DSpace at VNU: Multiplex PCR assay for malaria vector Anopheles minimus and four related species in the Myzomyia Series from Southeast Asia

Medical and Veterinary Entomology (2003) 17, 423–428 Multiplex PCR assay for malaria vector Anopheles minimus and four related species in the Myzomyia Series from Southeast Asia H K PHUC, A J BALL, L SON*, N V HANH*, N D TU*, N G LIEN*, A V E R A R D I and H T O W N S O N Liverpool School of Tropical Medicine, U.K and *Hanoi University of Science, Vietnam Abstract Mosquitoes (Diptera: Culicidae) of the Anopheles (Cellia) Myzomyia Series are important malaria vectors in Africa, India and Southeast Asia Among 10 named species of Myzomyia known from the Oriental Region, seven form the An minimus group Even for expert taxonomists, the adults of these species remain difficult to identify morphologically For technical staff of malaria control programmes, confusion may extend to misidentification of species that are not formally within the minimus group For identification of specimens from Indochina (Cambodia, Laos, Vietnam), we describe a multiplex polymerase chain reaction (PCR) assay, based on rDNA internal transcribed spacer (ITS2) sequences, that employs a cocktail of primers to identify An minimus Theobald sibling species A and C (sensu; Green et al., 1990) and three other species in the An minimus group (An aconitus Doănitz, An pampanai Buăttiker & Beales, An varuna Iyengar), as well as An jeyporiensis James, also belonging to the Myzomyia Series As the test is DNA-based, it can be applied to all life stages of these mosquitoes for ecological investigations and vector incrimination studies This PCR assay is simpler, quicker, cheaper and more readily interpreted than previous assays Key words Anopheles aconitus, An jeyporiensis, An minimus, An pampanai, An varuna, Myzomyia, malaria vectors, polymerase chain reaction assay, rDNA ITS2, sibling species, species identification, Southeast Asia, Cambodia, Laos, Vietnam Introduction Anopheles minimus is recognized as an important malaria vector throughout the Oriental region (Reid, 1968; Harrison, 1980; Lien, 1991; Pholsena, 1992; Baimai et al., 1996; Dev, 1996; Sawabe et al., 1996; Khan et al., 1998; Kobayashi et al., 2000; Chen et al., 2002) In Thailand, Green et al Correspondence: Professor H Townson, Liverpool School of Tropical Medicine, Pembroke Place, Liverpool L3 5QA, U.K E-mail: htownson@liverpool.ac.uk # 2003 The Royal Entomological Society (1990) considered An minimus to comprise at least two sibling species, A and C, based on the absence of heterozygotes for two alleles of octanol dehydrogenase (Odh 100 and 134) The work of Sharpe et al (2000) and Somboon et al (2001) confirms that An minimus (sensu Harrison, 1980) is a complex of several species, with important differences in vector roles and distributions (Chen et al., 2002) For other species in the An minimus group (Harrison, 1980; Chen et al., 2003), evidence of a role in malaria transmission is scanty and difficult to evaluate In addition to the An minimus complex, there are six other nominal members of the An minimus group among 11 Oriental species 423 424 H K Phuc et al described in the Myzomyia* Series (sensu Edwards, 1932) of Anopheles subgenus Cellia Among these species, the overlapping morphological characters lead to confusion for field entomologists seeking to implicate the species in malaria transmission, particularly where two or more species are in sympatry For example, the appearance of pale spots on the costal wing vein is used in diagnosis, yet in some parts of southeast Asia, An minimus has highly variable wing spotting that may lead to it being confused with other Myzomyia species (Van Bortel et al., 2000, 2001, 2002) Anopheles aconitus is widespread and abundant across southeast Asia, but usually zoophilic Rahman et al (1995) found Plasmodium falciparum sporozoites in An aconitus collected from cattle in Pensinsula Malaysia, whereas Hassan et al (2001) collected it biting humans indoors in Malaysia Anopheles aconitus is regarded as a secondary vector in Cambodia (Webster, 