DSpace at VNU: Exogenous proline and trehalose promote recovery of rice seedlings from salt-stress and differentially modulate antioxidant enzymes and expression of related genes

Journal of Plant Physiology 169 (2012) 596–604 Contents lists available at SciVerse ScienceDirect Journal of Plant Physiology journal homepage: www.elsevier.de/jplph Exogenous proline and trehalose promote recovery of rice seedlings from salt-stress and differentially modulate antioxidant enzymes and expression of related genes Noppawan Nounjan a , Phan Tuan Nghia b , Piyada Theerakulpisut a,∗ a b Genomics and Proteomics Research Group for Improvement of Salt-tolerant Rice, Department of Biology, Faculty of Science, Khon Kaen University, Khon Kaen 40002, Thailand Key Laboratory of Enzyme and Protein Technology, Faculty of Biology, Hanoi University of Science, Hanoi, Viet Nam a r t i c l e i n f o Article history: Received 17 August 2011 Received in revised form 11 January 2012 Accepted 11 January 2012 Keywords: Antioxidant enzymes Proline Rice Salt stress Trehalose a b s t r a c t Proline (Pro) and Trehalose (Tre) function as compatible solutes and are upregulated in plants under abiotic stress They play an osmoprotective role in physiological responses, enabling the plants to better tolerate the adverse effects of abiotic stress We investigated the effect of exogenous Pro and Tre (10 mM) in seedlings of Thai aromatic rice (cv KDML105; salt-sensitive) during salt stress and subsequent recovery Salt stress (S, NaCl) resulted in growth reduction, increase in the Na+ /K+ ratio, increase in Pro level and up-regulation of Pro synthesis genes (pyrroline-5-carboxylatesynthetase, P5CS; pyrroline-5-carboxylate reductase, P5CR) as well as accumulation of hydrogen peroxide (H2 O2 ), increased activity of antioxidative enzymes (superoxide dismutase, SOD; peroxidase, POX; ascorbate peroxidase, APX; catalase, CAT) and transcript up-regulation of genes encoding antioxidant enzymes (Cu/ZnSOD, MnSOD, CytAPX, CatC) Under salt stress, exogenous Pro (PS; Pro + NaCl) reduced the Na+ /K+ ratio, further increased endogenous Pro and transcript levels of P5CS and P5CR, but decreased the activity of the four antioxidant enzymes The transcription of genes encoding several antioxidant enzymes was upregulated Exogenous Tre (TS; Tre + NaCl) also reduced the Na+ /K+ ratio and strongly decreased endogenous Pro Transcription of P5CS and P5CR was upregulated, the activities of SOD and POX decreased, the activity of APX increased and the transcription of all antioxidant enzyme genes upregulated Although exogenous osmoprotectants did not alleviate growth inhibition during salt stress, they exhibited a pronounced beneficial effect during recovery period showing higher percentage of growth recovery in PS (162.38%) and TS (98.43%) compared with S (3.68%) During recovery, plants treated with PS showed a much greater reduction in endogenous Pro than NaCl-treated (S) or Tre-treated plants (TS) Increase in CAT activity was most related to significant reduction in H2 O2 , particularly in the case of PS-treated plants Advantageous effects of Pro were also associated with increase in APX activity during recovery © 2012 Elsevier GmbH All rights reserved Introduction Abbreviations: APX, ascorbate peroxidase; C, nutrient solution without Pro/Tre and NaCl; CAT, catalase; GB, glycinebetaine; GSA, glutamate semialdehyde; H2 O2 , hydrogen peroxide; KDML105, Oryza sativa cv Khao Dawk Mali 105; P, 10 mM Pro; P5C, pyrroline-5-carboxylate; P5CDH, pyrroline-5-carboxylate dehydrogenase; P5CR, pyrroline-5-carboxylate reductase; P5CS, pyrroline-5-carboxylatesynthetase; PDH, proline dehydrogenase; POX, peroxidase; Pro, proline; PS, 10 mM Pro plus 100 mM NaCl; S, 100 mM NaCl; sqRT-PCR, semi-quantitative reverse transcriptasepolymerase chain reaction; SOD, superoxide dismutase; T, 10 mM Tre; T6P, Tre-6-phosphate; TPP, Tre-6-phosphate phosphatase; TPS, Tre-6-phosphate synthase; Tre, trehalose; TS, 10 mM Tre plus 100 mM NaCl ∗ Corresponding author Tel.: +66 43 342908; fax: +66 43 364169; mobile: +66 89 6231777 E-mail addresses: 5150200091@stdmail.kku.ac.th (N Nounjan), phantn@fpt.vn (P.T Nghia), piythe@kku.ac.th (P Theerakulpisut) 0176-1617/$ – see front matter © 2012 Elsevier GmbH All rights reserved doi:10.1016/j.jplph.2012.01.004 Soil salinity is one of the most important abiotic stress problems which inhibit growth and reduces productivity of crops including rice, tomato, chili and potato especially in drier parts of many countries around the globe In Thailand, 62% (6.08 × 106 tons/ha) of rice-growing areas are located in the Northeastern part of the country, but due to water shortage and soil salinity problems arising from the presence of underground salt domes, rice productivity from this area has been relatively low In the year 2010, rice productivity from the Northeast was × 103 tons/ha compared to 3.3 × 103 tons/ha from the central plain which hardly experiences water shortage and has no saline soils (Thai Rice Exporters Association, 2011; http://www.thairiceexporters.or.th/production.htm) Salt stress arises from the combination of osmotic and ion toxicity effect (primary effect), and oxidative stress (secondary effect) N Nounjan et al / Journal of Plant Physiology 169 (2012) 596–604 Salts in the soil water inhibit plant growth primarily by reducing the ability of the plant to take up water thus leading to slower growth Secondarily, a buildup of toxic level of Na+ and Cl− and inhibition of K+ uptake severely inhibits several enzymes requiring K+ as cofactors leading to a whole range of metabolic impairment (Munns et al., 2006) Under salinity stress, an increase in the biosynthesis of compatible solutes such as Pro (Pro), ectoine, glycine betaine, sorbitol and Tre (Tre) protects cells against hyperosmotic stress The high concentration of compatible solutes is able to balance the concentration of salts outside the cell on one side, and on the other, to counteract the high concentrations of Na+ and Cl− in the vacuole (Türkan and Demiral, 2009) Under salinity and other abiotic stresses plants can generate reactive oxygen species (ROS) such as superoxide anion (O2 •− ), singlet oxygen (1 O2 ) and hydrogen peroxide (H2 O2 ) These ROS are strongly reactive because they can interact with essential macromolecules and metabolites causing cellular damage In order to protect cells and tissue from oxidative damage plants must produce non-enzymatic antioxidants such as glutathione and ascorbate as well as antioxidant enzymes including peroxidase (POX; EC1.11.1.7), superoxide dismutase (SOD; EC1.15.1.1), ascorbate peroxidase (APX; EC1.11.1.1) and catalase (CAT; EC1.11.1.6) to defend against oxidative stress (Ashraf, 2009) Pro is the most common osmolyte accumulating in plants in response to various stress conditions It offers a wide range of protective roles including osmotic adjustment, stabilizer for cellular structure and reduction of damage to the photosynthetic apparatus The level of Pro accumulation in plants varies from species to species The importance of Pro in enhancing plant stress tolerance has recently been substantiated through a transgenic approach Transgenic rice expressing the P5CS gene from mothbean showed an enhanced accumulation of P5CS mRNA level, Pro content and higher tolerance to drought and salt stress (Su and Wu, 2004) Tre is a non-reducing disaccharide found in many organisms It is an essential component of the mechanisms that coordinate metabolism with plant growth adaptation and development (Paul, 2007) Tre accumulation influences the alteration of sugar metabolism leading to an osmoprotectant effect under stress (Djilianov et al., 2005) In transgenic rice which received the otsA and otsB genes (TPS and TPP in higher plant) from Escherichia coli, Tre accumulated 3–10 fold higher when compared to the wild type and overproduction of Tre increased tolerance to abiotic stresses (Garg et al., 2002) Ge et al (2008) demonstrated that OsTPP1 overexpression in rice enhanced tolerance to salt and cold stress Exogenous osmoprotectants have been reported to have osmoprotective roles in abiotic stress response and have been suggested as an alternative approach to improve crop productivity under saline conditions (Nakayama et al., 2005) Exogenous application of Pro has been reported to offer beneficial effects to plants under stress conditions (Ashraf and Foolad, 2007) For example, in tobacco under salt stress, adding exogenous Pro to cell suspension culture alleviated the effect of salt stress and increased the activities of antioxidant enzymes (Hoque et al., 2007) Moreover, exogenous Pro decreased protein carbonylation and enhanced antioxidant defense and methylglyoxal detoxification systems (Hoque et al., 2008) Pretreatment of maize with 10 mM Tre relieved the damaging effects of salinity stress on the metabolic pathways such as Hill-reaction activity, photosynthetic pigments and nucleic acids content (Zeid, 2009) Tre pretreatment of winter wheat protected thylakoid membranes from heat damage, maintained cell membrane integrity and reduced ROS accumulation from heat stress (Luo et al., 2010) Thai aromatic rice (cv KDML105) is a well-known economically important Thai cultivar highly recognized in the international market (known as Thai Hom Mali Rice) as the world’s best quality aromatic rice However, KDML105 is sensitive to salt stress, especially during the seedling stage, giving low yield and poor grain 597 milling quality when it is grown under saline soils (Gregorio et al., 1997; Summart et al., 2010) The aim of this work was to test the effects of exogenous Pro and Tre on physiological responses in seedlings of KDML105 during salt stress and recovery period Few reports have addressed the effects of these osmoprotectants on modification of physiological responses during salt stress in rice This work provides additional information on the roles of exogenously applied osmoprotectants in modifying responses of rice during salinity stress as well as during the recovery period Materials and methods Plant materials and treatments Seeds of rice (Oryza sativa L cv KDML105) were germinated in distilled water for d at room temperature (RT), and then transferred to plastic chambers containing Yoshida solution (Yoshida et al., 1976) under natural sunlight in a greenhouse for 28 d during which the solutions were renewed every d The plants were then divided into six treatment groups by addition of the following solutions into Yoshida solution for d as follows: Yoshida solution without Pro/Tre and NaCl (C), 100 mM NaCl (S), 10 mM Pro (P), 10 mM Pro plus 100 mM NaCl (PS), 10 mM Tre (T) and 10 mM Tre plus 100 mM NaCl (TS) The use of 10 mM Pro and Tre was based on the previous report of Garcia et al (1997) and a preliminary experiment in our laboratory (unpublished data, 2006) The experiment was set up according to a completely randomized design with replications After d treatment the plants were then allowed to recover for d by replacing the treatment solutions with Yoshida solution Rice plants were harvested twice; the first, after the d stressed period and the second, after the d recovery period Plants were analyzed for fresh and dry weights, Na+ /K+ ion concentration, Pro accumulation, H2 O2 content, total protein, activity of antioxidant enzymes (POX, SOD, APX and CAT) and gene expression (genes encoding Pro synthesis and antioxidant enzymes) Growth parameters and ion concentration Plant fresh weight was determined and then the plants were dried in a hot-air oven at 70 ◦ C for 4–5 d until the dry weight was stabilized The dried plant materials were ground to fine powder Dried samples (0.1 g) were subjected to chemical analyses by digesting in 10 mL of nitric acid at 300 ◦ C, mL perchloric acid at 200 ◦ C and 20 mL of M hydrochloric acid The concentration of Na and K ions were analyzed using an Atomic Absorption Spectrometer (Model GBC 932 AAA, England) Determination of Pro and H2 O2 content The method described by Bates et al (1973) was applied to quantify Pro content Briefly, leaf samples (0.1 g) were homogenized in mL of 3% sulfosalicylic acid then filtered Two mL of filtrate was mixed with mL of ninhydrin reagent (1.25 g ninhydrin in 30 mL glacial acetic acid and 20 mL M phosphoric acid) and mL of glacial acetic acid The reaction mixture was heated at 100 ◦ C for h and then placed on ice for 20 before being extracted with mL of toluene The absorbance of the red chromophore in the toluene fraction was measured at 520 nm and the amount of proline was determined by comparison with a standard curve For measurement of H2 O2 , leaf tissues (0.1 g) were homogenized with mL of 0.1% (w/v) trichloroacetic acid (TCA) and centrifuged at 12,000 × g for 15 The supernatant (0.5 mL) was added to 0.5 mL of 10 mM potassium phosphate buffer (pH 7.0) and mL of M potassium iodide The absorbance of H2 O2 was determined using a 598 N Nounjan et al / Journal of Plant Physiology 169 (2012) 596–604 spectrophotometer at 390 nm, the amount of H2 O2 was calculated from a standard curve (Velikova et al., 2000) Determination of total protein and antioxidant enzyme activities Leaf samples (0.5 g) were homogenized in a 10 mM potassium phosphate buffer (pH 7.0) containing 4% polyvinyl pyrrolidone (PVP), the homogenates were centrifuged at 12,000 × g at ◦ C for 15 min, and the supernatants were immediately used for determination of enzyme activity Total protein was determined by the Bradford method (Bradford, 1976) A 20 ␮L aliquot of the supernatant was mixed with 980 ␮L of Bradford reagent (BioRad) and the absorbance was read at 595 nm Protein concentration was quantified by comparison with a standard curve using bovine serum albumin For SOD, the activity was assayed by its ability to inhibit photochemical reduction of nitroblue tetrazolium chloride (NBT) at 560 nm The reaction mixture (3 mL) contained 50 mM potassium phosphate buffer (pH 7.8), 13 mM methionine, 75 ␮M NBT, 0.1 mM EDTA and 0.05 mL of enzyme extract The reaction started when adding ␮M riboflavin, the mixture was incubated under fluorescent lamps for 10 then kept in the dark to stop the reaction The absorbance of the mixture was measured at 560 nm The reaction mixture with no enzyme developed maximum color due to maximum rate of reduction of NBT One unit of SOD was determined as the amount of enzyme that inhibits 50% NBT photoreduction The activity was expressed as unit min−1 mg−1 protein (Beuchamp and Fridovich, 1971; Dhindsa et al., 1981) For the POX assay, the reaction mixture (3 mL) contained 10 mM potassium phosphate buffer (pH 7.0), 0.2% of guaiacol and 0.04 mL of enzymes extract The reaction was then added with mM of H2 O2 and incubated at RT for min, the absorbance was then measured at 470 nm The activity of POX was calculated from the rate of formation of guaiacol dehydrogenation product (GDHP) using the extinction coefficient of 26.6 mM−1 cm−1 , and the activity was expressed as ␮mol GDHP min−1 mg−1 protein (Velikova et al., 2000) The activity of APX was determined using a reaction mixture (3 mL) containing 0.5 mM ascorbic acid, 0.1 mM EDTA and 0.1 mL of enzyme extract The reaction started when adding H2 O2 to a final concentration of 1.5 mM The absorbance of the mixture was measured at 290 nm The APX activity was calculated using the extinction coefficient of 2.8 mM−1 cm−1 and the activity was expressed as ␮mol ascorbate oxidized min−1 mg−1 protein (Nakano and Asada, 1980) The activity of CAT was assayed in a mL reaction mixture containing 10 mM potassium phosphate buffer (pH 7.0), 0.1 mL of enzyme extract and 0.035% of H2 O2 The activity of CAT was calculated based on the rate of disappearance of H2 O2 which was followed as a decline in the absorbance at 240 nm measured at and after the addition of H2 O2 The activity was calculated using the extinction coefficient of 40 mM−1 cm−1 , and expressed as H2 O2 reduced min−1 mg−1 protein (Velikova et al., 2000) Gene expression analysis Total RNA of rice leaf tissues (0.03 g) was extracted using an RNA isolation kit (SV Total RNA isolation system, Promega) Contaminated DNA was removed by DNaseI treatment (RQ1 RNase-Free DNase, Promega) Total RNA was quantified by UV–vis spectrophotometer (NanoDrop, Thermo Fisher Scientific) Gene expression was analyzed using semiquantitative reverse transcriptase-polymerase chain reaction (sqRT-PCR) First-strand cDNA was synthesized from 0.72 ␮g total RNA by RevertAidTM First Strand cDNA Synthesis Kit (Fermentas) using 0.5 ␮g/␮L oligo (dT)18 primer at 42 ◦ C for 60 The second step amplification reactions for expression analysis of P5CS, Cu/ZnSOD, MnSOD, CytAPX, CatC and actin were performed using published primer sequences (Kim et al., 2003, 2007) Primers for analysis of P5CR expression was designed based on O sativa Japonica Group mRNA under accession number NM 001051928, using GeneFisher software (http://bibiserv.techfak.uni-bielefeld.de) The forward and reverse primer sequences were –3 TTCAGCTGTTGGACAAGCAGCA and –3 GGTTCCTGCCGGGGAAGTGA, respectively, which amplified a PCR product of 317 bp The total reaction of PCR was 25 ␮L (iTaqTM DNA polymerase kit), containing 0.2 ␮L of cDNA template for each sample The cycling steps included a pre-denaturation for at 94 ◦ C, 30–35 cycles for amplification (denaturation for 40 s at 94 ◦ C, annealing for 45 s at 60–62 ◦ C, extension for 30 s at 72 ◦ C) and a final extension for at 72 ◦ C The PCR products were separated on a 1.5% (w/v) agarose gel then stained with SYBR® Gold (Invitrogen) and observed on a UV transilluminator The relative quantification of mRNA level was calculated by using PhotoCaptMW software, version 10 (Vilber Lourmat) Statistical analysis All results were presented as means ± SD The significance of differences between the mean values was determined by ANOVA The P value smaller or equal to 0.05 was considered as statistically significant Results Growth parameters and ion concentration After the plants were treated for d, mean fresh weight for salt stressed (S, PS and TS), compatible solute treatments (P and T) and control plants (C) were determined No significant differences between C and P, S and T, PS and TS were observed (Fig 1A) However, plant fresh weights of both S and T treatments were significantly higher than those under salt stressed supplied with Pro (PS) and Tre (TS) After d recovery from stress, fresh weights of all treatment groups were significantly increased: 83.39% in C, 46.22% in P, 93.05% in T, 162.38% in PS and 98.44% in TS, except S which showed a slight increase of 3.68% Fresh weight after recovery of the C, P and PS groups were highest followed by T, TS and S, respectively A similar trend was observed for plant dry weight (Fig 1B), the supplement of Pro and Tre did not improve plant dry weight under stress After d recovery from stress, means of plant dry weight were increased up to 81.05%, 78.35% and 40.78% for non salt-stressed groups (C, P and T) In plants which experienced salt treatments, dry weights were increased 25.33%, 78.31% and 53.16% in S, PS and TS, respectively Six days after the treatment with osmoprotectants, Na+ /K+ ratios in C, P and T were much lower than those in salt stressed plants (S, PS and TS) as shown in Fig Pro caused a small reduction, whereas Tre led to significant increase in Na+ /K+ ratios when compared with the control In salt-stressed groups, supplementation with Pro (PS) and Tre (TS) led to a reduction in Na+ /K+ ratio compared with the ones treated with only NaCl (S), but the effect was more pronounced with Pro Five days after recovery from stress, Na+ /K+ ratios in S, PS and TS decreased, although not significantly different, from the values on day after stress Pro accumulation and gene expression of P5CS and P5CR during salt-stress and after recovery As shown in Fig 3A, after the plants received the treatments for d, Pro content in all treatment groups were