1. Trang chủ
  2. » Thể loại khác

kupdf com lehninger principles of biochemistry test bank ch 26pdf

12 421 0

Đang tải... (xem toàn văn)

Tài liệu hạn chế xem trước, để xem đầy đủ mời bạn chọn Tải xuống

THÔNG TIN TÀI LIỆU

Thông tin cơ bản

Định dạng
Số trang 12
Dung lượng 209,01 KB

Nội dung

Chapter 26 RNA Metabolism Multiple Choice Questions DNA-dependent synthesis of RNA Page: 996 Difficulty: Ans: B RNA polymerase: A) B) C) D) binds tightly to a region of DNA thousands of base pairs away from the DNA to be transcribed can synthesize RNA chains de novo (without a primer) has a subunit called λ (lambda), which acts as a proofreading ribonuclease separates DNA strands throughout a long region of DNA (up to thousands of base pairs), then copies one of them E) synthesizes RNA chains in the 3' → 5' direction DNA-dependent synthesis of RNA Pages: 996-998 Difficulty: Ans: A Which of the following statements about E coli RNA polymerase is false? A) Core enzyme selectively binds promoter regions, but cannot initiate synthesis without a sigma factor B) RNA polymerase holoenzyme has several subunits C) RNA produced by this enzyme will be completely complementary to the DNA template D) The enzyme adds nucleotides to the 3' end of the growing RNA chain E) The enzyme cannot synthesize RNA in the absence of DNA DNA-dependent synthesis of RNA Pages: 996-999 Difficulty: Ans: C Which of the following statements about E coli RNA polymerase (core enzyme) is false? A) B) C) D) E) In the absence of the σ subunit, core polymerase has little specificity for where initiation begins The core enzyme contains several different subunits The core enzyme has no polymerizing activity until the σ subunit is bound The RNA chain grows in a 5' → 3' direction The RNA product is complementary to the DNA template DNA-dependent synthesis of RNA Page: 998 Difficulty: Ans: D RNA polymerase from E coli (core enzyme alone) has all of the following properties except that it: A) B) C) D) E) can extend an RNA chain and initiate a new chain is required for the synthesis of mRNA, rRNA, and tRNA in E coli produces an RNA polymer that begins with a 5'-triphosphate recognizes specific start signals in DNA requires all four ribonucleoside triphosphates and a DNA template 302 Chapter 26 RNA Metabolism DNA-dependent synthesis of RNA Page: 998 Difficulty: Ans: B The sigma factor of E coli RNA polymerase: A) B) C) D) E) associates with the promoter before binding core enzyme combines with the core enzyme to confer specific binding to a promoter is inseparable from the core enzyme is required for termination of an RNA chain will catalyze synthesis of RNA from both DNA template strands in the absence of the core enzyme DNA-dependent synthesis of RNA Pages: 999-1001 Difficulty: Ans: B After binding by E coli RNA polymerase, the correct order of events for transcription initiation is: A) B) C) D) E) closed complex formation, open complex formation, promoter clearance, start of RNA synthesis closed complex formation, open complex formation, start of RNA synthesis, promoter clearance open complex formation, closed complex formation, start of RNA synthesis, promoter clearance start of RNA synthesis, closed complex formation, open complex formation, promoter clearance start of RNA synthesis, open complex formation, closed complex formation, promoter clearance DNA-dependent synthesis of RNA Pages: 1000-1001 Difficulty: Ans: B Which one of the following statements about E coli RNA polymerase (core enzyme) is false? A) B) C) D) E) It can start new chains de novo or elongate old ones It has no catalytic activity unless the sigma factor is bound It uses nucleoside 5'-triphosphates as substrates Its activity is blocked by rifampicin Its RNA product will hybridize with the DNA template DNA-dependent synthesis of RNA Page: 1002 Difficulty: Ans: E “Footprinting” or DNase protection is a technique used to identify: A) B) C) D) E) a region of DNA that has been damaged by mutation E coli cells that contain a desired, cloned piece of DNA the position of a particular gene of a chromosome the position of internally double-stranded regions in a single-stranded DNA molecule the specific binding site of a repressor, polymerase, or other protein on the DNA DNA-dependent synthesis of RNA Page: 1003 Difficulty: Ans: B Which one of the following statements about eukaryotic RNA polymerases is correct? A) All three eukaryotic