Aquaculture research, tập 42, số 12, 2011

Aquaculture Research, 2011, 42, 1745^1751 doi:10.1111/j.1365-2109.2010.02771.x Genetic variation in resistance to infectious pancreatic necrosis in rainbow trout (Oncorhynchus mykiss) after a challenge test Marte Wetten1, Sissel Kjệglum1, Kjersti Turid Fjalestad1, Olaf Skjìrvik2 & Arne Storset1 Aqua Gen AS, Pir-Senteret,Trondheim, Norway VESO Vikan,Vikan, Namsos, Norway Correspondence: Sissel Kjệglum, Aqua Gen AS, PO Box 1240, Pir-Senteret, N-7462 Trondheim, Norway E-mail: sissel.kjoglum@ aquagen.no Abstract In this study, we wanted to evaluate genetic variation in resistance to infectious pancreatic necrosis (IPN) in a breeding population of rainbow trout Two hundred families were challenged at a commercial test station, using methods that were previously developed for testing resistance to IPN in Atlantic salmon Thirty-Âve days after the challenge the accumulated mortality was 26% The results show that resistance to IPN is moderately heritable in the tested population (h2 50.30) The genetic correlation between IPN resistance and body weight was found to be low and non-signiÂcant The signiÂcant additive genetic variation found in IPN resistance after a controlled challenge test gives promise for successful breeding for increased resistance to IPN in rainbow trout Keywords: genetics, IPN, rainbow trout, variance components Introduction Infectious pancreatic necrosis (IPN) is a serious disease in farmed salmonids and may cause major economic losses both in fry and post-smolts In general, IPN aĂects rainbow trout (Oncorhynchus mykiss) mainly in freshwater; only a few cases of IPN in searunning rainbow trout have been reported (Torkjel Bruheim, pers comm.) This is diĂerent from Atlantic salmon (Salmo salar) which is aĂected both in freshand seawater (Roberts & Pearson 2005) Although good management and vaccination can reduce mortality, the risk of disease outbreaks cannot be elimi- r 2011 Blackwell Publishing Ltd nated Genetically improved resistance is therefore a valuable strategy to reduce losses due to IPN Okamoto, Tayama, Kawanobe, Fujiki, Yasuda and Sano (1993) described how progeny, whose parents had experienced an IPN outbreak, had an increased resistance to IPN in rainbow trout By carefully checking for virus persistence in their breeding population, they were able to establish an IPN-resistant strain with no virus in the Âfth generation For commercial breeding, using survivors of either a natural outbreak or a controlled challenge is regarded as unacceptable due to the risk of introducing IPN virus (IPNV) into the rearing facilities of the hatcheries For genetic improvement purposes, selection based on survival information from full- and half-sibs has so far been the preferred method for commercial breeding organizations In Atlantic salmon, genetic variation in resistance to IPN has been well documented in diĂerent strains (Guy, Bishop, Brotherstone, Hamilton, Roberts, McAndrew & Woolliams 2006; Storset, Strand, Wetten, Kjệglum & Ramstad 2007; Wetten, Aasmundstad, Kjệglum & Storset 2007; Guy, Bishop, Woolliams & Brotherstone 2009) In the Aqua Gen population of Atlantic salmon, selection for increased resistance to IPN has been very successful and has led to a considerable genetic improvement in IPN resistance (Storset et al 2007) Both persisting losses due to IPN in commercial rainbow trout aquaculture and successful results from selective breeding for increased IPN resistance in Atlantic salmon encouraged us to hypothesize that the challenge test developed for Atlantic salmon would also enhance selective breeding of rainbow trout The results in this study present the estimates 1745 Breeding for IPN-resistance in rainbow trout M Wetten et al of variance components and an estimate of heritability, and possibilities of genetic improvement of IPN resistance by selection are discussed Also, because of the importance of growth in the breeding programme for rainbow trout, the genetic correlation between body weight and IPN resistance was estimated Materials and methods Fish The family-based breeding programme that Aqua Gen is now managing was initiated in1972 Fish were collected from farms in both Norway and Sweden during the years 1972^1974 to give the basis for three distinct breeding populations of rainbow trout, one for each year class in the generation interval (3 years) In 2006, the three distinct breeding populations were merged into one and another commercial strain (previously bred separately) was also introduced to the Aqua Gen breeding population None of the four populations that have now been merged into one have ever been selected for increased IPN resistance The 200 tested families in the 2006 year class were made from112 dams and108 sires The mating design was partial factorial, where eggs from each dam were split in two and fertilized with milt from two diĂerent males Due to few oĂspring in 24 of the families, only 200 out of the 224 families originally made could be used for the challenge test Each family were allocated to a separate compartment of an egg incubator As all Âsh challenged to IPNV were destroyed after the test, individual body weight was recorded on fullsibs of the challenged Âsh months after fertilization In total,18952 Âsh were registered for their body weight Fish who had their body weights recorded were kept as separate families in separate tanks from fertilization until tagging by a PIT-tag (Trac id systems AS, Stavanger, Norway), at weight of 5^10 g After tagging, all Âsh were reared communally This body weight registration is a routine in the breeding programme, and the body weights registered at this time are used in the breeding-value estimation Challenge test The Âsh were challenged at VESO Vikan (Nord Trệndelag, Norway), which is a large-scale research laboratory licensed to carry out challenge trials with Âsh pathogens Before Ârst feeding, un-vaccinated fry from each family were transported as separate groups to VESO Vikan The Âsh had then a weight of 1746 Aquaculture Research, 2011, 42, 1745^1751 0.15^0.20 g The 200 families were challenged in separate tanks of10 L, and the number of Âsh from each family varied from 75 to137 In total, mortalities from IPN were registered on 22182 Âsh A pre-challenge of rainbow trout fry was performed to see if they were susceptible to the IPNV isolate V1244 (results not shown) The inoculum originated from a clinical case of IPN in Atlantic salmon postsmolts in Nord-Trệndelag in 2001, and virus was propagated to sucient quantity using standard cell culture methods at the Norwegian School of Veterinary Sciences, Oslo, Norway The strain carries putative genomic virulence marker motifs (Santi, Vakharia & Evensen 2004), and has been veriÂed as highly virulent in Atlantic salmon fry challenge experiments This isolate has been used in challenge tests with Atlantic salmon both in fry and post-smolts (Ramstad, Romstad, Knappskog & Midtlyng 2007; Storset et al 2007) The isolate was re-isolated from rainbow trout gonad (RTG-2) cells after passage through smolts by The Norwegian School of Veterinary Science and propagated as described by Song, Santi, Evensen andVakharia (2005) The challenge test started after Ârst feeding and days of acclimatization Fish were challenged using a standard bath challenge (Taksdal, Stangeland & Dannevig 1997) with a titre of 1.4 105 TCID50 mL At time of challenge the water Êow was stopped in all tanks The water was aerated and the water level was lowered to approximately 1.4 L The IPNV was added to produce the concentrations given above Normal water Êow was resumed after h of bath challenge At normal Êow, the water Êow was minimum 0.7 L tank The fry were fed manually twice a day (ad libitum) The challenge test lasted 35 days Water temperature was 12 1C The level of oxygen in the incoming water was logged Mortality was registered on a daily basis and all Âsh that were not sampled for veriÂcation of IPN diagnosis were destroyed immediately To study the repeatability of the test, three of the families were challenged in four replicates The replicates were randomly placed in the test facility Samples from 40 randomly chosen tanks were taken for veriÂcation of IPN diagnosis by using IPNV Ag ELISATM Testline (TEST-LINE, Clinical Diagnostics, Brno, Czech Republic) (Rodaỉk, Posp|Ô sil,Tomaỉnek, Vesely, Obr & Vajicek 1988) Statistical analyses Although IPN resistance was deÂned as a binary trait, dead or alive, the trait is assumed to be poly- r 2011 Blackwell Publishing Ltd, Aquaculture Research, 42, 1745^1751 Aquaculture Research, 2011, 42, 1745^1751 Breeding for IPN-resistance in rainbow trout M Wetten et al genic This underlying continuous variable is often called the liability trait (Falconer & Mackay 1996) and is the justiÂcation for the use of a linear model Several studies on statistical analyses of challenge test data have been reported (Gitterle, ềdegễrd, Gjerde, Rye & Salte 2006; ềdegễrd, Olesen, Gjerde & Klemetsdal 2006, 2007; Kettunen, Serenius & Fjalestad 2007) Models considering test period