2000) and was the primary inland vector in Java (Chow et al., 1959) Anopheles varuna has been considered a malaria vector in the hilly and forested parts of east-central India (Rao, 1984), but its overall distribution and importance as a malaria vector in the Oriental region is uncertain because it has been, and continues to be, much confused with An minimus (Reid, 1968; Van Bortel et al., 2001) In the case of An pampanai there are few records to indicate its true vector status Regarding other Oriental Myzomyia, An filipinae and An flavirostris are restricted to certain island groups The An culicifacies complex has five sibling species (A, B, C, D and E) that may all contribute to malaria transmission in the Indian subcontinent (Subbarao, 1998; Kar et al., 1999), of which only species B has been recorded from southeast Asia (Van Bortel et al., 2002) Anopheles jeyporiensis is the commonest anopheline in the western Ghats and has been recorded as a vector of malaria in many parts of India, particularly in the Jeypore Hills (Rao, 1984) from where it was described, although Reid (1968) regarded it as only a minor vector of malaria in the Orient In Vietnam, hundreds of specimens of An jeyporiensis have been examined using a sporozite enzyme-linked immunosorbent assay and not a single positive has been found (Binh Nguyen Thi Huong, personal communication) Likewise, in Assam the sporozoite rate of An jeyporiensis is reported to be only 0.04%, similar to 0.02–0.7% in An varuna, where the major vector is An minimus with much higher sporozoite rates (Rao, 1984; Dev, 1996) Sharpe et al (1999) used allele-specific amplification of the D3 variable region of the 28S rDNA gene to distinguish An minimus A from C and single-strand conformation polymorphism (SSCP) of the D3 amplified region to discriminate four species, An varuna, An aconitus, An minimus A and C Unfortunately, this method is more time consuming and the results less easy to interpret than those from conventional polymerase chain reaction (PCR) An alternative approach was adopted by Van Bortel et al (2000) who used PCR amplification of the rDNA rDNA internal transcriber spacer (ITS2) region followed by BsiZI restriction enzyme digestion to distinguish An aconitus, An jeyporiensis, An minimus A and C, An pampanai, An varuna and subsequently An culicifacies (Van Bortel et al., 2002) Compared to SSCP, this is simpler, but it requires local medical entomologists to employ both PCR and restriction fragment length polymorphism (RFLP) analysis with consequent increased costs and methodological complexity Furthermore, RFLP fragments of very similar size are produced in An minimus C and An varuna, so that these species may easily be confused Most recently, Kengne et al (2001) described the use of random amplified polymorphic DNA (RAPD) markers for the identification of species in the An minimus group RAPD fragments specific for species A and C were cloned and sequenced From these sequences, specific primer pairs were designed to create a multiplex PCR able to identify five species: An minimus A and C, An aconitus, An pampanai and An varuna In this assay, the PCR products from hybrids of minimus A and C were different from both parents These so-called ‘hybrizymes’ add to the confusion of using such a method in routine, large-scale sampling of mosquito populations In this study, we describe the development and use of a method, based on a single multiplex PCR, for identifying An minimus species A and C and distinguishing the four related species, An aconitus, An jeyporiensis, An varuna and An pampanai that are most frequently encountered in Cambodia, Laos and Vietnam (Indochina) This method has proved both simple and reliable in our hands, and when employed by others (C Walton, personal communication) Materials and methods Mosquitoes * According to Harbach (1994) the Myzomyia Series includes more than 60 recognized species of Anopheles (Cellia), mostly endemic to the Afrotropical Region, with 11 named taxa in the Oriental Region: aconitus Doănitz, filipinae Manalang, culicifacies Giles, flavirostris (Ludlow), fluviatilis James, jeyporiensis James, majidi (Young & Majid), mangyanus (Banks), minimus Theobald, pampanai Buăttiker & Beales and varuna Iyengar Those in bold comprise the An minimus group Several of these nominal speciesgroup taxa are complexes of multiple sibling species with nonLinnean terminology Chen et al (2002) reviewed the An minimus group in China, where Hong Kong is the type-locality of minimus Molecular phylogeny of Oriental Myzomyia was interpreted by Chen et al (2003) # The specimens examined in this study were collected from 36 study sites in Vietnam, Laos and Cambodia The geographical location and ecological character of the sites are shown in Fig and Table Female mosquitoes were also collected using landing collections on human bait A proportion were allowed to feed (either on the senior author or a graduate volunteer, with informed consent) and their eggs collected and larvae reared Specimens were identified to species using morphological characters and the key of Harrison (1980) Because the molecular characteristics of these species are unambiguously different (see below), any specimens that initially were of doubtful identity, were 2003 The Royal Entomological Society, Medical and Veterinary Entomology, 17, 423–428 PCR identification of Oriental Myzomyia species follows: 94 C for min; 30 cycles of 94 C for min, 55 C for min, 72 C for min; followed by a final extension at 72 C for 10 PCR products were purified on QIAquick Spin column (Qiagen: www.qiagen.com) and the products checked by running on agarose gels again before sequencing in an ABI PrismTM 377 DNA Sequencer (www.appliedbiosystems.com) CHINA 13 14 12 11 15 10 32 LAOS 425 16 17 18 19 35 33 20 Species diagnostic PCR 21 34 THAILAND 22 23 CAMBODIA 24 36 25 30 28 31 29 26 27 The assay employed six species-specific reverse primers and one universal forward primer derived from the highly conserved region of the 5.8S coding region (Tables and 3) The PCR reaction was run in a 25 mL volume containing: 2.5 mL 10Â buffer (100 mM Tris-HCl pH 8.3, 500 mM KCl), 0.2 mM NTPs, 1.5 mM MgCl2, 25 ng each of six primers, 0.625 U Taq, and 10–20 ng DNA template This diagnostic PCR requires very little DNA and results were obtained with c 1/800 of the total DNA from a mosquito or 1/50 of the DNA extracted from a single leg The thermal cycle profile was optimized to the following conditions: 94 C for 5min; then 32 cycles of 94 C for min, 60 C for and 72 C for 2min and a final extension at 72 C for 5–10 Ten microlitres of reaction products were run on 1.2% agarose gels containing ethidium bromide and produced fragments whose sizes were diagnostic for the species (see Fig 2) Fig Map showing the mosquito collection sites in Cambodia, Laos and Vietnam Details of sites are given in Table Results subsequently assigned readily to species on the basis of the PCR test described below For An minimus s.l., several offspring from each brood were then examined for their octanol dehydrogenase electromorphs (Green et al., 1990) to determine whether they were An minimus A or C The remainder of the brood was preserved in absolute alcohol for subsequent DNA studies Likewise, specimens collected by CDC light-trap were identified morphologically and then placed directly in absolute alcohol for assays later Amplification and sequencing Genomic DNA from individual mosquitoes was extracted following the method of Ballinger-Crabtree et al (1992), the final DNA pellet being re-suspended in 50 mL of TE buffer The rDNA ITS2 region was then amplified using conserved 5.8S and 28S primers modified from those used by Paskewitz & Collins (1990) Each PCR reaction was carried out in 0.5-mL microtubes in an Omni-E thermal cycler (Hybaid: www.thermohybaid.com) using a 25 mL reaction buffer containing: 2.5 mL 10Â Buffer (100 mM Tris-HCl, pH 8.3, 500 mM KCl) 0.2 mM NTPs, 1.5 mM MgCl2, 25 ng each of 5.8S and 28S primers, 0.5 U Taq DNA polymerase (Sigma: www.sigmaaldrich.com) and 20–50 ng DNA template The thermal cycle profile was as # Specific ITS2 primers The complete ITS2 region was amplified from 13 