significantly different Generally, plants under salt stress accumulated a high Pro level Plants treated with both Pro plus NaCl (PS) showed the highest Pro content, more than those treated with NaCl (S) and Tre plus NaCl N Nounjan et al / Journal of Plant Physiology 169 (2012) 596–604 599 Fig The effect of NaCl (S), Pro (P), Tre (T), NaCl and Pro (PS) and NaCl and Tre (TS) on fresh (A) and dry (B) weight of rice after d salt-stress treatment (dark bars) and after d recovery (light bars) C, control The values showed means ± SD Different small letters for the dark shaded bars and capital letters for the light shaded bars indicated that the means are significantly different (P ≤ 0.05) The asterisk (*) indicates the significant difference (P ≤ 0.05) in the mean values between d after salt stress and d after recovery (TS) The amount of Pro in PS was 2.0 fold that of S and 4.2 fold that of TS In the groups without NaCl (C, P and T), the application of Pro (P) dramatically enhanced Pro accumulation in plants (7.9 fold compared with the control and 11.4 fold compared with plants supplied with Tre) The expression levels of P5CS and P5CR genes (Fig 3B) in response to all treatments (except P for P5CR) followed similar patterns of change in Pro accumulation (Fig 3A) After recovery from salt stress, Pro accumulation was markedly decreased, except in the plants treated with TS The reduction was very marked with exogenous Pro treatments i.e 12.29 and 11.08 fold in P and PS compared to 1.69 and 2.43 in C and S In contrast, exogenous Tre did not affect Pro content in T and caused a slight increase in TS (1.17 fold increase) The transcript levels of P5CS in S, P, PS and T decreased in accordance with the reduction in Pro content The level of P5CS expression in TS, however, was not consistent with the change in Pro content In contrast to P5CS, the expression level of P5CR for S, P and PS increased which did not coincide with the reduction in Pro Antioxidative defense and expression of genes encoding antioxidant enzymes during salt-stress and after recovery The effects of salt stress and exogenous Pro and Tre on the activity of antioxidant enzymes during salt-stress and after recovery Fig The effect of NaCl (S), Pro (P), Tre (T), NaCl and Pro (PS) and NaCl and Tre (TS) on ratio between Na+ and K+ in rice leaves after d salt-stress treatment (dark bars) and after d recovery (light bars) C, control The values showed means ± SD Different small letters for the dark shaded bars and capital letters for the light shaded bars indicated that the means are significantly different (P ≤ 0.05) The asterisk (*) indicates the significant difference (P ≤ 0.05) in the mean values between d after salt stress and d after recovery Fig The effect of NaCl (S), Pro (P), Tre (T), NaCl and Pro (PS) and NaCl and Tre (TS) on Pro content and expression of Pro synthesis genes (A) Free Pro content in rice leaves after d of salt treatment (dark bars) and after d of recovery (light bars) The values showed means ± SD Different small letters for the dark bars and capital letters for the light bars indicated that the means are significantly different (P ≤ 0.05) The asterisk (*) indicates the significant difference (P ≤ 0.05) in the mean values between d after salt stress and d after recovery (B) and (C) Expression, using sqRT-PCR, of P5CS and P5CR, in rice leaves on day after salt stress and day after recovery The product of RT-PCR of rice actin gene was used as a loading control The histogram shows relative abundance of cDNA from P5CS or P5CR after normalization with the actin signal The experiment was repeated at least three times 600 N Nounjan et al / Journal of Plant Physiology 169 (2012) 596–604 Fig The effect of NaCl (S), Pro (P), Tre (T), NaCl and Pro (PS) and NaCl and Tre (TS) on (A) H2 O2 content, (B) POX activity, (C) SOD activity, (D) APX activity and (E) CAT activity in rice leaves after d salt-stress treatment (dark bars) and after d recovery (light bars) C, control The values showed means ± SD Different small letters for the dark bars and capital letters for the light bars indicated that the means are significantly different (P ≤ 0.05) The asterisk (*) indicates the significant difference (P ≤ 0.05) in the mean values between d after salt stress and d after recovery are shown in Fig Under salt stress, the production of H2 O2 was significantly increased The H2 O2 content in rice plants supplied with exogenous Pro (PS) and Tre (TS) were and 1.5 fold that of stressed plants without osmoprotectants (S) Among groups without NaCl (C, P and T), the plants supplied with Tre alone (T) produced the highest H2 O2 content During recovery period, H2 O2 content decreased in plants previously treated with NaCl (37.39% in S, 34.94% in PS and 21.14% in TS) For C and P, the H2 O2 content remained the same Conversely, significant reduction of H2 O2 content was observed in T The SOD and POX activities showed similar patterns of response after the d salt stress period Under salt stress conditions (S, PS and TS), SOD and POX activities were markedly enhanced when compared to groups with only exogenous osmoprotectants (P and T) The highest SOD and POX activities were observed in plants exposed to NaCl (S) In non-NaCl groups, the plants added with Pro alone (P) expressed the lowest SOD activity The lowest POX activity was observed in rice treated with either exogenous Pro (P) or Tre (T) During the recovery period, activities of these enzymes significantly decreased in almost all treatments, but in the case of plants previously supplied with Pro (P), the SOD and POX activities significantly increased The activities of APX and CAT presented similar general patterns of responses to salt and osmoprotectants Under the salt stress treatment, KDML105 plants externally supplied with Tre (TS) had the highest APX activity [1.8 fold compared to plants receiving NaCl only (S) and 2.6 fold compared with plants supplied with Pro (PS) respectively] In response to salt stress, CAT activity was significantly increased in plants supplied with NaCl only (S) and NaCl plus Tre (TS), while the activity in PS plants was the lowest For plants receiving osmoprotectants without NaCl; Pro (P) had no effect on APX activity compared to the control (C), whereas Tre (T) significantly suppressed the activity of this enzyme Exogenous Pro (P) or Tre (T) had no effect on CAT activity After the plants were allowed to recover from salt stress for d, the activities of APX and CAT increased in all treatments (except for the case of APX activity in S) Plants previously supplied with Pro under salt stress (PS) showed extremely high APX and CAT