survival (both linear and threshold models), test-day survival (linear repeatability) and time until death taking censoring into account (Cox and Weibull proportional hazard frailty) have been evaluated The general conclusions from these studies were that all models have a high correlation between rankings of families A linear model, as used in this paper, will therefore also give the best families the highest breeding values Also, the use of a linear model would simplify the estimation of the genetic correlation between body weight and IPN resistance The variance components were estimated with REML method using the average information algorithm by DMU package (Madsen & Jensen 2008) A bivariant linear animal model was Âtted Following model was used for both IPN resistance and body weight: common environment for full-sibs due to separate rearing of full-sib families before tagging, maternal effects and non-additive eĂects common to full-sibs For IPN the tank eĂect also include the eĂect of tank in the challenge test The heritability (h2) for resistance to IPN and weight was estimated as h2 ẳ s2A =s2A ỵ s2T ỵ s2E ị where s2A is an estimate of the additive variance in the population (animal eĂect), s2T is an estimate of the variance caused by tank eĂects and s2E is an estimate of the residual variance Heritability of IPN was adjusted to the underlying liability scale (hu2) using the method of Robertson and Lerner (1949): h2u ẳ h2 ẵp1 pị=z2 where hu2 is the heritability on the underlying liability scale, p is the proportion of aĂected Âsh, z is the height of the standard normal curve at the threshold point The tank eĂect was estimated as the proportion of variance due to the tank eĂect Y ij ẳ mean ỵ tankj ỵ animali ỵ residualij where Yij is the observation on animal i within full-sib group j; tankj is the random eĂect of full-sib group j; animali is the random additive genetic eĂect of the animal i; residualij is the random residual for Âsh i The animal eĂects were assumed to be $ N(0,As2A), the common full-sib eĂect were assumed to be $ N(0,Is2T) and the residuals were assumed to be $ N(0,Is2E) The tank eĂect includes the eĂect of Results Challenge tests The accumulated mortality curve for all Âsh in the fry challenge test is given in Fig As can be seen from the graph, the daily mortalities are constant after around days after infection At the termination of the test the overall mortality was 26.3% Cummulative mortality (%) 30 25 20 15 10 5 11 13 15 17 19 21 23 25 27 29 31 33 Day post challenge 35 Figure Cumulative mortality (percentage) in the infectious pancreatic necrosis challenge test for rainbow trout r 2011 Blackwell Publishing Ltd, Aquaculture Research, 42, 1745^1751 1747 Breeding for IPN-resistance in rainbow trout M Wetten et al Figure provides the mortality in each of the 200 families in the challenge test, sorted by mortality As can be seen from the Âgure, there was a large variation in mortality between the diĂerent families, with the within family mortality ranging from 0% to 87% The horizontal line in the Âgure gives the overall mortality in the test Aquaculture Research, 2011, 42, 1745^1751 Discussion The results presented here demonstrate that a challenge test for IPN resistance developed for Atlantic salmon also can be used for the breeding population of rainbow trout investigated in this study IPN resistance in rainbow trout was found to be a moderately heritable trait, and the trait has therefore potential for genetic improve- Repeatability of the challenge test Table provides the mean mortality for the three families in the challenge test that were replicated four times each The results demonstrate a good repeatability of the test Body weight Mean body weight at the time of registration was 61.7 g, with a standard deviation of 16.2 g Note that individual body weight was registered on full-sibs of the Âsh in the IPN challenge test Table Mortalities (%) in the three replicated families, each family with four replicates Replicate Family Family Family 43 15 28 17 35 15 40 13 Table Variance components with standard errors (SE), heritabilities on the observed and underlying scale and the proportion of variance caused by the tank estimated for both IPN resistance and body weight Genetic analyses Table provides the variance components estimated from the statistical analyses.The heritability for IPN resistance was estimated to be moderate and the heritability of body weights was high When transformed to the underlying liability scale, the heritability for IPN resistance increased to 0.55 The variance due to the common environment (tank eĂect) was small for both traits (Table 2) The genetic correlation between IPN resistance and body weight was 0.20 ( ặ 0.10) IPN Body weight Parameters Estimate SE Estimate SE Genetic variance (s2A) Tank variance (s2T) Residual variance (s2E) Heritability observed scale Heritability underlying scale Proportion of variance caused by tank 0.06 0.01 0.13 0.30 0.55 0.04 118.26 8.58 134.70 0.45 0.01 0.00 0.01 18.17 3.03 9.30 0.03 100 Overall mortality 90 80 Mortality (%) 70 60 50 40 30 20 10 11 21 31 41 51 61 71 81 91 101 111 121 131 141 151 161 171 181 191 Family (sorting number) Figure The distribution of mortalities in the families in the infectious pancreatic necrosis challenge test 1748 r 2011 Blackwell Publishing Ltd, Aquaculture Research, 42, 1745^1751 Aquaculture Research, 2011, 42, 1745^1751 ment by selection The genetic correlation between IPN resistance and body weight of sib groups recorded seven months after fertilization was found to be low From the genetic analyses it was found that around 30% of the variance in IPN resistance was due to genetic eĂects From studies in Atlantic salmon, the heritabilities for IPN resistance have been reported to be 0.31using a linear animal model based on challenge data (Wetten et al 2007) and from 0.07 to 0.56 using a reduced animal model based on Âeld data (Guy et al 2009) This is the Ârst reported study of genetic variation in IPN resistance after a controlled challenge test in rainbow trout One challenge of using controlled testing for breeding purposes is the prediction of how the results could improve survival in the Âeld Correlations in mortalities between experimental tests and natural Âeld outbreaks have not yet been published in rainbow trout In Atlantic salmon, Wetten et al (2007) described how the results from commercial tests were validated by natural Âeld outbreaks both in Ângerlings and post-smolts They reported genetic correlations between IPNV challenge test data and Âeld mortality data in the range of 0.78^0.83 The high genetic correlation implies that an IPNV challenge test on fry serves as a good predictor for IPN Âeld mortality during both the juvenile stage and in post-smolts in Atlantic salmon Similarly, Gjệen, Refstie, Ulla and Gjerde (1997) reported a high genetic correlation between resistance to furunculosis in a challenge test and survival during a Âeld outbreak in Atlantic salmon Further, Storset et al (2007) described how the same ranking of low resistant and high resistant groups of Atlantic salmon was demonstrated in a fry test and a smolt test when full-sibs were challenged to IPNV Their report also veriÂes a positive eĂect of selection based on challenge-tests in the fry-stage on resistance at later life-stages In Atlantic salmon, the virulence of IPNV serotype Sp strains can be classiÂed as virulent, moderately virulent, or low virulent, depending on two major outer capsid protein (VP2) residues 217 and 221 (Song et al 2005) Previous challenge experiments in Atlantic salmon have demonstrated that the most IPN susceptible Aqua Gen families are aĂected by virulent strains only, whereas moderately virulent strains give very low mortality in Âsh from the Aqua Gen breeding population (Santi et al 2004; Song et al 2005) The IPNV isolate used in the challenge test of this study has been classiÂed as virulent in Atlantic salmon Results from Âeld outbreaks, however, indicate that strains non-virulent for Atlantic salmon Breeding for IPN-resistance in rainbow trout M Wetten et al could be highly virulent for rainbow trout (Nina Santi, pers comm.) A further development of the IPNV challenge test for rainbow trout could therefore be to challenge Âsh by other strains of IPNV However, the survival of the fry in a challenge study of such duration would mainly depend upon the activation of the innate immune system (Dorson, De Kinkelin & Torchy 1992; Tatner 1996; Ellis 2001), and it is thus expected that the genetic resistance should be eĂective against a range of diĂerent IPNV isolates The potential to improve resistance to IPN also depends on the genetic correlations between IPN and other traits in the breeding programme In the present study, the genetic correlation between IPN resistance and weight at the smolt stage was found to be small and negative but with a large standard error The standard error of the estimate could be larger than expected since body weights and IPN resistance were not registered on the same Âsh, but on