specimens of An minimus A (373 bp) collected from Laos, Cambodia, Vietnam and on the border of Vietnam and China and from nine specimens of An minimus C (375 bp) from northern Laos, Vietnam and the border of Vietnam and China (see Table 2) There are a total of 23 bp differences between An minimus A and C, comprising two indels, 15 transversions and six transitions, and these differences were consistent throughout the sampling area In comparison, there are few similarities between the ITS2 sequences of An minimus and those of the other minimus group species, An aconitus, An pampanai and An varuna, whose ITS2 regions are 278, 255 and 227 bp, respectively These differences confound alignment of their ITS2 sequences Based on species-specific differences, six primers were designed and using as reverse primers These reverse primers were mixed with 5.8S forward primer to amplify the whole ITS2 region (Manonmani et al., 2001) This diagnostic cocktail gives a 184 bp PCR product with template DNA from An minimus A, a 252 bp band for An varuna, a 306 bp band for An aconitus, a 346 bp band for An jeyporiensis, a 452 bp band for An pampanai and a 509 bp band for An minimus C This species-diagnostic assay produces 2003 The Royal Entomological Society, Medical and Veterinary Entomology, 17, 423–428 426 H K Phuc et al Table Details of sampling sites of Anopheles minimus A and C and An aconitus (Aco), An jeyporiensis (Je), An pampanai (Pa) and An varuna (Va) Localities are those of a village or hamlet and the relevant province HBC, human bait catches; BBC, bovid bait catches; MIC, early morning indoor collections; LT, CDC light-trap collections; ORC, outdoor-resting collections; LS, larval sampling Species Locality name/province Terrain Date of collection Geographical coordinates Collection method A, C, Je, Aco A, Je, Aco A, Je, Aco A, Je A, C, Je A, C, Je A, C, Je, Aco A, C, Je, Aco A, C, Je, Aco A, C, Je, Aco A, C, Je, Aco A, Aco A A A Aco, Je A, C, Je, Aco A, Je, Aco A, C, Aco A, C, Aco A, Aco A A, Je, Aco A, Je, Aco Aco, Je A, Aco, Va Aco, Pa, Va Aco, Je A, Aco A, Je, Aco A, Aco Vietnam Phuong Do/Ha Giang Quang Ngan Vuoc/Lao Cai Qua Thon/Son La Huoi Oi Ca Lieng/Cao Bang Na Phuong Ang Mo/Lang Son 10 Phu Cuong/Hoa Binh 11 Quyet Chien 12 Hoa Son 13 Giang Bien/Hanoi 14 Duong Ha 15 Mai Hien 16 Cat Ba/HaiPhong 17 Thach Thanh/Thanh Hoa 18 Quynh Thang/Nghe An 19 Cam Lam 20 Huong Khe/Ha Tinh 21 Ky Thinh 22 Van Canh 23 Konthup/Gia Lai 24 Alaba 25 Khanh Phu/Khanh Hoa 26 Binh Thanh/BinhThuan 27 Tanh Linh 28 Lada 29 Dong Xoai/Dong Nai 30 Dac U/Binh Phuoc 31 Thanh Tan/Tay Ninh Mountain and foothills Foothills Foothills Foothills Savanna High mountains Mountains Mountains Mountains Mountains High mountains Foothills Plain Plain Plain Island Primitive forest Savanna and foothills High mountains Forest Coast plain Foothill Highland Highland Mountain Coast plain Forest Forest and mountain Plain Forest Plain and foothills March 25, 1999 March 26, 1999 February 10, 1999 February 10, 1999 October 9, 1999 October 11, 1999 November 5, 1999 November 4, 1999 April 8, 2000 Three trips, 1999 Five trips, 1999 Laboratory colony Tens of trips Tens of trips Tens of trips August 12, 1999 November 12, 1999 November 23, 1999 November 21, 1999 November 24, 1999 November 25, 1999 Dry sample June 10, 1999 June 15, 1999 June 2, 1999 Four trips, 1999 Two trips, 1999 May 21, 1999 July 20, 1999 Three trips, 1999 May 26, 1999 22 490 N 105 30 E 22 310 N 104 540 E 22 310 N 104 60 E 22 310 N 104 50 E 21 40 N 104 50 E 20 550 N 104 30 E 22 290 N 106 340 E 22 310 N 106 330 E 22 150 N 106 280 E 20 370 N 105 160 E 20 300 N 105 110 E 20 550 N 105 400 E 21 30 N 105 550 E 21 40 N 105 550 E 21 50 N 105 530 E 20 440 N 107 20 E 20 140 N 105 360 E 19 190 N 105 250 E 18 520 N 104 420 E 18 230 N 105 280 E 18 50 N 106 230 E 13 370 N 108 590 E 13 440 N 107 510 E 14 120 N 107 550 E 12 140 N 108 580 E 11 100 N 108 410 E 11 50 N 107 400 E 11 90 N 107 160 E 11 320 N 106 540 E 12 140 N 107 260 E 11 190 N 106 30 E BBC*, HBC*, MIC BBC*, HBC*, MIC BBC*, HBC*, MIC BBC*, MIC* BBC*, MIC BBC* BBC*, HBC BBC*, HBC