activities APX activity in PS increased fold compared to S and 1.4 fold compared to TS Likewise, CAT activity in PS increased 1.8 fold compared to S and 1.9 fold compared to TS N Nounjan et al / Journal of Plant Physiology 169 (2012) 596–604 601 Fig Expression of genes encoding antioxidative enzymes (Cu/ZnSOD, MnSOD, CytAPX and CatC) monitored in rice leaves after d of salt treatment (A) and after d of recovery (B) The product of RT-PCR of rice actin gene was used as loading control The histogram shows relative abundance of cDNA from each gene after normalization with the actin signal The experiment was repeated at least three times The expression patterns of genes encoding enzymes Cu/ZnSOD, MnSOD, CytAPX and CatC are shown in Fig At d after stress, the expression of Cu/ZnSOD, MnSOD, CytAPX and CatC in all treatments with the presence of salts (S, PS and TS) were markedly enhanced compared to the control For plants treated with Pro without saltstress (P), the expression of all genes was suppressed Tre supplement, on the other hand, resulted in gene up-regulation, especially Cu/ZnSOD, in both unstressed (T) and salt-stressed (TS) conditions After the plants were allowed to recover for d, plants previously stressed with salt (S) showed a slight repression in the expression of Cu/ZnSOD and CytAPX, but small up-regulation of MnSOD and CatC The expression of these genes in non-stressed plants previously supplied with Pro (P) was as low as during stress The expression level of all genes in the PS group was highly similar to that of S For plants previously treated with Tre without (T) and with salt (TS), the expression of all genes was considerably reduced Discussion Effects of exogenous Pro and Tre on fresh and dry weights, and Na+ /K+ ratio Sodium chloride in the nutrient solution inhibited growth resulting in the reduction in fresh and dry weights of KDML105 seedlings Adding Pro and Tre into saline nutrient solution did not present any beneficial effects on growth Yamada et al (2005) reported that exogenous Pro (0, 5, 10 and 50 mM) strongly inhibited growth and accelerated leaf senescence of Arabidopsis and petunia The toxicity of Pro was found to be mediated by P5C accumulation in the Pro degradation pathway (Hellmann et al., 2000) Our results correspond with these findings Plant growth in the solution with combined NaCl and Pro (PS) was suppressed presumably not only by NaCl stress but also by Pro The effect of Tre on growth inhibition was found in KDML105 plants fed with Tre alone (T) Seedlings of Arabidopsis cultured in MS medium supplemented with 100 mM Tre failed to develop primary leaves and primary roots (Aghdasi et al., 2010) Schluepmann et al (2004) summarized that exogenously supplied Tre resulted in T6P accumulation which is a growth inhibitor Although exogenous Pro and Tre did not clearly show protective roles during the saltstress period, they obviously furnished the plants with enhanced ability to recover as compared with stressed plants without the osmoprotectants Among the most common effects of salinity is growth inhibition by accumulation of Na+ and reduction in K+ uptake and the ratio of Na+ to K+ showed an inverse relationship with growth (Gregorio and Senadhira, 1993) Exogenous Pro showed higher ability than Tre in alleviating the inhibitory effect of salt by reducing Na+ uptake 602 N Nounjan et al / Journal of Plant Physiology 169 (2012) 596–604 resulting in lower values of Na+ /K+ (Fig 2) Similar effects were observed by Sobahan et al (2009) that exogenous Pro and GB suppressed Na+ uptake and accumulation while K+ content was not affected resulting in lower Na+ /K+ ratio in rice plants In addition, the mitigating effects of exogenous Pro and GB on Na+ /K+ ratio were observed in salt-sensitive fresh market tomato (Heuer, 2003) Effects of exogenous Pro and Tre on Pro accumulation and expression P5CS and P5CR genes The effects Pro and Tre on Pro accumulation and expression of genes in the Pro synthesis pathway (P5CS and P5CR) by sqRTPCR were investigated after d salt stress and d recovery Plants treated with NaCl (S) accumulated 5.53 fold higher Pro than the control Lutts et al (1999) demonstrated that the salt-sensitive rice accumulated higher levels of Na+ and Pro than the salt-resistant rice and concluded that accumulation of Pro is related to saltstress injury These findings are consistent with Vaidyanathan et al (2003) and Theerakulpisut et al (2005) that salt-sensitive rice cultivars showed higher growth inhibition and accumulated greater amounts of Pro than the tolerant ones and concluded that high Pro levels in sensitive cultivars did not afford much protection The results from the present study indicated that over-accumulation of Pro in rice seedlings did not offer plant protection but was one of the consequences of metabolic perturbation triggered by salt stress Elevated amounts of Pro in plants treated with exogenous Pro alone (P) and NaCl plus exogenous Pro (PS) compared with the S treatment can probably be attributed to passive Pro uptake as suggested by Heuer (2003) in hydroponically grown tomato plants treated with and 10 mM Pro Similar results were also observed by Huang et al (2009) when salt-sensitive cucumber plants were sprayed with 25 mM Pro Conversely, supplements with Tre negatively affected Pro amounts in both unstressed and salt-stressed conditions resulting in a significant reduction in Pro Exogenous Tre also reduced Pro accumulation in two maize cultivars under drought stress while increasing biomass production, improving plant water relations and some key photosynthetic attributes (Ali and Ashraf, 2011) Considering profound mitigating effects of exogenous Tre on rice (Garcia et al., 1997) and protective roles of enhanced production of Tre in transgenic rice (Ge et al., 2008), it may be presumed in this case that osmoprotective effects of Tre reduced the need for plants to accumulate Pro Transcription levels of both Pro-synthesizing genes, P5CS and P5CR, were strongly induced under salt stress (S) coinciding with several fold increase in Pro (Fig 3B) Several authors determined that the expression of the P5CS gene is related to Pro accumulation under salt stress in rice (Hien et al., 2003; Kim et al., 2007) Although P5CR does not catalyze a rate limiting step, P5CR gene expression is up-regulated under salt stress in some plant species such as soybean (Delauney and Verma, 1990) and Arabidopsis (Verbruggen et al., 1993), while the data regarding expression of P5CR in rice are scanty Pro application to plants without salt stress (P) showed considerably higher content of Pro but P5CS transcripts were