full-sibs However, in the breeding programme, breeding values for the selection candidates are estimated based on their own record of body weight, and records on mortalities from full-sibs So for breeding purposes, this correlation is relevant From the literature, genetic correlations between growth and disease resistance have been reported to be both zero and unfavourable Leeds, Silverstein,Vallejo, Palti, Rexroda III, Evenhuis, Hadidi, Weber, Welch and Wiens (2009) studied response to selection on bacterial cold water disease resistance in rainbow trout and found no signiÂcant genetic correlation between the disease and body weights However, Henryon, Jokumsen, Berg, Lund, Pedersen, Olesen and Slierendrecht (2002) reported unfavourable correlations ( 0.14 to 0.33) between the predicted breeding values for resistance to viral haemorrhagic septicaemia in rainbow trout and the predicted breeding values for body weight, body length and feed conversion eciency A challenge in breeding for genetic resistance to diseases is that the trait is only scored as two categories, dead or alive However, if the date of death is also registered, the number of statistical methods for evaluating such data is increased For breeding purposes, the correct ranking of the families is imperative as well as the possibility to estimate genetic correlations between the traits of importance Several papers evaluating statistical methods for analyses of binary data conclude that the ranking of families are the same when diĂerent models including linear models are used (Gitterle et al 2006; ềdegễrd et al 2006) r 2011 Blackwell Publishing Ltd, Aquaculture Research, 42, 1745^1751 1749 Breeding for IPN-resistance in rainbow trout M Wetten et al A successful breeding programme for increased resistance may not only reduce the number of infected Âsh at any time, but at the same time also reduce the risk of susceptible Âsh being infected The number of susceptible individuals in the population plays an important role in determining the level of herd or Êock immunity, which in turn determines whether an organism can survive in the population Flock immunity can be demonstrated when just a portion of a population is vaccinated and when this portion provides protection to unvaccinated animals as well (Martin, Meek & Willeberg 1987) There are reasons to believe that selection for increased IPN resistance also will reduce the number of healthy carriers in the population Aqua Gen has in their brood Âsh found a much lower frequency of IPNV carriers in brood Âsh selected for increased resistance to IPN than in brood Âsh not selected for this trait (Nina Santi, pers comm.) If the number of healthy carriers is reduced, this could possibly reduce the infection pressure on both farmed and wild Âsh Breeding from survivors of a commercial challenge is considered unacceptable, because of the risk of introducing IPNV into hatcheries, and also because of the chance of using infected carriers as brood Âsh However, by challenging full-sibs of the brood Âsh, it is possible to selection on brood Âsh that remain unchallenged This method has already been proven to be very successful in Atlantic salmon (Wetten et al 2007) Although a selection programme based on challenge testing and possibly selection on several other traits simultaneously does not allow for rapid development of resistant strains, the accumulated improved resistance over generations can be substantial References Dorson M., De Kinkelin P & Torchy C (1992) Interferon synthesis in rainbow trout fry following infection with infectious pancreatic necrosis virus Fish and ShellÂsh Immunology 2, 311^313 Ellis A.E (2001) Innate host defence mechanisms of Âsh against viruses and bacteria Developmental and Comparative Immunology 25, 827^839 Falconer D.S & Mackay T.F.C (1996) Introduction to Quantitative Genetics, 4th edn Longman Group, Essex, UK GitterleT., ềdegễrd J., Gjerde B., Rye M & Salte R (2006) Genetic parameters and accuracy of selection for resistance to White Spot Syndrome Virus (WSSV) in Penaeus (Litopenaeus) vannamei using diĂerent statistical models Aquaculture 251, 210^218 1750 Aquaculture Research, 2011, 42, 1745^1751 Gjệen H.M., Refstie T., Ulla O & Gjerde B (1997) Genetic correlations between survival of Atlantic salmon in challenge and Âeld tests Aquaculture 158, 277^288 Guy D.R., Bishop S.C., Brotherstone S., Hamilton A., Roberts R.J., McAndrew B.J & Woolliams J.A (2006) Analysis of the incidence of infectious pancreatic necrosis mortality in pedigreed Atlantic salmon, Salmo salar L, populations Journal of Fish Diseases 29, 637^647 Guy D.R., Bishop S.C., Woolliams J.A & Brotherstone S (2009) Genetic parameters for resistance to infectious pancreatic necrosis in pedigreed Atlantic salmon (Salmo salar) post-smolts using a reduced animal model Aquaculture 290, 229^235 Henryon M., Jokumsen A., Berg P., Lund I., Pedersen P.B., Olesen N.J & Slierendrecht W.J (2002) Genetic variation for growth rate, feed conversion eciency, and disease resistance exists within a farmed population of rainbow trout Aquaculture 209, 59^76 Kettunen A., Serenius T & Fjalestad K.T (2007) Three statistical methods for genetic analysis of disease resistance against vibriosis in Atlantic cod (Gadus morhua L) Journal of Animal Science 85, 305^313 Leeds T.D., Silverstein J.T., Vallejo R.L., Palti Y., Rexroda C.E III, Evenhuis J., Hadidi S., Weber G.M., Welch T.J & Wiens G.D (2009) Response to selection for bacterial cold water disease resistance in rainbow trout (abstract) The10th International Symposium on Genetics in Aquaculture 22^26 June 2009,Thailand Madsen P & Jensen J (2008) A Users Guide to DMU.Version 6, Release 4.7 Faculty of Agricultural Science, Department of Genetics and Biotechnology, University of Aarhus, Aarhus, Denmark Martin S.W., Meek A.H & Willeberg P (1987) Descriptive epidemiology In: Veterinary Epidemiology (ed by J.-P Vaillancourt), pp 79120 Iowa State University Press, Ames, IA, USA ềdegễrd J., Olesen I., Gjerde B & Klemetsdal G (2006) Evaluation of statistical models for genetic analysis of challenge test data on furunculosis resistance in Atlantic salmon (Salmo salar): prediction of Âeld survival Aquaculture 266,70^76 ềdegễrd J., Olesen I., Gjerde B & Klemetsdal G (2007) Evaluation of statistical models for genetic analysis of challenge-test data on ISA resistance in Atlantic salmon (Salmo salar): prediction of progeny survival Aquaculture 266,70^76 Okamoto N.,Tayama T., Kawanobe M., Fujiki N.,Yasuda Y & Sano N (1993) Resistance of a rainbow trout strain to infectious pancreatic necrosis Aquaculture 117,71^76 Ramstad A., Romstad A.B., Knappskog D.H & Midtlyng P.J (2007) Field validation of experimental challenge models for IPN vaccines Journal of Fish Diseases 30, 723^731 Robertson A & Lerner I.M (1949) The heritability of all-or-none traits; viability of poultry Genetics 34, 395^411 r 2011 Blackwell Publishing Ltd, Aquaculture Research, 42, 1745^1751 Aquaculture Research, 2011, 42, 1745^1751 Roberts R.J & Pearson M.D (2005) Infectious pancreatic necrosis in Atlantic salmon, Salmo salar L Journal of Fish Diseases 28, 383^390 Rodaỉk L., Posp|Ô sil Z.,Tomaỉnek J.,Vesely T., Obr T & Vajicek L (1988) Enzyme-linked immunosorbent assay (ELISA) for the detection of infectious pancreatic necrosis virus (IPNV) in culture Êuids and tissue homogenates of the rainbow trout, Salmo gairdneri Richardson Journal of Fish Diseases 11, 225^235 Santi N.,VakhariaV N & Evensen ề (2004) IdentiÂcation of putative motifs involved in the virulence of infectious pancreatic necrosis virus.Virology 322, 31^40 Song H., Santi N., Evensen O & VakhariaV.N (2005) Molecular determinants of infectious pancreatic necrosis virus virulence and cell culture adaptation Journal of Virology 79, 10289^10299 Storset A., Strand C., Wetten M., Kjệglum S & Ramstad A (2007) Response to selection for resistance against infec- Breeding for IPN-resistance in rainbow trout M Wetten et al tious pancreatic necrosis in Atlantic salmon (Salmo salar, L.) Aquaculture 272, 62^68 Taksdal T., Stangeland K & Dannevig B.H (1997) Induction of infectious pancreatic necrosis (IPN) in Atlantic salmon Salmo salar and brook trout Salvelinus fontinalis by bath challenge of fry with infectious pancreatic necrosis virus (IPNV) serotype Sp Diseases of Aquacultured Organisms 28, 39^44 Tatner M.F (1996) Natural changes in the immune system of Âsh In: Fish Physiology,Vol.15 (ed by S Hoar, D.J Randall & A.P Farrell), pp 255^287 Academic Press, San Diego, CA, USA Wetten M., Aasmundstad T., Kjệglum S & Storset A (2007) Genetic analysis of resistance to infectious pancreatic necrosis in Atlantic salmon (Salmo salar L.) Aquaculture 272, 111^117 r 2011 Blackwell Publishing Ltd, Aquaculture Research, 42, 1745^1751 1751 Aquaculture Research, 2011, 42, 1752^1763 doi:10.1111/j.1365-2109.2010.02772.x Effects of low dietary protein level on serum oestradiol, testosterone and sex reversal in rice field eel, Monopterus albus (Zuiew) Hanwen Yuan1, Shiyuan Gong1, Zhangjie Chu2, Guobin Zhang1,Yongchao Yuan1,Wenjie Gong1 & Jianlin Yan1 College of Fisheries, Key Lab of Agricultural Animal Genetics, Breeding and Reproduction of Ministry of Education, Huazhong Agricultural University,Wuhan, Hubei, China Zhejiang Ocean University, Zhoushan, Zhejiang, China Correspondence: Shiyuan Gong, College of Fisheries, Huazhong Agricultural University,Wuhan, Hubei Province 430070, China E-mail: gsy@mail.hzau.edu.cn Abstract Introduction We investigated the eĂects of low dietary protein in isocaloric diets on sex reversal of Monopterus albus by evaluating the oestradiol (E2) and testosterone (T) concentrations, gonadosomatic index (GSI), sex ratio and gonad structure at the histological level Fish (9.50 ặ 1.50 g average initial weight; n per group) were fed with Âve practical diets containing 100, 150, 200, 250 or 400 g kg crude protein to apparent satiation for 15 months Serum E2 and T concentrations were determined by radioimmunoassays E2 concentrations and GSI signiÂcantly increased while T concentrations decreased as the dietary protein level was raised Fish fed 400 g kg of dietary protein had signiÂcantly higher E2 concentrations and GSI than those fed with lower dietary protein levels The Tconcentrations of Âsh fed 100 g kg of dietary protein was signiÂcantly higher than that of Âsh fed higher dietary protein levels The shift of sex ratio towards more male and intersex Âsh was observed with decreasing dietary protein levels Therefore, low dietary protein level may promote sex change from female to male in M albus This study provides important information for successful reproductive management and may be exploited for aquaculture of this species The rice Âeld eel, Monopterus albus, taxonomically belongs to the teleosts, the family Synbranchidae of the order Synbranchiformes (Neoteleostei, Teleostei, Vertebrata), and is also the only representative species of the group of Synbranchidae in China It inhabits mainly China, Japan and Southeast Asia (Li, Liao, Yu, Cheng & Tong 2007), but it can also be found in Northern Australia and Southeastern United States (Collins, Trexler, Nico & Rawlings 2002) This fresh water Âsh is an economically important species in Southeast Asia Owing to its unique characteristics, such as relative small genome size and natural sex reversal from female via intersex into male during its life span, it is a good model for studying vertebrates in comparative genomics, evolution and developmental biology, especially in sexual development (Zhou, Cheng & Tiersch 2002) The rice Âeld eel is a protogynous hermaphrodite, strictly changing its sex unidirectionally from functional female to male naturally during development Moreover, the intersex gonads are found during its growth for an extended period of time (Liem 1963; Chan & Philips1967; Liem1968) The breeding season is from May to August The rice Âeld eels spend or more years reaching puberty under natural ambient conditions, which are all females in the beginning After spawning they normally begin to change sex from female to intersex and then Ânally to male The eels may not develop into mature functional males Keywords: Monopterus albus, low dietary protein level, oestradiol, testosterone, gonadosomatic index, sex reversal 1752 r 2011 Blackwell Publishing Ltd Aquaculture Research, 2011, 42, 1752^1763 EĂects of low dietary protein level in M albus H Yuan et al until they are more than years old In fact, females of more than years old have been found in the natural population (Xiao 1995; Yang, Chen, Ruan & Su 2008) These special characteristics have made the rice Âeld eel an ideal species for the study of sex determination and diĂerentiation (Zhou, Cheng, Zhang, Guo, Cooper & Tiersch 2002) Since the discovery of natural sex reversal in rice Âeld eels in 1944 (Liu 1944), some eĂorts have been made to uncover the mechanism underlying the process in this species from both the physiological and biochemical perspective (Liu & Ku 1951; Chan,Wai,Tang & Lofts 1972; Liu, Wan, Su, Zhang & Han 1987; Yeung & Chan 1987; Liu, Cui,Wang & Chen 1990; Tao, Lin, Kraak & Peter 1993; Yeung, Chen & Chan 1993a, b; Fan, Cai, Lin & Zhang 1999; Zou 2000), at the cytological level (Xiao 1993, 1995; Xiao & Liu 1995) and at the molecular level (Lu, Cheng, Guo & Zhou 2003; Wang, Cheng, Xia, Guo, Huang & Zhou 2003; Yu, Cheng, Guo, Xia & Zhou 2003; Zhou, Liu, Guo, Yu, Cheng, Huang, Tiersch & Berta 2003; Xia, Cheng, Yu, Guo & Zhou 2004; Huang, Guo, Shui, Gao, Yu, Cheng & Zhou 2005; Jang, Zhou, Xia, Zhao, Cheng & Zhou 2006) However, the detailed mechanism of sex reversal of this species remains unclear Because of overÂshing, environmental destruction or other unknown factors, the resources of rice Âeld eels have drastically decreased over the past few decades in China (He, Liu, Guo, Jin & Zhang 2004;Yin, Li, Zhou & Liu 2005), artiÂcial propagation and breeding is an eĂective means for supplementing the natural resources To date, the farming scale of this species is limited by scarcity of the eel fry since large-scale artiÂcial propagation and breeding is hindered by the shortage of mature male broodstock and low absolute fecundity Therefore, studies designed to understand the process of sex reversal in Âsh with low absolute fecundity will be important role for the breeding industry Some studies have been conducted on genetic variation and population diĂerentiation of the species (Liu, Wang, Zeng, Luo & Han 2005; Yang, Zhou, Zhang & Li 2005; Li et al 2007) Liem (1963) presumed that adverse environmental factors such as intermittent drought and food shortage may promote sex change of rice Âeld eel Shi, Lin & Tang (1998) reported that long-term (6 weeks) starvation improved the sex change process in the species Thus far, little is known about the eĂect of low protein levels on sex reversal of rice Âeld eel In the present study, we propose that a low dietary protein level promotes sex change from female to male in protogy- nous rice Âeld eel The objectives of our study were to evaluate the serum oestradiol (E2), testosterone (T) concentrations and sex reversal of M albus fed with a low protein diet This study should provide useful information to obtain sucient numbers of suitable males for successful reproductive management and eventual increase of the species in the farming industry Materials and methods Diet preparation Five experimental diets containing 100, 150, 200, 250 or 400 g crude protein per kg were formulated (Table1).White Âshmeal and soybean meal were used as protein sources, Âsh oil as a lipid source and Table Ingredients used in the preparation of experimental diets and their estimated nutrient and energy contents (400 g kg protein level was used as the control diet) Dietary protein levels (g kg 1) 100 150 200 250 400 Ingredients (g kg 1) American white fishmeal 20 100 180 260 500 Soybean meal 120 120 120 120 120 a-starch 500 460 420 380 260 Wheat bran 180 160 140 120 60 Rice bran 120 100 80 60 Fish oil 12 10 Vitamin premixw 5 5 Mineral premixz 20 20 20 20 20 Binder (CMC) 23 25 27 29 35 Proximate analysis (g kg of dry matter basis) Crude protein 108.5 154.6 200.7 246.7 384.9 Crude lipid 39.7 38.5 37.2 35.9 32.1 Crude ash 216 230.5 244.9 259.3 302.6 Energy (kJ g 1)z 13.07 13.06 13.04 13.03 12.98 P:Ek 8.3 11.8 15.4 18.9 29.7 FeedstuĂs not mentioned here are the same feedstuĂs currently used by the domestic aquaculture feed companies Produced by Premier PaciÂc Seafood, USA wContains (g kg unless otherwise speciÂed): vitamin A, 65000 IU; vitamin D3, 45000 IU; vitamin E, 25; vitamin K3, 5; vitamin B1, 12.5; vitamin B2, 12.5; vitamin B6, 15; vitamin B12, 0.025; DL -calcium pantothenate, 40; niacin, 50; folic acid, 2.5; biotin, 0.08; inositol, 75; ascorbic acid, 120 zContains (as g kg in diet): Ca, 100; P, 50; K, 30; Na, 20; Mg, 10; Fe, 22; Zn, 3; Mn, 3; Cu, 1.8; Co, 0.15; I, 0.12; Se, 0.05 Mean values from three replicates zComputed as 16.7 kJ g protein and carbohydrate and 37.6 kJ g lipid kProtein to energy ratio in mg kJ CMC, carboxymethyl cellulose r 2011 Blackwell Publishing Ltd, Aquaculture Research, 42, 1752^1763 1753 Aquaculture Research, 2011, 42, 1890^1894 doi:10.1111/j.1365-2109.2010.02777.x SHORT COMMUNICATION Molecular identification of hybrids between Neotropical catfish species Pseudoplatystoma corruscans and Pseudoplatystoma reticulatum Fernanda Dotti Prado1, Diogo Teruo Hashimoto1, Fernando Fernandes Mendonca2, JoseÔ Augusto Senhorini3, Fausto Foresti2 & Fabio Porto-Foresti1 Departamento de Ciencias BioloÔgicas, Faculdade de Ciencias, Campus de Bauru, Universidade Estadual Paulista (UNESP), Bauru, SP, Brazil Departamento de Morfologia, Instituto de Biociencias, Campus de Botucatu, Universidade Estadual Paulista (UNESP), Botucatu, SP, Brazil Centro Nacional de Pesquisa e Conservacaỡo de Peixes Continentais, CEPTA/ICMBio, Pirassununga, SP, Brazil Correspondence: F Porto-Foresti, Departamento de Ciencias BioloÔgicas, Faculdade de Ciencias, Campus de Bauru, Universidade Estadual Paulista (UNESP), CEP 17033-360, Bauru, SP, Brazil E-mail: fpforesti@fc.unesp.br CatÂsh species Pseudoplatystoma corruscans (pintado) and