BBC*, HBC, MIC BBC*, HBC*, MIC* BBC*, HBC, MIC* MIC* LS*, MIC*, ORC* LS* LS* BBC* BBC*, HBC BBC*, HBC* BBC*, HBC* BBC* BBC* BBC* BBC*, HBC, LT* BBC*, HBC, LT* BBC* BBC* BBC*, HBC BBC*, HBC BBC* BBC*, HBC* BBC*, HBC A, A, A, A, Laos 32 Muong Son/Samneur 33 Voong Co/Bolikhamxay 34 Khamcot 35 Phonxay High mountain Forest Mountainous town Forest Dec, 1999 February 26, 1999 February 30, 1999 March 2, 1999 20 530 N 18 120 N 18 110 N 18 150 N BBC*, HBC BBC*, HBC*, MIC* BBC*, MIC* BBC* Cambodia 36 Ta Trok/Battambang Forest and plain July 3, 1999 12 510 N 102 490 E C, Je, Aco Aco, Je Aco Je A, Aco, Pa,Va 104 20 E 104 460 E 104 580 E 104 560 E BBC*, HBC *Methods used successfully to collect An minimus PCR products that are significantly different in size to distinguish them readily by examination of an ethidium bromide-stained gel (Fig 2) A natural hybrid of An minimus A and C found in Calieng, Cao Bang was recognized, as was a laboratory-produced hybrid; each gave two bands, one from each parent These primers were used to identify 661 adult female mosquitoes, comprising 25 An aconitus, 65 An jeyporiensis, 280 An minimus A, 150 An minimus C, 31 An pampanai and 110 An varuna All results were unambiguous and agreed completely with isoenzyme or mitotic chromosome determinations Smaller numbers of larvae and adult males were also identified using this assay # Discussion From the area sampled, no intraspecific variation was detected in the sequence of the ITS2 region in mosquitoes of the An minimus complex Samples of An minimus A from the extreme north of Vietnam (bordering southern China), northern Laos to central Vietnam and Laos, and southern Vietnam and north-west Cambodia have identical ITS2 sequence with An minimus A from Thailand, as described by Sharpe et al (2000) Similarly, An minimus C from the Vietnam/China border, through middle Vietnam and Laos all have identical ITS2 sequences Studies of mitochondrial DNA sequences and of allelic variation at 2003 The Royal Entomological Society, Medical and Veterinary Entomology, 17, 423–428 PCR identification of Oriental Myzomyia species 427 Table DNA sequence of ITS2 in Anopheles minimus species A and C showing insertions/deletions (indels –), transitions (s) and transversions (v) The two species differ at 23 out of the 375 bases found in species C Nucleotide position An minimus A An minimus C Indel Transition Tranversion A T 4 2 9 3 4 5 5 5 6 3 7 7 C A A T C T T A – A – – A – T G A C G C G A C G G A G T C A A G A G A C A C A C C T A C A C s s s v v s v v v v v s v v v s v v v v v Base pairs Percentage 373 375 2/23 6/23 15/23 8.7 26.1 65.2 Table Sequence of the primers used for ITS2 amplification and species diagnosis within Myzomyia Oligonucleotide sequence (50 À30 ) Function Size of the PCR product (bp) PCR primers used for ITS2 amplification ATCACTCGGCTCATGGATCG ATGCTTAAATTTAGGGGGTAGTC Anneals to 5.8S Anneals to 28S 558–601 PCR primers used for species diagnosis ATCACTCGGCTCATGGATCG GGGCGCCATGTAGTTAGAGTTG GTGGCCCCGCAATGTATG AGGTTCACCCCGCTCTGG CTCCCCATAGCGCGTAAGC GAAAGCACCTGAAACCTGCG GGTTGCCCACTCAATACGGGTG Anneals to 5.8S An minimus A An varuna An aconitus An jeyporiensis An pampanai An minimus C 184 252 306 346 452 509 microsatellite loci (Phuc and Townson, unpublished data) show evidence of significant genetic variation within species A and C, but this is not reflected at the level of the ITS2 sequences The significance of this variation and its relevance to speciation in the minimus complex can only be assessed once these other data are complete and analysed For An aconitus, one individual was sequenced from each collection site and identical ITS2 sequences were found in all specimens from northern and southern Vietnam The same is true of An jeyporiensis Samples of An varuna and An pampanai were collected in southern Vietnam and north-west Cambodia, at sites $1000 km apart, without any ITS2 sequence variation being found For the six species studied, therefore, the apparent absence of intraspecific variation within the ITS2 region sequence between samples from Cambodia, Laos and Vietnam, together