only slightly induced, and that of P5CR was clearly suppressed Exogenous Pro in the absence of NaCl did not have negative effects on growth and Na+ /K+ ratio, and a slight effect on H2 O2 accumulation On the other hand, a combination of Pro and salt (PS) exacerbated the effect of salt leading to excessive Pro accumulation (Fig 3A) in association with enhanced expression of P5CS and P5CR, plant weight reduction (Fig 1) and H2 O2 over-accumulation (Fig 4A) compared to plants stressed with NaCl alone (S) Despite the essential functions of Pro in primary metabolism and stress response, excessive amounts of Pro caused the P5C to increase to a toxic level and also elevated the flow of electrons through the mitochondrial electron transport chain leading to concomitant generation of ROS (Miller et al., 2009) After recovery from salt stress, marked decrease in Pro accumulation was observed in all treatments except TS This decline in Pro was also found in cotton (Parida et al., 2008) and was associated with a down-regulation in the transcription level of P5CS This result was similar to that of Peng et al (1996) who found that AtP5CS transcript levels in Arabidopsis declined during the recovery from salinity stress On the other hand, the expression level of P5CR was up regulated in almost all treatments However, up-regulation of P5CR was not related to Pro accumulation The results regarding P5CR expression, were in line with those of Trovato et al (2008) that decline in Pro after salt stress recovery was not related to P5CR expression but instead closely associated with up-regulation of PDH (Miller et al., 2005) Effect of exogenous Pro and Tre on H2 O2 , antioxidant enzymes activity and expression of related genes Increase in H2 O2 content in response to salt stress in rice was previously reported (Lin and Kao, 2001; Vaidyanathan et al., 2003) SOD activity considerably increased under salt stress to convert O2 •− to H2 O2 which is consequently detoxified by POX, APX and CAT Despite the considerable increase in activity of the four antioxidative enzymes (SOD, POX, APX and CAT), H2 O2 content was significantly higher in S compared to C (Fig 4) Although a regulated amount of increased ROS in response to abiotic stress plays an essential role in adjusting the cellular redox state and regulatory gene expression associated with stress responses to optimize defense and survival, excessive ROS due to imbalance between the detoxification process and ROS generation ultimately leads to cellular damage and growth inhibition (Shao et al., 2008) Exogenous Pro plus NaCl (PS) led to lower activity of SOD, POX, APX and CAT in plants compared to S corresponding to a dramatic rise in H2 O2 in PS The suppression of antioxidative enzyme activity under stress conditions by an external supply of Pro was also found for SOD in Salvia officinalis under UV-B stress (Radyukina et al., 2011) and for SOD and CAT in grapevine under oxidative stress (Ozden et al., 2009) In cucumber under salt stress supplemented with exogenous Pro, there was a decline in SOD activity but an increase in POX (Huang et al., 2009) Adding Tre to plants without salt stress (T) significantly reduced the activity of POX and APX, relating to much higher level of H2 O2 compared to C Exposure of Tre combined with NaCl (TS) did not affect CAT activity, markedly reduced the activities of SOD and POX but enhanced that of APX However, increased activity of APX alone was not enough to efficiently remove H2 O2 resulting in a significantly higher level of H2 O2 in TS than S In contrast, Ali and Ashraf (2011) found that foliar application of Tre significantly increased POX and CAT Salt stress induces expression of Cu/ZnSOD and MnSOD to similar extents This is in agreement with Kaminaka et al (1999) who presented that MnSOD and Cu/ZnSOD genes were strongly enhanced by drought and salinity Yu-zhuo et al (2008) illustrated that Cu/ZnSOD is a first cellular defense enzyme to scavenge O2 •− and accounted for most of the total SOD activity In wheat, Sairam et al (2005) showed that the activities of Cu/ZnSOD and MnSOD were strongly enhanced and responsible for salt tolerance The activity of FeSOD, on the other hand, was extremely low, insensitive to salt stress and did not contribute to the scavenging of salinity induced ROS It was found that the expression of a FeSOD gene encoding chloroplast-specific SOD isoform from KDML105 in salt stress treatment was very low (data not shown) Exogenous Pro or Tre combined with NaCl also up-regulated the expression of Cu/ZnSOD and MnSOD but in the absence of NaCl exogenous Pro strongly suppressed whereas Tre enhanced the expression of Cu/ZnSOD and MnSOD N Nounjan et al / Journal of Plant Physiology 169 (2012) 596–604 The increase in CytAPX transcription and APX activity of KDML105 in response to salt stress corresponded with that found by Hong et al (2007) for the OsAPX8 gene in rice in response to NaCl The activity of CAT in the KDML105 leaf increased corresponding to an elevation of transcript level of CatC; the leaf-specific isoform, as earlier detected in rice by Kim et al (2007) Similar to the effects on expression of Cu/ZnSOD and MnSOD described, external supply of Pro or Tre under salt stress also up-regulated the expression of CytAPX and CatC but in the absence of NaCl exogenous Pro suppressed whereas Tre enhanced the expression of CytAPX and CatC Notably, d after recovery from stress, the decline in H2 O2 in all treatment groups, except P, was related directly to significant increase in CAT activity However, SOD and POX activity in all treatment groups decreased appreciably, except in the case of plants previously treated with Pro without NaCl (P) Pattern of changes in APX activity was similar to that of CAT activity (except for S) This suggested that the reduction of H2 O2 after the stress depended largely on the increased CAT and APX activities This agreed with the findings by Lee et al (2001) that CAT activity increased corresponding to the reduction in H2 O2 whereas SOD, POX and APX activities decreased during recovery from salt stress in rice Interestingly, plants which previously experienced both Pro and NaCl (PS), showed extremely high activity of APX and CAT After the plants were relieved from stress, the transcript levels of Cu/ZnSOD, MnSOD, CytAPX and CatC in all treatment groups were generally down-regulated or remained stable compared with the control Plants previously treated with Pro without NaCl (P) still showed a low level of gene expression On the contrary, while plants receiving Tre treatment alone (T) showed a strong up-regulation of gene expression during