Pseudoplatystoma reticulatum (cachara) constitute large-size migratory Âsh species of high commercial value and ecological importance, and are widely distributed in South American hydrographic basins (Buitrago-Suarez & Burr 2007) Hybrids between these species have been produced in several Brazilian hatcheries (Godinho 2007; Porto-Foresti, Hashimoto, Alves, Almeida, Senhorini, Bortolozzi & Foresti 2008), mainly with an intention to obtain individuals that present commercial advantages Besides the fact that the production of these Âsh species has already become a large-scale practice in Âsh farms, a lack of rigid control and monitoring of production and management is observed Otherwise, the possibility of genetic contamination of native and cultured stocks can be pointed out as serious problems involving the process when the production and commercialization of hybrids are carried out in the places of parental native species occurrence (Toledo-Filho, Almeida-Toledo, Foresti, Calcagnotto, Santos & Bernardino 1998) As escapes of individuals produced in Âsh farms into the natural environment are very frequent (Orsi & Agostinho 1999), the occurrence of ecological disequilibrium (Einum & Fleming 1997), genetic introgression and even the extinction of native species may occur (Allendorf, Leary, Spruell 1890 & Wenburg 2001; Epifanio & Philipp 2001) In this case, beyond the harmful environmental eĂects of hybridization, the loss of the native genetic pool of distinct parental species may preclude the development of future breeding programmes and the commercial production of these species The identiÂcation of pure parental species and hybrids is an essential step in order to provide tools for the proper management of these animals and avoid the risks they represent (Toledo-Filho, Almeida-Toledo, Foresti, Bernardino & Calcagnotto 1994) However, two main facts can be pointed out to reinforce the diculties in the control and management of Âsh production, as Âsh are commercialized when they are still juveniles and morphological identiÂcation is difÂcult and mostly imprecise In such a context, genetic methodologies can provide diagnostic molecular markers to identify, in a clear and accessible way, parents and hybrids (Young, Ostberg, Keim & Thorgaard 2001; Hashimoto, Mendonca, Senhorini, Bortolozzi, Oliveira, Foresti & Porto-Foresti 2009) Hybrids between P corruscans and P reticulatum have already been captured in nature, probably due to escapes from hatcheries These Âsh were shown to be fertile and were able to back-cross with the parental species in captivity (J A Senhorini, pers comm.), thus reinforcing the necessity of adequate monitor- r 2011 Blackwell Publishing Ltd Aquaculture Research, 2011, 42, 1890^1894 Molecular identiÂcation of catÂsh hybrids F D Prado et al ing and control of the hybrids Hence, the main purpose of the present study was to develop molecular markers using the multiplex-polymerase chain reaction (PCR) and PCR-restriction fragment length polymorphism (RFLP) protocols for the identiÂcation of the parental species P corruscans and P reticulatum and their reciprocal interspeciÂc hybrids Sequencing Materials and methods In the analysis of the parental lineages, 50 individuals of P corruscans and 50 specimens of P reticulatum were genetically analysed For the interspeciÂc hybrid lineages, 40 specimens of pintachara (crosses using P corruscans as females and P reticulatum as males) and 40 individuals of cachapinta (crosses using P reticulatum as females and P corruscans as males) were analysed All assessed samples were obtained from the stock maintained at the Centro Nacional de Pesquisa e Conservacaỡo de Peixes Continentais, Instituto Chico Mendes da Conservacaỡo de Biodiversidade (CEPTA/ICMBio, Pirassununga, SP, Brazil), where the hybrids were produced Members of the parental stocks of P corruscans and P reticulatum were captured in the Paraguay River (Paraguay River basin) The Âsh specimens were identiÂed and stored in the collection of the Laboratory of Fish Genetics, UNESP, Bauru (SP), Brazil Partial sequences of the nuclear recombination activating gene (RAG2) and mitochondrial ribosomal 16S genes were isolated, respectively, with the primer pairs RAG2 SiluF and RAG2 SiluR, designed using as a template a sequence of the species Phractocephalus hemioliopterus (GenBank accession no DQ492364) and universal primers 16S F and 16S R (Palumbi 1996) (Table 1) DNA sequencing was analysed on an ABI PrismTM 377 DNA Sequencer (Perkin-Elmer, Sao Paulo, Brazil), using the DYEnamic Terminator Cycle Sequencing kit (Amersham Biosciences, GE Healthcare, Sao paulo, Brazil) with the forward and reverse primers for each gene PCR-RFLP Restriction maps were analysed using the software NEBCUTTER V2.0 (Vincze, Posfai & Roberts 2003) The PCR products were digested by restriction enzymes in a Ânal volume of mL containing mL of PCR products, enzyme buĂer and units of restriction enzyme (10 U/mL) (New England Biolabs, Uniscience Brasil, Saỡo Paulo, Brazil) Reactions were incubated according to the ideal temperature of each enzyme for h Multiplex-PCR DNA extraction DNA extraction was based on the commercial kit protocol Wizard Genomic DNA PuriÂcation Kit ^ Promega (Prodimol Biotecnologia, Belo Horizonte, Minas Gerais Brazil) DNA quantity was determined against a molecular marker standard (Low DNA Mass Ladder ^ Invitrogen, Life Technologies, Sao Paulo, Brazil) by electrophoresis in a 1% agarose gel Sequences were aligned using the CLUSTALW program (Thompson, Higgins & Gibson 1994), which was implemented in the BIOEDIT program (Hall 1999) Primer conditions were analysed using the NETPRIMER software available in the PREMIER Biosoft International site hhttp://www.premierbiosoft.com/netprimeri SpeciesspeciÂc primers (RAG2 PcR and 16S PcF for P corruscans, and RAG2 PrR and 16S PrR for P reticulatum) Table Sequences of the primers and polymerase chain reaction (PCR) conditions used to amplify given gene fragments Gene Primer sequence RAG2 SiluF RAG2 SiluR 16S F 16S R RAG2 PcR RAG2 PrR 16S PcF 16S PrR CCTGAGTGCTACCTTATTCATGGA CTTGGGAGGAAGAGACCATC ACGCCTGTTTATCAAAAACAT CCGGTCTGAACTCAGATCACGT AACTCCAGGTCAATGAGATAAATG CAGTTCCAGGTCTCTGTGGTT TGACCATAAAGATCCGGCTAT TCTTGGTTTTGGGGTTGTTA PCR conditions 95 1C/5 min; 95 1C/30 s, 50 1C/45 s, 72 1C/15 s (35 repetitions); 72 1C/7 95 1C/5 min; 95 1C/30 s, 58 1C/45 s, 72 1C/10 s (35 repetitions); 72 1C/7 Listed from to 0, Silu, Siluriformes; F, forward; R, reverse; Pc, Pseudoplatystoma corruscans; Pr, Pseudoplatystoma reticulatum r 2011 Blackwell Publishing Ltd, Aquaculture Research, 42, 1890^1894 1891 Molecular identiÂcation of catÂsh hybrids F D Prado et al Aquaculture Research, 2011, 42, 1890^1894 were designed internal to the universal primers to produce fragments of diĂerent sizes for each species in the multiplex-PCR (Table 1) Polymerase chain reaction conditions and primer sequences are given in Table All PCR reactions were performed in a total volume of 25 mL containing 150 mM of each dNTP (dATP, dTTP, dGTP and dCTP), 1.5 mM MgCl2, Taq DNA buĂer (20 mM Tris-HCl, pH 8.4 and 50 mM KCl), 0.5 unit of Taq Polymerase (Invitrogen), 0.2^0.4 mM of each primer and 10^ 50 ng of genomic DNA DNA fragment sizes were determined by electrophoresis on1.5% agarose gels that were stained with ethidium bromide (1ng/mL), visualized under UV illumination and captured by a digital camera (OLYMPUS, CAMEDIA, C-5060 5.1 Megapixel, Sao Paulo, Brazil) The RAG2 nuclear gene ampliÂcation with RAG2 Silu F and RAG2 Silu R primers revealed fragments of approximately 550 bp in the parental lineages and hybrids analysed Enzymatic restriction revealed one band of almost 300 bp and another of about 250 bp in P corruscans while P reticulatum maintained a single band of approximately 550 bp Both hybrids showed three bands, two inherited from P corruscans and one of P reticulatum, which allowed its identiÂcation by the heterozygous pattern (Fig.1a) In relation to the mitochondrial 16S gene, ampliÂcation through the universal primers showed bands of approximately 650 bp for all the specimens studied After enzymatic digestion of the samples, P.corruscans maintained a single band of about 650 bp and P reticulatum showed two bands: one of approximately 300 bp and another of about 350 bp The hybrid pintachara revealed the same electrophoretic proÂle of maternal species P corruscans, while the hybrid cachapintashowed the same bands of maternal species P reticulatum (Fig.1b) Results PCR-RFLP Partial sequences of the genes nuclear RAG2 (GenBank accession no HM107836 and HM107838) and mitochondrial 16S (GenBank accession no HM107839 and HM107837) revealed some diĂerences in the nucleotide composition between the parental species Restriction maps obtained from these sequences were used to identify enzymes that had an exclusive cleavage in each parental species In the nuclear gene, four speciÂc enzymes were veriÂed for P corruscans (SfaNI, BsrBI, AvaII e Sau96I) and six for P reticulatum (AciI, BstUI, BsaI, BsmAI, HgaI e AccI) In the mitochondrial gene, one exclusive