RNA polymerases recognize the same promoters as prokaryotic polymerases B) None of the eukaryotic RNA polymerases recognizes prokaryotic promoters C) Only eukaryotic RNA polymerase I recognizes prokaryotic promoters D) Only eukaryotic RNA polymerase II recognizes prokaryotic promoters E) Only eukaryotic RNA polymerase III recognizes prokaryotic promoters Chapter 26 RNA Metabolism 303 10 DNA-dependent synthesis of RNA Pages: 1003-1005 Difficulty: Ans: B Which of the following is not known to be involved in initiation by eukaryotic RNA polymerase II? A) B) C) D) E) DNA helicase activity DNA polymerase activity Formation of an open complex Protein binding to specific DNA sequences Protein phosphorylation 11 RNA processing Page: 1007 Difficulty: Ans: B Processing of a primary mRNA transcript in a eukaryotic cell does not normally involve: A) B) C) D) E) attachment of a long poly(A) sequence at the 3' end conversion of normal bases to modified bases, such as inosine and pseudouridine excision of intervening sequences (introns) joining of exons methylation of one or more guanine nucleotides at the 5' end 12 RNA processing Page: 1008 Difficulty: Ans: C The 5'-terminal cap structure of eukaryotic mRNAs is a(n): A) B) C) D) E) 7-methylcytosine joined to the mRNA via a 2',3'-cyclic linkage 7-methylguanosine joined to the mRNA via a 5' → 3' diphosphate linkage 7-methylguanosine joined to the mRNA via a 5' → 5' triphosphate linkage N6-methyladenosine joined to the mRNA via a 5' → 5' phosphodiester bond O6-methylguanosine joined to the mRNA via a 5' → 5' triphosphate linkage 13 RNA processing Page: 1009 Difficulty: Ans: B The excision (splicing) of many group I introns requires, in addition to the primary transcript RNA: A) B) C) D) E) a cytosine nucleoside or nucleotide and a protein enzyme a guanine nucleoside or nucleotide (only) a protein enzyme only a small nuclear RNA and a protein enzyme ATP, NAD, and a protein enzyme 14 RNA processing Page: 1009 Difficulty: Ans: E A branched (“lariat”) structure is formed during: A) B) C) D) E) attachment of a 5' cap to mRNA attachment of poly(A) tails to mRNA processing of preribosomal RNA splicing of all classes of introns splicing of group II introns 304 Chapter 26 RNA Metabolism 15 RNA processing Page: 1010 Difficulty: Ans: E Splicing of introns in nuclear mRNA primary transcripts requires: A) B) C) D) E) a guanine nucleoside or nucleotide endoribonucleases polynucleotide phosphorylase RNA polymerase II small nuclear ribonucleoproteins (snurps) 16 RNA processing Page: 1013 Difficulty: Ans: B Which one of the following is not true of the mRNA for ovalbumin? A) B) C) D) E) Exons are used for polypeptide synthesis Introns are complementary to their adjacent exons and will form hybrids with them The mature mRNA is substantially shorter than the corresponding region on the DNA The mRNA is originally synthesized in the nucleus, but ends up in the cytoplasm The splicing that yields a mature mRNA occurs at very specific sites in the RNA primary transcript 17 RNA processing Page: 1014 Difficulty: Ans: E Differential RNA processing may result in: A) B) C) D) E) a shift in the ratio of mRNA produced from two adjacent genes attachment of the poly(A) tail to the 5' end of an mRNA inversion of certain exons in the final mRNA the production of the same protein from two different genes the production of two distinct proteins from a single gene 18 RNA processing Pages: 1015-1016 Difficulty: Ans: A Which of the following statements about the synthesis of rRNA and tRNA in E coli is true? A) B) C) D) E) Both rRNA and some tRNAs are part of the same primary transcript Each rRNA sequence (16S, 23S, 5S) is transcribed into a separate primary transcript Primary tRNA transcripts undergo methylation, but rRNA sequences are not methylated The tRNA sequences all lie at the 3’end of the rRNA transcripts There is a single copy of the rRNA genes 19 RNA processing Pages: 1018-1019 Difficulty: Ans: C Which of the following is not usually essential for the catalytic activity of ribozymes? A) B) C) D) E) Correct base pairing Correct base sequence Correct interaction with protein Correct secondary structure Correct three-dimensional structure Chapter 26 RNA Metabolism 305 20 RNA processing Page: 1019 Difficulty: Ans: D Which one of the following properties of the L-19 IVS ribozyme is not shared with enzymes that are purely protein? A) B) C) D) E) It