25-39, p 987.) 300 Chapter 25 DNA Metabolism 49 DNA recombination Page: 988 Difficulty: What distinguishes the simple from the complex class of bacterial transposon? Ans: The simple class called insertion sequences contains only the information needed for transposition and the genes for proteins (transposases) that carry out the process Those in the class of complex transposons carry additional genes, such as those for antibiotic resistance, a property they confer upon any host bacterium that harbors them 50 DNA recombination Pages: 988-989 Difficulty: What distinguishes the two mechanistic pathways for transposition in bacteria, and what is a cointegrate? Ans: Direct transposition moves the transposon itself to a new location, leaving behind a doublestrand break in the DNA from whence it came (which must be repaired) The transposing DNA is inserted into a staggered cut at the target site, and replication fills in the remaining gaps Replicative transposition moves a copy of the element to a new site, leaving a copy behind at the old location; the cointegrate intermediate carries two complete copies of the transposon, with the donor region covalently linked to DNA at the target site (See Figs 25-42 and 25-43, p 989.) 51 DNA recombination Pages: 990-991 Difficulty: Briefly describe the role of recombination in the generation of antibody (immunoglobin) diversity Ans: The genes for immunoglobin polypeptide chains are divided into segments, with multiple versions of each segment (which code for slightly different amino acid sequences) Recombination results in the joining of individual versions of each segment to generate a complete gene Antibody diversity results from the very large number of different combinations that are possible (See Fig 2544, p 990.)

Ngày đăng: 04/06/2018, 15:29

TỪ KHÓA LIÊN QUAN

w