enzyme was observed for P corruscans (ApoI) and three for P reticulatum (Tsp509I, BpuEI e SmlI) The enzymes Sau96I (speciÂc for the nuclear gene of P corruscans) and SmlI (particular for the mitochondrial gene of P reticulatum) were selected for this study Multiplex-PCR Multiplex ampliÂcation of the RAG2 gene (using primers RAG2 SiluF, RAG2 SiluR, RAG2 PcR and RAG2 PrR) showed one band of about 550 bp, which corresponded to the reaction control, in all samples, and another band that was characteristic for each species, which were almost 330 bp for P corruscans and approximately 290 bp for P reticulatum The hybrids showed a heterozygous pattern with two bands, one inherited from each parental species (Fig 2a) Multiplex-PCR of the mitochondrial 16S gene (using primers 16S F, 16S R, 16S PcF and 16S PrR) showed fragments of approximately 650 bp, which was the reaction control, for all individuals, and characteristic bands for each species, with approximately Figure.1 PCR-RFLP patterns of the RAG2 nuclear gene (a) and the 16S mitochondrial gene (b) Lanes:1^2, Pseudoplatystoma corruscans; 3^4,pintachara; 5^6,cachapinta;7^8, Pseudoplatystoma reticulatum; M, molecular weight marker 1kb 1892 r 2011 Blackwell Publishing Ltd, Aquaculture Research, 42, 1890^1894 Aquaculture Research, 2011, 42, 1890^1894 Molecular identiÂcation of catÂsh hybrids F D Prado et al Figure Multiplex-PCR patterns of the RAG2 nuclear gene (a) and 16S mitochondrial gene (b) Lanes: 1^2, Pseudoplatystoma corruscans; 3^4, pintachara; 5^6, cachapinta; 7^8, Pseudoplatystoma reticulatum; M, molecular weight marker 1kb 200 bp for P corruscans and 400 bp for P reticulatum The hybrid pintachara presented the same electrophoretic pattern of the maternal species P corruscans, while the hybrid cachapinta showed bands equal to the maternal species P reticulatum (Fig 2b) Discussion Molecular techniques have been applied in the worldwide aquaculture, allowing for an adequate management of several cultivated species (Liu & Cordes 2004;Wang, Mao, Chen, Liu & Gui 2009) and providing a huge number of molecular markers that have been applied successfully for hybrid identiÂcation and detecting genetic introgression in Âsh (Perez, Martinez, Moran, Beall & Garcia-Vazquez1999; Scribner, Page & Bartron 2001; Gunnell,Tada, Hawthorne, Keeley & Ptacek 2008; Aboim, Mavarez, Bernatchez & Coelho 2010) The use of PCR-RFLP and multiplex-PCR markers in the present study revealed a distinct molecular pattern among the species P corruscans, P reticulatum and their hybrids, without the occurrence of intraspeciÂc variations The multiplex-PCR presented some advantages when compared with PCR-RFLP, because it requires additional steps of restriction enzyme, eliminating the time and costs associated with buying enzymes However, there may be some diculties and limitations on the design of primers and the speciÂcity or eciency of ampliÂcations In any case, both approaches are eĂective in identifying hybrids between these catÂsh species and can be applied according to the time and reagents available With respect to mitochondrial DNA, it is important to highlight that only with the 16S mitochondrial gene analysis were the reciprocal hybrids pintachara and cachapintadiscriminated through the identiÂcation of the maternal parent This discrimination is ne- cessary, as reciprocal hybrids may present diĂerent biological and zootechnical characteristics (ToledoFilho et al 1998; Porto-Foresti et al 2008) Because of their low cost and little requirements when compared with other molecular techniques, the methodologies developed in this study provide a quick and precise method for the safe identiÂcation of the parental species P corruscans and P reticulatum and the hybrids pintachara and cachapinta Other studies conÂrm the eciency and reliability of PCR-RFLP and multiplex-PCR techniques in the identiÂcation of Âsh species (Teletchea 2009) and hybrids (Padhi & mandal 1997; El-serafy, Abdel-Hameid, Awwad & Azab 2007; Hashimoto et al 2009) It is considered that the present results will help with the development of safe programmes for the suitable management and exploitation of these hybrids in aquaculture and provide a more reÂned compilation of the Âsheries and aquaculture statistical data In addition, these techniques can certainly identify samples that have been processed and prepared for sale and hybrids captured in nature Acknowledgments This work was supported by grants from Fundacaỡo de Amparo aỉ Pesquisa Estado de Saỡo Paulo (FAPESP) and Conselho Nacional de Desenvolvimento Cient|Ô Âco e TecnoloÔgico (CNPq) References Aboim M.A., Mavarez J., Bernatchez L & Coelho M.M (2010) Introgressive hybridization between two Iberian endemic cyprinid Âsh: a comparison between two independent hybrid zones Journal of Evolutionary Biology 23, 817^828 r 2011 Blackwell Publishing Ltd, Aquaculture Research, 42, 1890^1894 1893 Molecular identiÂcation of catÂsh hybrids F D Prado et al Aquaculture Research, 2011, 42, 1890^1894 Allendorf F.W., Leary R.F., Spruell P & Wenburg J.K (2001) The problem with hybrids: setting conservation guidelines Trends in Ecology and Evolution 16, 613^622 Buitrago-Suarez U.A & Burr B.M (2007) Taxonomy of the catÂsh genus Pseudoplatystoma Blecker (Siluriformes:Pimelodidae) with recognition of eight species Zootaxa 1512, 1^38 Einum S & Fleming I.A (1997) Genetic divergence and interactions in the wild among native farmed and hybrid Atlantic salmon Journal of Fish Biology 50, 634^651 El-Serafy S.S., Abdel-Hameid N.H., Awwad M.H & Azab M.S (2007) DNA riboprinting analysis of Tilapia species and their hybrids using restriction fragment length polymorphisms of the small subunit ribosomal DNA Aquaculture Research 38, 295^303 Epifanio J & Philipp D (2001) Simulating the extinction of parental lineages from introgressive hybridization: the eĂects of Âtness, initial proportions of parental taxa, and mate choice Reviews in Fish Biology and Fisheries 10, 339^ 354 Godinho H.P (2007) EstrateÔgias reprodutivas de peixes aplicadas aỉ aqicultura: bases para o desenvolvimento de tecnologias de producaỡo Revista Brasileira Reproduc aỡo Animal 31, 351^360 Gunnell K.,Tada M.K., Hawthorne F.A., Keeley E.R & Ptacek M.B (2008) Geographic patterns of introgressive hybridization between nativeYellowstone cutthroat trout (Oncorhynchus clarkia bouvieri) and introduced rainbow trout (O mykiss) in the South Fork of the Snake River watershed, Idaho Conservation Genetics 9, 49^64 Hall T.A (1999) BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/ 98/NT Nucleic acids Symposium Series 41, 95^98 Hashimoto D.T., Mendonca F.F., Senhorini J.A., Bortolozzi J., Oliveira C., Foresti F & Porto-Foresti F (2009) IdentiÂcation of hybrids between Neotropical Âsh Leporinus macrocephalus and Leporinus elongatus by PCR-RFLP and multiplex-PCR: tools for genetic monitoring in aquaculture Aquaculture 298, 346^349 Liu Z.J & Cordes J.F (2004) DNA marker technologies and their applications in aquaculture genetics Aquaculture 238, 1^37 Orsi L.M & Agostinho A.A (1999) Introducaỡo de espeÔcies de peixes por escapes acidentais de tanques de cultivo em rios da Bacia Rio Parana, Brasil Revista Brasileira de Zoologia 16, 557^560 Padhi B.K & Mandal R.K (1997) Inadvertent hybridization in a carp hatchery as detected by nuclear DNA RFLP Journal of Fish Biology 50, 906^909 Palumbi S.R (1996) Nucleic acids II: the polymerase chain reaction In: Molecular Systematics (ed by D Hillis, C Moritz & B Mable), pp 205^247 Sinauer Associates, Sunderland, UK Perez J., Martinez J.L., Moran P., Beall E & Garcia-Vazquez E (1999) IdentiÂcation of Atlantic salmon X brown trout hybrids with a nuclear marker useful for evolutionary studies Journal of Fish Biology 54, 460^464 Porto-Foresti F., Hashimoto D.T., Alves A.L., Almeida R.B.C., Senhorini J.A., Bortolozzi J & Foresti F (2008) Cytogenetic markers as diagnoses in the identiÂcation of the hybrid between Piaucu (Leporinus macrocephalus) and Piapara (Leporinus elongatus) Genetics and Molecular Biology 31(Suppl.), 195^202 Scribner K.T., Page K.S & Bartron M.L (2001) Hybridization in freshwater Âshes: a review of case studies and cytonuclear methods of biological inference Reviews in Fish Biology and Fisheries 10, 293^323 Teletchea F (2009) Molecular identiÂcation methods of Âsh species: reassessment and possible applications Reviews of Fish Biology and Fisheries 19, 265^293 Thompson J.D., Higgins D.G & Gibson T.J (1994) CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, positions-speciÂc gap penalties and weight matrix choice Nucleic Acids Research 22, 4673^4680 Toledo-Filho S.A., Almeida-Toledo L.F., Foresti F., Bernardino G & Calcagnotto D (1994) Monitoramento e conservac aỡo geneÔ tica em projeto de hibridac aỡo entre pacu e tambaqui Cadernos de IctiogeneÔtica 2, CCS/USP, Saỡo Paulo, SP, Brazil Toledo-Filho S.A., Almeida-Toledo L.F., Foresti F., Calcagnotto D., Santos S.B.A.F & Bernardino G (1998) Programas geneÔ ticos de selec aỡo, hibridac aỡo e endocruzamento aplicados aỉ piscicultura Cadernos de IctiogeneÔtica 4, CCS/USP, Saỡo