acts as a true catalyst It can be competitively inhibited It displays Michaelis-Menten kinetics It exploits base-pairing with internal guide sequences It makes use of covalent and metal ion catalysis 21 RNA processing Page: 1020 Difficulty: Ans: E Which one of the following statements about mRNA stability is true? A) B) C) D) E) Degradation always proceeds in the 5' to 3' direction Degradation of mRNA by polynucleotide phosphorylase yields 5'-nucleoside monophosphates In general, bacterial mRNAs have longer half-lives than eukaryotic mRNAs Rates of mRNA degradation ared always at least 10-fold slower than rates of mRNA synthesis Secondary structure in mRNA (hairpins, for example) slows the rate of degradation 22 RNA-dependent synthesis of RNA and DNA Page: 1021 Difficulty: Ans: A The reverse transcriptase of an animal RNA virus catalyzes: A) B) C) D) E) degradation of the RNA strand in a DNA-RNA hybrid insertion of the viral genome into a chromosome of the host (animal) cell RNA formation in the 3' → 5' direction RNA synthesis, but not DNA synthesis synthesis of an antisense RNA transcript 23 RNA-dependent synthesis of RNA and DNA Page: 1022 Difficulty: Ans: D Reverse transcriptase: A) B) C) D) E) can utilize only RNA templates has a 3' → 5' proofreading exonuclease but not a 5' → 3' exonuclease is activated by AZT is encoded by retroviruses synthesizes DNA with the same fidelity as a typical DNA polymerase 24 RNA-dependent synthesis of RNA and DNA Page: 1022 Difficulty: Ans: D Compared with DNA polymerase, reverse transcriptase: A) B) C) D) E) does not require a primer to initiate synthesis introduces no errors into genetic material because it synthesizes RNA, not DNA makes fewer errors in synthesizing a complementary polynucleotide makes more errors because it lacks the 3' → 5' proofreading exonuclease activity synthesizes complementary strands in the opposite directionfrom 3' → 5' 306 Chapter 26 RNA Metabolism 25 RNA-dependent synthesis of RNA and DNA Page: 1024 Difficulty: Ans: C AZT (3'-azido-2',3'-dideoxythymidine), used to treat HIV infection, acts in HIV-infected cells by: A) B) C) D) E) blocking ATP production blocking deoxynucleotide synthesis inhibiting reverse transcriptase inhibiting RNA polymerase II inhibiting RNA processing 26 RNA-dependent synthesis of RNA and DNA Page: 1027 Difficulty: Ans: D Which one of the following statements about the reverse transcriptases of retroviruses and the RNA replicases of other single-stranded RNA viruses, such as R17 and influenza virus, is correct? A) Both enzymes can synthesize either RNA or DNA from an RNA template strand B) Both enzymes can utilize DNA in addition to RNA as a template strand C) Both enzymes carry the specificity for the RNA of their own virus D) Both enzymes have error rates similar to those of cellular RNA polymerases E) Both enzymes require host-encoded subunits for their replication function 27 RNA-dependent synthesis of RNA and DNA Pages: 1030 Difficulty: Ans: C Aptamers are: A) double-stranded RNA products of nuclease action on hairpin RNAs B) repeat sequence elements at the ends of transposons C) small RNA molecules selected for tight binding to specific molecular targets D) the RNA primers required for retroviral replication E) the short tandem repeat units found in telomeres Short Answer Questions 28 DNA-dependent synthesis of RNA Page: 996 Difficulty: Write the sequence of the messenger RNA molecule synthesized from a DNA template strand having the sequence: (5')ATCGTACCGTTA(3') Ans: (3')UAGCAUGGCAAU(5') Also acceptable is (5')UAACGGUACGAU(3') 29 DNA-dependent synthesis of RNA Pages: 996-998 Difficulty: List one basic property that distinguishes RNA polymerases from DNA polymerases, and list one basic property they share Ans: Among the distinguishing characteristics: RNA polymerase does not require a primer, but DNA Chapter 26 RNA Metabolism 307 polymerase does; RNA polymerase lacks the 3' → 5' proofreading exonuclease activity present in DNA polymerase Among the shared properties: both enzymes use nucleoside triphosphates as substrates, require Mg 2+ and Zn2+, produce an antiparallel complement to the template, and synthesize nucleic acids in the direction 5' → 3' 30 DNA-dependent synthesis of RNA Pages: 996-997 Difficulty: Below, an RNA molecule is being transcribed from a strand of DNA Indicate the 5' and 3' ends of the RNA molecule and of the strand of