with the unambiguous differences in PCR product-size, make this assay very suitable for differentiation of An aconitus, An jeyporiensis, An pampanai and An varuna, as well as distinguishing between species A and C of An minimus in Indochina and probably elsewhere 184 252 306 346 452 509 bp Fig Products from the multiplex PCR run on a 1.2% agarose gel Track 1, 100 bp molecular weight ladder (Sigma P1473); track 2, Anopheles minimus A; track 3, An varuna; track 4, An aconitus; track 5, An jeyporiensis; track 6, An pampanai; track 7, An minimus C; track 8, laboratory A/C hybrid; track 9, natural A/C hybrid # Acknowledgements We thank the World Health Organization TDR programme, The Leverhulme Trust and the British Council for funding this research and associated field studies 2003 The Royal Entomological Society, Medical and Veterinary Entomology, 17, 423–428 428 H K Phuc et al References Baimai, V., Kijchalao, U & Rattanarithikul, R (1996) Metaphase karyotypes of Anopheles of Thailand and Southeast Asia: V, The Myzomyia series, subgenus Cellia (Diptera: Culicidae) Journal of the American Mosquito Control Association, 12, 97–105 Ballinger-Crabtree, M.E., Black, W.C & Miller, B.R (1992) Use of genetic polymorphisms detected by the random-amplified polymorphic DNA polymerase chain reaction (RAPD-PCR) for differentiation and identification of Aedes aegypti subspecies and populations American Journal of Tropical Medicine and Hygiene, 47, 893–901 Chen, B., Harbach, R.E & Butlin, R.K (2002) Molecular and morphological studies on the An minimus group of mosquitoes in southern China: taxonomic review, distribution and malaria vector status Medical and Veterinary Entomology, 16, 253–265 Chen, B., Butlin, R.K & Harbach, R.E (2003) Molecular phylogenetics of the Oriental members of the Myzomyia Series of Anopheles subgenus Cellia (Diptera: Culicidae) inferred from nuclear and mitochondrial sequences Systematic Entomology, 28, 57–69 Chow, C.Y., Ibnoe, M.R & Josopoero, S.T (1959) Bionomics of anopheline mosquitoes in inland areas of Java, with special reference to Anopheles aconitus Doăn Bulletin of Entomological Research, 50, 647–660 Dev, V (1996) Anopheles minimus: its bionomics and role in the transmission of malaria in Assam, India Bulletin of the World Health Organization, 74, 61–66 Edwards, F.W (1932) Genera Insectorum Diptera Fam Culicidae Fascicle, 194, 1–258 Green, C.A., Gass, R.F., Munstermann, L.E & Baimai, V (1990) Population genetic evidence for two species in Anopheles minimus Thailand Medical and Veterinary Entomology, 4, 25–34 Harbach, R.E (1994) Review of the internal classification of the genus Anopheles (Diptera: Culicidae): the foundation for comparative systematics and phylogenetic research Bulletin of Entomological Research, 84, 331–342 Harrison, B.A (1980) Medical entomology studies XIII The Myzomyia series of Anopheles (Cellia) in Thailand, with emphasis on intra-interspecific variations (Diptera: Culicidae) Contributions of the American Entomological Institute, 17, 1–195 Hassan, A.A., Rahman, W.A., Rashid, M.Z.A., Shahrem, M.R & Adanan, C.R (2001) Composition and biting activity of Anopheles (Diptera: Culicidae) attracted to human bait in a malaria endemic village in peninsular Malaysia near the Thailand border Journal of Vector Ecology, 26, 70–75 Kar, I., Subbarao, S.K., Eapen, A et al (1999) Evidence for a new malaria vector species, species E, within the Anopheles culicifacies complex (Diptera: Culicidae) Journal of Medical Entomology, 36, 595–600 Kengne, P., Trung, H.D., Baimai, V., Coosemans, M & Manguin, S (2001) A multiplex PCR-based method derived from random amplified polymorphic DNA (RAPD) markers for the identification of species of the Anopheles minimus group in Southeast Asia Insect Molecular Biology, 10, 427–435 Khan, S.A., Handique, R., Tewari, S.C., Dutta, P., Narain, K & Mahanta, J (1998) Larval ecology and mosquito fauna of upper Brahmaputra valley, northeast India Indian Journal of Malariology, 35, 131–145 Kobayashi, J., Somboon, P., Koemanila, H et al (2000) Malaria prevalence and a brief entomological survey