Paulo, SP, Brazil, 56pp Vincze T., Posfai J & Roberts R.J (2003) NEBcutter: a program to cleave DNA with restriction enzymes Nucleic Acids Research 31, 3688^3691 Wang D., Mao H.L., Chen H.X., Liu H.Q & Gui J.F (2009) Isolation of Y- and X-linked SCAR markers in yellow catÂsh and application in the production of all-male populations Animal Genetics 40, 978^981 Young W.P., Ostberg C.O., Keim P & Thorgaard G.H (2001) Genetic characterization of hybridization and introgression between anadromous rainbow trout (Oncorhynchus mykiss irideus) and coastal cutthroat trout (O clarki clarki) Molecular Ecology 10, 921^930 1894 Keywords: Pseudoplatystoma, interspeciÂc hybridization, species identiÂcation, molecular markers, genetic conservation r 2011 Blackwell Publishing Ltd, Aquaculture Research, 42, 1890^1894 Aquaculture Research, 2011, 42, 1895^1898 doi:10.1111/j.1365-2109.2010.02778.x SHORT COMMUNICATION Evaluation of free radical-generating compounds for toxicity towards the cyanobacterium Planktothrix perornata, which causes musty off-flavour in pond-raised channel catfish (Ictalurus punctatus) N P Dhammika Nanayakkara1 & Kevin K Schrader2 Thad Cochran National Center for Natural Products Research, University of Mississippi, Mississippi, MS, USA United States Department of Agriculture, Agricultural Research Service, Natural Products Utilization Research Unit, University of Mississippi, Mississippi, MS, USA Correspondence: K K Schrader, United States Department of Agriculture, Agricultural Research Service, Natural Products Utilization Research Unit, University of Mississippi, Mississippi, MS 38677-8048, USA Email: kevin.schrader@ars.usda.gov The cyanobacterium (blue^green alga) Planktothrix perornata [Skuja] Anagnostidis and Komarek grows in channel catÂsh Ictalurus punctatus (RaÂnesque) aquaculture ponds in the southeastern United States and produces the mustycompound 2-methylisoborneol (MIB) CatÂsh will rapidly absorb MIB into their Êesh resulting in a musty taint, thereby rendering them unpalatable and unmarketable until MIB is purged Environmentally derived oĂ-Êavours in the channel catÂsh production industry can cost producers as much as US$10^60 million annually because of delayed harvest (Tucker 2000) One approach to manage musty oĂ-Êavour in farm-raised channel catÂsh is the application of algaecides to production ponds to kill or prevent the growth of the undesirable cyanobacteria Currently, only the herbicide diuron (N 0-(3,4-dichlorophenyl)-N,N,-dimethylurea) and copper-based compounds, such as copper sulphate and chelated-copper compounds, are approved by the United States Environmental Protection Agency (USEPA) for use in catÂsh production ponds for managing musty oĂ-Êavour problems caused by P perornata Copper-based products and diuron are limited in their usefulness in controlling P perornata because of their accumulation in the environment, lack of selectivity towards noxious cyanobacteria and the small margin of safety between phytotoxic concentrations and ichthyotoxic concentrations Photosynthetic organisms have evolved complex enzymatic systems to neutralize the potentially toxic and disruptive eĂects of physiologically generated reactive oxygen intermediates (ROI) (e.g H2O2, OH, O2 ) However, H2O2 will inhibit the growth of certain species of cyanobacteria (Samuilov, Bezryadnov, Gusev, Kitashov & Fedorenko 1999) Previous research to discover other algaecidal compounds for use to manage P perornata determined that ROIgenerating molecules, such as paraquat (Schrader, de Regt, Tidwell, Tucker & Duke 1998a), artemisinin (Xiao, Chen, Qu & Liu 2010) and certain quinones (e.g anthraquinone) (Schrader, de Regt, Tidwell, Tucker & Duke 1998b), were highly toxic towards P perornata The physiological mechanisms (e.g deÂciency of antioxidant enzyme activities including catalase, superoxide dismutase and ascorbate peroxidase) contributing to the sensitivity of P perornata to ROI-generating compounds were recently elucidated by Schrader and Dayan (2009) The discovery of alternative algaecides that are selectively toxic towards P perornata and environmentally safe would beneÂt the catÂsh production industry In this study, a catalase inhibitor, 3-amino-1,2,4triazole (Correa, Manrique, Font, Escrig & Aragon 2008), and several known intracellular free radicalproducing compounds, tert-butyl hydroperoxide (Cheng, Nguyen, Song & Bonanno 2007), phenazine Published 2011 This article is a U.S Government work and is in the public domain in the USA 1895 Compounds toxic towards oĂ-Êavour cyanobacterium N P D Nanayakkara & K K Schrader methosulphate (Shcherbachenko, Lisovskaya & Tikhonov 2007),6-hydroxydopamine (Fujita, Shiosaka, Ogino, Okimura, Utsumi, Sato, Akagi, Inoue, Utsumi & Sasaki 2008), ninhydrin (Elsner, Gurgul-Convey & Lenzen 2008) and the two quinoline compounds (1)(S)-8-[(4-amino-1-methylbutyl)amino]-6-methoxy-4methyl-5-[3,4-dichlorophenoxy]quinoline succinate] or abbreviated as NPC 1161A and ( )-(R)-8-[(4-amino-1-methylbutyl)amino]-6-methoxy-4-methyl-5-[3,4 -dichlorophenoxy]quinoline succinate] or abbreviated as NPC 1161B (Nanayakkara, Ager Jr, Bartlett, Yardley, Croft, Khan, McChesney & Walker 2008) were evaluated for their toxicity towards P perornata Test compounds tert-butyl hydroperoxide, phenazine methosulphate, 6-hydroxydopamine, ninhydrin and 3-amino-1,2,4-triazole were obtained from Aldrich (St Louis, MO, USA) Synthesis of NPC 1161A and NPC 1161B was reported earlier (Nanayakkara et al 2008) Each test compound was dissolved in 100% technical grade ethanol and corrections for purity were made An isolate of P perornata was obtained from a water sample collected from a Mississippi catÂsh pond (van der Ploeg, Dennis & de Regt 1995) A culture of the green alga Selenastrum capricornutum [Printz] was obtained from Dr J C Greene, USEPA, Corvallis, OR, USA, and was used as a representative of green algae (division Chlorophyta) in the bioassay to determine selective toxicity of the test compounds Each culture was maintained separately in continuous, steadystate growth using the conditions outlined previously (Schrader, de Regt, Tucker & Duke 1997) to provide a source of cells growing at a constant rate Continuous cultures samples were measured spectrophotometrically (model UV-3101PC, Shimadzu, Kyoto, Japan) at 750 nm to monitor cell density, which was maintained at 0.18^0.27 absorbance for P perornata and 0.19^0.25 absorbance for S capricornutum The bioassay procedures used by Schrader et al (1997) were followed, except for several modiÂcations as described below Final test concentrations of the test compounds were 0.01, 0.1, 1.0, 10.0 and 100.0 mM Three replicate wells were used for each test compound concentration and controls Microplates (96well, type Costar polystyrene; Corning, Corning, NY, USA) were held in an environmental light chamber (Percival ScientiÂc, Boone, IA, USA) maintained at 29 1C and under continuous illumination by overhead Êuorescent lamps (20 W, cool-white) at a photon Êux density (photosynthetically active radiation) of 16^ 30 mE m s as measured using a model LI-250 light meter and Quantum sensor (LI-COR, Lincoln, 1896 Aquaculture Research, 2011, 42, 1895^1898 NE, USA) Absorbance measurements (650 nm) were obtained at the beginning of each assay and then every 24 h for days using a SpectraCount microplate photometer (Packard Instrument Company, Meriden, CT, USA) Mean absorbance data (average of three replicate wells) were graphed to determine the lowest observed-eĂect concentration (LOEC; the the lowest concentration of test compound to partially inhibit growth) and lowest-complete-inhibition concentration (LCIC; the lowest concentration of test compound to completely inhibit growth) The LOEC was determined to be the lowest concentration in which the graphed line and standard deviation bars of the mean absorbance data points at 3^4 days did not overlap the graphed line and standard deviation bars of the control mean absorbance data points at 3^4 days The bioassay was repeated In this study, the most toxic compound towards P perornata was tert-butyl hydroperoxide, with an LOEC and an LCIC of 0.01 mM (Table 1) This compound was also selectively toxic towards P perornata based upon the LOEC of 100.0 mM and LCIC of 4100.0 mM for S capricornutum Among the other compounds evaluated, NPC 1161A, NPC 1161B and phenazine methosulphate were moderately toxic towards P perornata, with LCIC of 1.0 and 10.0 mM for NPC 1161A and NPC 1161B, respectively; these compounds were also selectively toxic towards P perornata The greater toxicity of NPC 1161A compared with NPC 1161B towards P perornata is likely due to the fact that NPC 1161A is a greater generator of ROI as discovered previously in animal toxicity studies (Nanayakkara et al 2008) Ninhydrin, 3-amino-1,2,4-triazole and 6-hydroxydopamine were all marginally toxic towards P perornata based upon LCIC values of 100.0 mM Both 6-hydroxydopamine and ninhydrin were selectively toxic towards P perornata when compared with LOEC and LCIC results for S capricornutum while 3-amino-1,2,4-triazole