stress, they displayed a notable decline in transcript levels of all genes after recovery In this study, the changes in transcript levels of genes encoding antioxidant enzymes in most cases did not coincide with the increase/decrease in activities of the corresponding enzymes Similarly, Hernández et al (2000) showed that long-term salt stress induced transcript levels of antioxidant enzymes genes, but this induction was not correlated with the corresponding changes in the enzyme activities This discrepancy may result from a higher turnover of these enzymes and/or an increase of their inactivation by H2 O2 (Scandalios, 1993) The data obtained in this work was inconsistent with the findings of Hoque et al (2007) and Gerdakaneh et al (2010) which reported that exogenous Pro showed protective roles in alleviating salt stress This may be because in this present study the rice plants were hydroponically grown under natural conditions, while the cell culture systems were used in the earlier reports Garcia et al (1997) also found the positive roles of exogenous Tre on reversing the adverse effects of salt stress in rice grown in the tissue culture system However, our results showed that exogenous application of Pro and Tre promoted a stronger ability of plants to recover from stress The roles and mechanisms of action of exogenous osmoprotectants are complex and remain controversial The beneficial effects of external supply of osmoprotectants vary depending on several conditions including plant species, developmental stages, the severity and duration of salt stress The effectiveness of the osmoprotectants also depends on whether they are applied prior to or during stress, methods of application and the concentrations of the osmoprotectants Available reports in rice involved the use of GB and Pro, therefore it is worth exploring the effects of other osmoprotectants such as Tre, sorbitol and ectoine Commercial prospects of enhancing stress tolerance in rice by exogenous osmoprotectants warrants further in-depth research in this area to gain a better understanding of the mechanism of action which can be applicable to improve crop production in stressful environments 603 Acknowledgements This work was financially supported by the TRF Master Research Grant (WII-MRG525S056), Khon Kaen University Research Grant to the Genomics and Proteomics Research Group for Improvement of Salt-tolerant Rice, and the Graduate School, Khon Kaen University We wish to thank Prof Dr Donald C Slack, the University of Arizona, Tuscon, Arizona, USA, for proof reading the manuscript References Aghdasi M, Schluepmann H, Smeekens S Characterization of Arabidopsis seedlings growth and development under trehalose feeding J Cell Mol Res 2010;2:1–9 Ali Q, Ashraf M Induction of drought tolerance in maize (Zea mays L.) due to exogenous application of trehalose: growth, photosynthesis, water relations and oxidative defense mechanism J Agron Crop Sci 2011;197:258–71 Ashraf M Biotechnological approach of improving plant salt tolerance using antioxidants as markers Biotechnol Adv 2009;27:84–93 Ashraf M, Foolad MR Roles of glycine betaine and proline in improving plant abiotic stress resistance Environ Exp Bot 2007;59:206–16 Bates LS, Waldren RP, Teare ID Rapid determination of free proline for water-stress studies Plant Soil 1973;39:205–7 Beuchamp C, Fridovich I Superoxide dismutase: improved assays and an assay applicable to acrylamide gels Anal Biochem 1971;44:276–87 Bradford M A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein–dye binding Anal Biochem 1976;72:248–54 Delauney AJ, Verma DPS A soybean -pyrroline-5-carboxylate reductase gene was isolated by functional complementation in E coli and is found to be osmoregulated Mol Gen Genet 1990;221:299–305 Dhindsa RS, Plumb-Dhindsa P, Thorpe TA Leaf senescence: correlation with increased levels of membrane permeability and lipid peroxidation and decreased levels of superoxide dismutase and catalase J Exp Bot 1981;32:93–101 Djilianov D, Georgieva T, Moyankova D, Atanassov A, Shinozaki K, Smeeken SCM, et al Improved abiotic stress tolerance in plant by accumulation of osmoprotectants gene transfer approach Biotechnol Biotechnol Eq 2005;19:63–71 Garcia AB, Engler JA, Iyer S, Cerats T, Montagu MV, Caplan AB Effects of osmoprotectants upon NaCl stress in rice Plant Physiol 1997;11:159–69 Garg AK, Kim JK, Owens TG, Ranwala AP, Choi YD, Kochian LV, et al Trehalose accumulation in rice plants confers high tolerance levels to different abiotic stresses Proc Natl Acad Sci USA 2002;99:15898–903 Ge LF, Chao DY, Shi M, Zhu MZ, Gao JP, Lin HX Overexpression of the trehalose-6phosphate phosphatase gene OsTPP1 confers stress tolerance in rice and results in the activation of stress responsive genes Planta 2008;228:191–201 Gerdakaneh M, Mozafari AA, Khalighi A, Sioseh-Mardah A The effects of exogenous proline and osmotic stress on morphology and biochemical parameters of strawberry callus Afr J Biotechnol 2010;9:3775–9 Gregorio GB, Senadhira D Genetic analysis of salinity tolerance in rice Theor Appl Genet 1993;86:333–8 Gregorio GB, Senadhira D, Mendoza RD Screening rice for salinity tolerance IRRI Discussion Paper Series 22 Manila: International Rice Research Institute; 1997 Hellmann H, Funck D, Rentsch D, Frommer WB Hypersensitivity of an Arabidopsis sugar signaling mutant toward exogenous proline application Plant Physiol 2000;123:779–90 Hernández JA, Jimenez A, Mullineaux PM, Sevilla F Tolerance of pea (Pisum sativum L.) to long-term salt stress is associated with induction of antioxidant defense Plant Cell Environ 2000;23:853–62 Heuer B Influence of exogenous application of proline and glycinebetaine on growth of salt-stressed tomato plants Plant Sci 2003;165:693–9 Hien DT, Jacobs M, Angenon G, Hermans C, Thu TT, Son LV, et al Proline accumulation and -pyrroline-5-carboxylate synthetase gene properties in three rice cultivars differing in salinity and drought tolerance Plant Sci 2003;165:1059–68 Hong CY, Hsuv YT, Tsai YC, Kao CH Expression of ascorbate peroxidase in roots of rice (Oryza sativa L.) seedlings in response to NaCl J Exp Bot 2007;58:3273–83 Hoque MA, Okuma E, Banu MNA, Nakamura Y, Shimoishi Y, Murata Y Exogenous proline mitigates the detrimental effects of salt stress more than exogenous betaine by increasing antioxidant enzyme activities J Plant Physiol 2007;164:553–61 Hoque MA, Banu MNA, Nakamura Y, Shimoishi Y, Murata Y Proline and glycinebetaine enhance antioxidant defense and methylglyoxal detoxification systems and reduce NaCl-induced damage in cultured tobacco cells J Plant Physiol 2008;165:813–24 Huang Y, Bie Z, Liu Z, Ai Z, Wang W