DNA that is complementary to the RNA molecule In which direction is synthesis occurring? Ans: 31 DNA-dependent synthesis of RNA Pages: 998-1006 Difficulty: For each of the following statements, indicate with a P if the statement applies only to prokaryotes, an E if the statement applies only to eukaryotes, and an E & P if the statement applies to both eukaryotes and prokaryotes _ RNA synthesis is blocked by actinomycin D _ A single RNA polymerase transcribes genes that encode mRNAs, tRNAs, and rRNA _ Transcription of mRNA is blocked by α-amanitin _ Sigma (σ) subunit detaches from RNA polymerase shortly after transcription has initiated _ The 5' end of the mature mRNA begins with a triphosphate _ The primary mRNA transcript is inacitve _ Termination of transcription requires the protein ρ factor Ans: E & P; P; E ; P; P; E; P 308 Chapter 26 RNA Metabolism 32 DNA-dependent synthesis of RNA Page: 999 Difficulty: The specific sequences that E coli RNA polymerase usually binds to in E coli DNA before initiating transcription generally contain more A=T base pairs than G≡C base pairs In no more than a few sentences, speculate on why this might be the case Ans: Because A=T base pairs are stabilized by only two hydrogen bonds (compared with three for G≡C pairs), double-stranded regions rich in A=T pairs are easier for RNA polymerase to bind and unwind in preparation for the transcription of one of the DNA strands 33 DNA-dependent synthesis of RNA Pages: 999-1001 Difficulty: Describe the sequence of events in the initiation of transcription by E coli RNA polymerase Ans: The core enzyme plus σ subunit, called holoenzyme, binds to the promoter region forming a closed complex (i.e., in which the DNA double helix is not unwound) This is converted to an open complex by the unwinding of a short region of the promoter Synthesis of the RNA chain begins within the complex The complex then moves along the DNA away from the promoter region and the σ subunit dissociates 34 DNA-dependent synthesis of RNA Pages: 1001, 1003 Difficulty: In a ρ-independent terminator, there is a palindrome rich in G≡C base pairs, followed by 8–10 uridine residues Explain how each of the following changes might affect terminator function: (a) Substitution of cytidines for the 8–10 uridines (b) Mutations in the palindrome that decrease its G≡C content (c) Elimination of half of the palindromic sequence Ans: (a) This substitution would decrease terminator function by stabilizing the RNA-DNA hybrid duplex (b) These mutations would decrease terminator function by destabilizing hairpin formation, and the RNA-DNA hybrid will be stabilized as a result (c) Without half the palindrome, the hairpin will not form, and the RNA-DNA hybrid will not be destabilized enough for the terminator to function 35 DNA-dependent synthesis of RNA Pages: 1001, 1003 Difficulty: Compare and contrast ρ-dependent and ρ-independent termination of transcription in prokaryotes Ans: In both, the transcription complex pauses at specific sequences in the DNA template In ρindependent termination, the formation of hairpin structures causes pausing which leads to dissociation of the product RNA and the polymerase from the template DNA and hence to termination In ρ-dependent termination, the features that cause pausing are unclear, and dissociation requires the presence of the ρ protein 36 DNA-dependent synthesis of RNA Page: 1002 Difficulty: The DNA molecule below is believed to contain a binding site for protein X It is labeled at the 5' end of the top strand (*), then subjected to a footprinting experiment In the idealized gel below, there is a band for every base of the labeled strand On the DNA sequence, point out the binding site for protein X Chapter 26 RNA Metabolism 309 *(5')GGATTCTAATAAAGTAACGCGTTACGACTTGG CCTAAGATTATTTCATTGCGCAATGCTGAACC [ Ans: *(5')GGATTCTAATAAAGT|AACGCGTT|ACGACTTGG CCTAAGATTATTTCA|TTGCGCAA|TGCTGAACC binding site 37 DNA-dependent synthesis of RNA Pages: 1003-1005 Difficulty:3 Describe briefly the process of initiation by eukaryotic RNA polymerase Ans: One transcription factor (TBP) binds specifically to the TATA region of the promoter A second factor (TFIIB) binds to the first factor, and RNA polymerase binds to the TFIIB-TBP complex Additional factors bind to produce the complete closed complex that is converted to the open complex by the action of DNA helicases Phosphorylation of the polymerase results in a conformational change that results in the actual initiation of the RNA chain (See Fig 26-9, p.1004.) 