in a village surrounded by rice fields in Khammouan province, Lao PDR Tropical Medicine and International Health, 5, 17–21 # Lien, J.C (1991) Anopheline mosquitoes and malaria parasites in Taiwan Gaoxiong Yi Xue Ke Xue Za Zhi, 7, 207–223 Manonmani, A., Townson, H., Adeniran, T., Jambulingam, P., Sahu, S & Vijayakuma, T (2001) rDNA-ITS2 polymerase chain reaction assay for the sibling species of Anopheles fluviatilis Acta Tropica, 78, 3–9 Paskewitz, S.M & Collins, F.H (1990) Use of the polymerase chain reaction to identify mosquito species of the Anopheles gambiae complex Medical and Veterinary Entomology, 4, 367–373 Pholsena, K (1992) The malaria situation and antimalaria program in Laos Southeast Asian Journal of Tropical Medicine and Public Health, 23, 39–42 Rahman, W.A., Hassan, A.A., Adanan, C.R & Rashid, M.R (1995) A report of Anopheles minimus (Diptera: Culicidae) attracted to cow bait in a malaria endemic village in peninsular Malaysia near the Thailand border Southeast Asian Journal of Tropical Medicine and Public Health, 26, 359–363 Rao, T.R (1984) The Anophelines of India Malaria Research Centre, Indian Council of Medical Research, New Delhi Reid, J.A (1968) Anopheles mosquitoes of Malaya and Borneo Studies from the Institute for Medical Research Malaysia, 31, 1–520 Sawabe, K., Takagi, M., Tsuda, Y et al (1996) Genetic differentiation among three populations of Anopheles minimus of Guangxi and Yunnan Provinces in the People’s Republic of China Southeast Asian Journal of Tropical Medicine and Public Health, 27, 818–827 Sharpe, R.G., Hims, M.M., Harbach, R.E & Butlin, R.K (1999) PCR-based methods for identification of species of the Anopheles minimus group: allele-specific amplification and single-strand conformation polymorphism Medical and Veterinary Entomology, 13, 265–273 Sharpe, R.G., Harbach, R.E & Butlin, R.K (2000) Molecular variation and phylogeny of the Minimus group of Anopheles subgenus Cellia (Diptera: Culicidae) Systematic Entomology, 25, 263–272 Somboon, P., Walton, C., Sharpe, R.G., Higa, Y., Tuno, N., Tsuda, Y & Takagi, M (2001) Evidence for a new sibling species of Anopheles minimus from the Ryuku Archipelago, Japan Journal of the American Mosquito Control Association, 17, 98–113 Subbarao, S.K (1998) Anopheline Species Complexes in South-East Asia Technical Publication, SEARO No 18, pp 1–82 World Health Organization Regional Office for South-East Asia, New Delhi Van Bortel, W., Trung, H.D., Roelants, P., Harbach, R.E., Backeljau, T & Coosemans, M (2000) Molecular identification of Anopheles minimus s.1 beyond distinguishing the members of the species complex Insect Molecular Biology, 9, 335–40 Van Bortel, W., Harbach, R.E., Trung, H.D., Roelants, P., Backeljau, T & Coosemans, M (2001) Confirmation of Anopheles varuna in Vietnam, previously misidentified and mistargeted as the malaria vector Anopheles minimus American Journal of Tropical Medicine and Hygiene, 65, 729–732 Van Bortel, W., Sochanta, T., Harbach, R.E., Socheat, D., Roelants, P., Backeljau, T & Coosemans, M (2002) Presence of Anopheles culicifacies B in Cambodia established by the PCRRFLP assay developed for the identification of Anopheles minimus species A and C and four related species Medical and Veterinary Entomology, 16, 329–334 Webster, J (2000) Malaria control in complex emergencies Cambodia http://www.malariaconsortium.org/Cambodia.pdf Accepted 21 September 2003 2003 The Royal Entomological Society, Medical and Veterinary Entomology, 17, 423–428 ... populations In this study, we describe the development and use of a method, based on a single multiplex PCR, for identifying An minimus species A and C and distinguishing the four related species, ... Manguin, S (2001) A multiplex PCR- based method derived from random amplified polymorphic DNA (RAPD) markers for the identification of species of the Anopheles minimus group in Southeast Asia Insect... Butlin, R.K (1999) PCR- based methods for identification of species of the Anopheles minimus group: allele-specific amplification and single-strand conformation polymorphism Medical and Veterinary