Protective role of proline against salt stress is partially related to the improvement of water status and peroxidase enzyme activity in cucumber Soil Sci Plant Nutr 2009;55:698–704 Kaminaka H, Morita S, Tokumoto M, Masumura T, Tanaka K Differential gene expressions of rice superoxide dismutase isoforms to oxidative and environmental stresses Free Radic Res 1999;31:219–25 Kim RA, Nam HY, Kim SU, Kim SI, Chang YJ Normalization of reverse transcription quantitative-PCR with housekeeping genes in rice Biotechnol Lett 2003;25:1869–72 604 N Nounjan et al / Journal of Plant Physiology 169 (2012) 596–604 Kim DW, Shibato J, Agrawal GK, Fujihara S, Iwahashi H, Kim DH, et al Gene transcription in the leaves of rice undergoing salt-induced morphological changes (Oryza sativa L.) Mol Cell 2007;24:45–59 Lee DH, Kim YS, Lee CB The inductive responses of the antioxidant enzymes by salt stress in the rice (Oryza sativa L.) J Plant Physiol 2001;158:737–45 Lin CC, Kao CH Cell wall peroxidase activity, hydrogen peroxide level and NaClinhibited root growth of rice seedlings Plant Soil 2001;230:135–43 Luo Y, Li F, Wang GP, Yang XH, Wang W Exogenously-supplied trehalose protects thylakoid membranes of winter wheat from heat-induced damage Biol Plantarum 2010;54:495–501 Lutts S, Majerus V, Kinet JM NaCl effects on proline metabolism in rice (Oryza sativa) seedlings Physiol Plant 1999;105:450–8 Miller G, Stein H, Honig A, Kapulnik Y, Zilberstein A Responsive modes of Medicago sativa proline dehydrogenase genes during salt stress and recovery dictate free proline accumulation Planta 2005;222:70–9 Miller G, Honig A, Stein H, Suzuki N, Mittler R, Zilberstein A Unraveling pyrroline-5-carboxylate-proline cycle in plants by uncoupled expression of proline oxidation enzymes J Biol Chem 2009;284:26482–92 Munns R, James AJ, Läuchli A Approaches to increasing the salt tolerance of wheat and other cereals J Exp Bot 2006;57:1025–43 Nakano Y, Asada K Spinach chloroplasts scavenge hydrogen peroxide on illumination Plant Cell Physiol 1980;21:1295–307 Nakayama H, Horie T, Yonamine I, Shinmyo A, Yoshida K Improving salt tolerance in plant cells Plant Biotechnol 2005;22:477–87 Ozden M, Demirel U, Kahraman A Effects of proline on antioxidant system in leaves of grapevine (Vitis vinifera L.) exposed to oxidative stress by H2 O2 Sci Hortic 2009;119:163–8 Parida AK, Dagaonkar VS, Phalak MS, Aurangabadkar LP Differential responses of the enzymes involved in proline biosynthesis and degradation in drought tolerant and sensitive cotton genotypes during drought stress and recovery Acta Physiol Plant 2008;30:619–27 Paul M Trehalose 6-phosphate Curr Opin Plant Biol 2007;10:303–9 Peng Z, Lu Q, Verma DPS Reciprocal regulation of -pyrroline-5-carboxylate synthetase and proline dehydrogenase genes controls proline levels during and after osmotic stress in plants Mol Gen Genet 1996;253:334–41 Radyukina NL, Shashukova AL, Makarova SS, Kuznetsov VIV Exogenous proline modifies differential expression of superoxide dismutase genes in UV-Birradiated Salvia officinalis plants Russ J Plant Physiol 2011;58:51–9 Sairam V, Srivastava GC, Agarwal S, Meena RC Differences in antioxidant activity in response to salinity stress in tolerant and susceptible wheat genotypes Biol Plantarum 2005;49:85–91 Scandalios JG Oxygen stress and superoxide dismutases Plant Physiol 1993;101:7–12 Schluepmann H, Dijken AV, Aghdasi M, Wobbes B, Paul M, Smeekens S Trehalose mediated growth inhibition of Arabidopsis seedlings is due to trehalose-6phosphate accumulation Plant Physiol 2004;135:879–90 Shao BH, Chu LY, Lu ZH, Kang CM Primary antioxidant free radical scavenging and redox signaling pathways in higher plant cells Int J Biol Sci 2008;4:8–14 Sobahan MA, Arias CR, Okuma E, Shimoishi Y, Nakamura Y, Hirai Y, et al Exogenous proline and glycinebetaine suppress apoplastic flow to reduce Na(+) uptake in rice seedlings Biosci Biotechnol Biochem 2009;73:2037–42 Su J, Wu R Stress-inducible synthesis of proline in transgenic rice confers faster growth under stress conditions than that with constitutive synthesis Plant Sci 2004;166:941–8 Summart J, Thanonkeo P, Panichajakul S, Prathepha P, McManus MT Effect of salt stress on growth, inorganic ion and proline accumulation in Thai aromatic rice, Khao Dawk Mali 105, callus culture Afr J Biotechnol 2010;9:145–52 Thai Rice Exporters Association 2011; http://www.thairiceexporters.or.th/ production.htm Theerakulpisut P, Bunnag S, Kong-Ngern K Genetic diversity, salinity tolerance and physiological responses to NaCl of six rice (Oryza sativa L.) cultivars Asian J Plant Sci 2005;4:562–73 Trovato M, Mattioli R, Costantino P Multiple roles of proline in plant stress tolerance and development Rendiconti Lincei 2008;19:325–46 Türkan I, Demiral T Recent developments in understanding salinity tolerance Environ Exp Bot 2009;67:2–9 Vaidyanathan H, Sivakumar P, Chakrabarty R, Thomas G Scavenging of reactive oxygen species in NaCl-stressed rice (Oryza sativa L.) differential response in salt-tolerant and -sensitive varieties Plant Sci 2003;165:1411–8 Velikova V, Yordanov I, Edreva A Oxidative stress and some antioxidant system in acid rain-treated bean plants: protective roles of exogenous polyamines Plant Sci 2000;151:59–66 Verbruggen N, Villarroel R, Van Montagu M Osmoregulation of pyrroline5-carboxylate reductase gene in Arabidopsis thaliana Plant Physiol 1993;103:771–81 Yamada M, Morishita H, Urano K, Shiozaki N, Yamaguchi-Shinozaki K, Shinozaki K, et al Effects of free proline accumulation in petunias under drought stress J Exp Bot 2005;56:1975–81 Yoshida S, Forno DA, Cock JH, Gomez KA Laboratory manual for physiological studies of rice Manila: International Rice Research Institute; 1976 Yu-zhuo A, Ye-jie D, Yuan-gang Z, Zhi-gang A Inhibition effect of expression of Cu/Zn superoxide dismutase from rice on synthesis of glutathione in Saccharomyces cerevisiae J Forest Res 2008;19:63–6 Zeid IM Trehalose as osmoprotectant for maize under salinity-induced stress Res J Agric Biol Sci 2009;5:613–22  ... during salt-stress and after recovery The effects of salt stress and exogenous Pro and Tre on the activity of antioxidant enzymes during salt-stress and after recovery Fig The effect of NaCl (S), Pro... up-regulation of PDH (Miller et al., 2005) Effect of exogenous Pro and Tre on H2 O2 , antioxidant enzymes activity and expression of related genes Increase in H2 O2 content in response to salt stress in rice. .. salt stress and d after recovery (TS) The amount of Pro in PS was 2.0 fold that of S and 4.2 fold that of TS In the groups without NaCl (C, P and T), the application of Pro (P) dramatically enhanced