38 DNA-dependent synthesis of RNA Pages: 1003-1006 Difficulty: Indicate whether each of the following statements about eukaryotic cells is true (T) or false (F) _ They have three distinct RNA polymerases _ Their mRNAs are generally synthesized by RNA polymerase I _ RNA polymerase III synthesizes only rRNAs _ The 5S rRNA is synthesized by RNA polymerase I _ Their RNA polymerases initiate transcription at specific promoter sites on the DNA Ans: T; F; F; F; T 39 RNA processing Pages: 1007-1017 Difficulty: Name four general types of postsynthetic processing reactions that are observed in RNA Briefly (one sentence or less) point out an example of each type In your example, identify the type of RNA 310 Chapter 26 RNA Metabolism molecule involved (tRNA, mRNA, rRNA, etc.), the type of “processing” involved, and whether the example is characteristic of eukaryotes or prokaryotes, or both Do not describe specific genes, sequences, complicated structures, or enzymes Ans: Posttranscriptional reactions on mRNA in eukaryotes include: (1) the removal of introns, (2) the addition of a 5' cap, and (3) addition of a poly(A) tail In prokaryotes and eukaryotes, tRNAs have sequences that are (4) trimmed and (5) spliced, (6) bases already incorporated into tRNA are modified (yielding, for example, pseudouridine and inosine), and (7) a 3'-CCA sequence is sometimes added to the tRNA Eukaryotic tRNA is also subject to intron splicing and posttranscriptional modification of some bases In prokaryotes and eukaryotes, preribosomal RNAs are (8) cleaved to form individual rRNAs 40 RNA processing Pages: 1008, 1011 Difficulty: Describe in words (not using structures) the important features of the structures present on the 5' and 3' ends of mature (processed) eukaryotic mRNAs Ans: At the 5' end there is a cap consisting of a guanosine joined to the 5'-terminal nucleotide through a 5' to 5' triphosphate group This guanine nucleotide is methylated on N-7 The next two nucleotides in the chain are also sometimes methylated on their 2'-OH groups At the 3' end is the poly(A) tail consisting of a run of 80–250 adenylate residues 41 RNA processing Pages: 1009-1011 Difficulty: Describe the mechanistic difference that distinguishes the splicing of group I introns from that of group II introns Ans: In the group I introns, the initial break in the RNA chain occurs as the hydroxyl group of a guanine nucleoside or nucleotide makes a nucleophilic attack on the phosphodiester bond In group II introns, the attacking species is the 2'-hydroxyl group of an adenylate residue in the intron itself 42 RNA processing Page: 1013 Difficulty: Describe the function of polyadenylate polymerase and name two properties that distinguish it from normal cellular RNA polymerases Ans: Poly(A) polymerase is required to add the long polyadenylate tail onto the 3' end of eukaryotic mRNAs Although it uses the ribonucleoside triphosphate ATP, releases pyrophosphate, and proceeds in the 5' → 3' direction, as cellular RNA polymerases, unlike them it is not templatedirected and it does require a 3'-hydroxyl end to prime synthesis 43 RNA processing Page: 1016 Difficulty: Beginning with the primary transcript containing a tRNA sequence, describe the steps in the formation of a mature tRNA molecule in E coli Ans: Short sequences at the 5' and 3' ends of the primary transcript are removed by RNase P and D, respectively A specific enzyme adds —CCA at the 3' end Several bases are modified (e.g., forming pseudouridine or methylguanosine) In some cases, an intron is spliced out Chapter 26 RNA Metabolism 311 44 RNA processing Pages: 1016, 1019 Difficulty: In 1989, Sidney Altman won a Nobel Prize for his work on RNase P In no more than three sentences, describe the function of RNase P, as well as the unusual characteristic of this enzyme that made Altman's work so important Ans: RNase P catalyzes the removal of a short piece of RNA at the 5' end of a maturing tRNA The enzyme is a ribozyme—an enzyme in which RNA is the catalytic species (See Fig 26-23, p 1016.) 45 RNA processing Page: 1017 Difficulty: Transfer RNAs have several bases in addition to the normal four found in RNA How are these rare bases incorporated into the tRNA molecule? Ans: The unusual bases in tRNA are made by first incorporating the usual four bases into a tRNA precursor, then enzymatically modifying specific nucleotide residues in the pre-tRNA molecule 46 RNA processing Pages: 1017-1019 Difficulty: Define ribozymes and briefly describe the structure and function of two ribozymes Ans: Ribozymes are enzymes that consist in part or entirely of RNA RNase P, which contains both protein and RNA, cleaves extra nucleotides from the 5' end of tRNA molecules The enzymatic activity is contained entirely in the RNA portion Group I introns are RNA sequences in primary transcripts that catalyze their own excision, without any involvement of catalytic proteins Small RNAs associated with certain RNA viruses of plants also contain self-splicing RNA sequences The enzyme peptidyl transferase (see Chapter 27), which forms peptide bonds during protein synthesis on ribosomes, is a ribozyme in which the essential catalytic component is RNA 47 RNA-dependent synthesis of RNA and DNA Pages: 996, 1022 Difficulty: Compare transcription and reverse transcription in terms of the following characteristics: (a) direction of polynucleotide synthesis (b) nature of template (c) nature of primer (d) incorporated nucleotides Ans: (a) direction of polynucleotide synthesis (b) nature of template (c) nature of primer (d) incorporated nucleotides Reverse Transcription Transcription 5' → 3' RNA or DNA tRNA dNTPs 5' → 3' DNA none NTPs 312 Chapter 26 RNA Metabolism 48 RNA-dependent synthesis of RNA and DNA Page: 1022 Difficulty: Describe all of the known catalytic activities of reverse transcriptase Ans: Reverse transcriptase can (1) synthesize DNA complementary to an RNA template; (2) degrade the RNA strand of the resulting RNA-DNA hybrid; and (3) synthesize DNA complementary to the resulting single-stranded DNA 49 RNA-dependent synthesis of RNA and DNA Pages: 1025-1027 Difficulty: What is a telomere? Describe the key features of its structure What is unusual about the structure and/or mechanism of action of telomerase? Ans: Telomeres are specialized structures at the ends of linear chromosomes They consist of tandem repeats of variable length, usually of the form TxGy in one strand and CyAx in the other The TG strand is often longer, resulting in a region of single-stranded DNA Telomerase is an enzyme that consists of RNA and protein; the RNA portion is an internal template for RNA-dependent DNA synthesis in the telomere TG strand by the protein portion This unusual structure and composition allows telomerase to catalyze replication at the ends of linear chromosomes without the loss of DNA 50 RNA processing Page: 1028 Difficulty: Why did the “RNA World” hypothesis have to await the discovery of ribozymes in order to become a widely attractive scenario? Ans: The existence of ribozymes proved that small RNA molecules could carry out catalytic functions, and have the potential capacity for self-replication Since ribonucleotides can arise from prebiotic chemistry, once they form short polymers the conceptual link to biochemical catalysis, which is essential for life, is complete The finding that the ribosome has catalytic RNA to carry out amino acid polymerization into peptides and proteins (see Chapter 27) strengthens the case for catalytic RNA molecules to have preceded catalytic proteins (i.e enzymes) in evolution 51 RNA-dependent synthesis of RNA and DNA Page: 1030 Difficulty: What is the utility of the SELEX protocol and how does it work? Ans: SELEX is “accelerated evolution in a test tube” that involves searching in pools of random RNA polymers to purify those that can bind tightly to particular substrates As described in Box 263, p 1090, a concentrated pool of RNA carrying randomized RNA sequences up to about 25 nucleotides is passed through an affinity column carrying the desired substrate Those that bind are eluted, amplified by reverse transcriptase, and copied by RNA polymerase to make a new pool that is enriched for molecules that were retained on the column This pool is cycled through the column again for a dozen or more passes, obtaining incremental enrichment on each pass The final set of molecules is cloned to obtain individual aptamers, which are then screened for the desired characteristics In practice, this method has been employed to generate a wide variety of RNA molecules with the ability to bind particular organic molecules or catalyze specific chemical reactions

Ngày đăng: 04/06/2018, 15:28

TỪ KHÓA LIÊN QUAN