was not selectively toxic A previous study by Samuilov et al (1999) found the catalase inhibitor salicylic acid to suppress the growth of the cyanobacteria Anacystis nidulans and Anabaena variabilis at 5000.0 mM In our study, the catalase inhibitor 3-amino-1,2,4-triazole was toxic towards P perornata, with LOEC and LCIC values of 100.0 mM Although the catalase activity of P perornata was determined to be signiÂcantly lower compared with the activity in S capricornutum as reported by Schrader and Dayan (2009), the lack of selective toxicity of 3-amino-1,2,4-triazole would suggest another potential toxic mode of action towards the test organisms used in this study Published 2011 This article is a U.S Government work and is in the public domain in the USA Aquaculture Research, 42, 1895^1898 Aquaculture Research, 2011, 42, 1895^1898 Compounds toxic towards oĂ-Êavour cyanobacterium N P D Nanayakkara & K K Schrader Table Results of the bioassay evaluation of free radical-producing compounds for toxicity towards Planktothrix perornata Test organism Planktothrix perornata Selenastrum capricornutum Test compound LOEC (lM) LCICw (lM) LOEC (lM) LCIC (lM) 3-Amino-1,2,4-triazole tert-Butyl hydroperoxide 6-Hydroxydopamine Ninhydrin NPC 1161Az NPC1161B Phenazine methosulfate 100.0 0.01 100.0 100.0 1.0 1.0 10.0 100.0 0.01 100.0 100.0 1.0 10.0 10.0 100.0 (0) 100.0 (0) 4100.0 4100.0 100.0 (0) 100.0 (0) 100.0 (0) 100.0 (0) 4100.0 4100.0 4100.0 100.0 (0) 100.0 (0) 100.0 (0) (0) (0) (0) (0) (0) (0) (0) (0) (0) (0) (0) (0) (0) (0) Lowest-observed-eĂect concentration lowest test concentration that partially inhibits growth; number in parentheses is the stan- dard error of the mean A standard error of is not unusual with this bioassay due to test compound concentrations made in 10-fold dilutions wLowest-complete-inhibition concentration lowest test concentration that completely inhibits growth; number in parentheses is the standard error of the mean A standard error of is not unusual with this bioassay due to test compound concentrations made in 10-fold dilutions z(1)-(S)-8-[(4-amino-1-methylbutyl)amino]-6-methoxy-4-methyl-5-[3,4-dichlorophenoxy]quinoline succinate] ( )-(R)-8-[(4-amino-1-methylbutyl)amino]-6-methoxy-4-methyl-5-[3,4-dichlorophenoxy]quinoline succinate] During previous studies to evaluate antimalarial activities, the 8-aminoquinolines NPC 1161A and NPC 1161B were correlated with methemoglobinaemia, likely due to the formation of hydrogen peroxide and ROI in erythrocytes (Nanayakkara et al 2008) In our study, both of these compounds were more toxic towards P perornata than primaquine, another antimalarial compound, which had an LCIC of 100.0 mM (Schrader & Harries 2001) Although these two 8aminoquinolines have relatively low mammalian toxicity, they are expensive to synthesize, and, therefore they are not good candidates to pursue for ecacy testing in catÂsh production ponds Although tert-butyl hydroperoxide was the most toxic towards P perornata, the undesirable toxicity towards nontarget organisms and high reactivity of this compound make it an unlikely candidate for ecacy testing in catÂsh production ponds However, the results of this study clearly demonstrate that the discovery of ROI-producing novel compounds, especially environment-safe natural compounds, should have high priority for evaluation as selective algaecides for managing musty oĂ-Êavour problems in pond-raised catÂsh related to the presence of P perornata Acknowledgments The technical assistance of Marcuslene Harries is greatly appreciated References Cheng Q., Nguyen T., Song H & Bonanno J (2007) Hypoxia protects human corneal endothelium from tertiary butyl hydroperoxide and paraquat-induced cell death in vitro Experimental Biology and Medicine 232, 445^453 Correa M., Manrique H.M., Font L., Escrig M.A & Aragon C.M.G (2008) Reduction in the anxiolytic eĂects of ethanol by centrally formed acetaldehyde: the role of catalase inhibitors and acetaldehyde-sequestering agents Psychopharmacology (Berlin) 200, 455^464 Elsner M., Gurgul-Convey E & Lenzen S (2008) Relation between triketone structure, generation of reactive oxygen species, and selective toxicity of the diabetogenic agent alloxan Antioxidants & Redox Signaling 10, 691^700 Fujita H., Shiosaka M., Ogino T., OkimuraY., Utsumi T., Sato E.F., Akagi R., Inoue M., Utsumi K & Sasaki J (2008) aLipoic acid suppresses 6-hydroxydopamine-induced ROS generation and apoptosis through the stimulation of glutathione synthesis but not by the expression of heme oxygenase-1 Brain Research 1206,1^12 Nanayakkara N.P.D., Ager A.L Jr, Bartlett M.S., Yardley V., Croft S.L., Khan I.A., McChesney J.D & Walker L.A (2008) Antiparasitic activities and toxicities of individual enantiomers of the 8-aminoquinoline 8-[(4-amino-1methylbutyl)amino]-6-methoxy-4-methyl-5-[3,4-dichloro phenoxy]quinoline succinate Antimicrobial Agents and Chemotherapy 52, 2130^2137 Samuilov V.D., Bezryadnov D.V., Gusev M.V., Kitashov A.V & Fedorenko T.A (1999) Hydrogen peroxide inhibits the growth of cyanobacteria Biochemistry (Moscow) 64, 47^53 Schrader K.K & Harries M.D (2001) Compounds with selective toxicity toward the musty-odor cyanobacterium Published 2011 This article is a U.S Government work and is in the public domain in the USA Aquaculture Research, 42, 1895^1898 1897 Compounds toxic towards oĂ-Êavour cyanobacterium N P D Nanayakkara & K K Schrader Oscillatoria perornata Bulletin of Environmental Contamination and Toxicology 66, 801^807 Schrader K.K & Dayan F.E (2009) Antioxidant enzyme activities in the cyanobacteria Planktothrix agardhii, Planktothrix perornata, Raphidiopsis brookii, and the green alga Selenastrum capricornutum In: Handbook on Cyanobacteria (ed by P.M Gault & H.J Marler), pp 473^483 Nova Science Publishers, NewYork, USA Schrader K.K., de Regt M.Q.,Tucker C.S & Duke S.O (1997) A rapid bioassay for selective algicides Weed Technology 11, 767^774 Schrader K.K., de Regt M.Q.,Tidwell P.D.,Tucker C.S & Duke S.O (1998a) Compounds with selective toxicity towards the oĂ-Êavor metabolite-producing cyanobacterium Oscillatoria cf chalybea Aquaculture 163, 85^99 Schrader K.K., de Regt M.Q.,Tidwell P.R.,Tucker C.S & Duke S.O (1998b) Selective growth inhibition of the musty-odor producing cyanobacterium Oscillatoria cf chalybea by natural compounds Bulletin of Environmental Contamination and Toxicology 60, 651^658 1898 Aquaculture Research, 2011, 42, 1895^1898 Shcherbachenko I.M., Lisovskaya I.L & TikhonovV.P (2007) Oxidation-induced calcium-dependent dehydration of normal human red blood cells Free Radical Research 41, 536^545 Tucker C.S (2000) OĂ-Êavor problems in aquaculture Reviews in Fisheries Science 8, 45^88 van der Ploeg M., Dennis M.E & de Regt M.Q (1995) Biology of Oscillatoria cf chalybea, a 2-methylisoborneol producing blue-green alga of Mississippi catÂsh ponds Water Science and Technology 31,173^180 Xiao F-L., Chen T-S., Qu J-L & Liu C-Y (2010) Artemisinin induces ROS-mediated caspase3 activation in ASTC-a-1 cells Proceedings of SPIE 7565,756501^756507 Keywords: algaecide, catÂsh, cyanobacterial, 2methylisoborneol, oĂ-Êavour, reactive oxygen intermediates Published 2011 This article is a U.S Government work and is in the public domain in the USA Aquaculture Research, 42, 1895^1898 Aquaculture Research, 2011, 42, 1899^1904 doi:10.1111/j.1365-2109.2010.02780.x SHORT COMMUNICATION Diet fed to brood stock effects the growth of channel catfish (Ictalurus punctatus L) fry Amina Zuberi1,, Megan Gima1,2, Andrew Gima1,3, Alison Hutson1,w, Atra Chaimongkol1,z, Menghe Li4, Gloria Umali-Maceina1, & Rex Dunham1 Department of Fisheries and Allied Aquacultures, Auburn University, Auburn, AL, USA School of Aquatic & Fishery Sciences, University of Washington, Seattle,WA, USA US Fish and Wildlife Service, Lacey,WA, USA National Warmwater Aquaculture Center, Mississippi State University, Stoneville, MS, USA Correspondence: R Dunham, Department of Fisheries and Allied Aquacultures, Auburn University, Auburn, AL 36849, USA E-mail: dunhara@auburn.edu Present address: Department of Animal Sciences, Quaid-i-Azam University, Islamabad, Pakistan w Present address: Silvery Minnow Refugium, P.O Box 1770, Los Lunas, NM 87031, USA z Present address: Coastal Aquatic Feed Research Institute, Department of Fisheries, 41/14 Moo Sukhumvit Road, Bangphra Sriracha Chonburi 20110,Thailand Present address: School of Forestry, Auburn University, Auburn, AL 36849, USA Introduction In female brood stock, the fast growth of oocytes, embryonic development and early performance of fry are critically aĂected by the nutrient supply during vitellogenesis During the vitellogenic phase of development, the main growth of the oocyte occurs through the uptake of extra-ovarian substances from the maternal blood (Tyler, Sumpter & Bromage 1988a, b) In rainbow trout there is decreased level of estradiol 17b and vitellogenin during fast ovary growth when brood stock is given a diet devoid of ascorbic acid (Waagbo, Thorsen & Sandnes 1989) Vitamin C is involved as a co-enzyme in many enzyme systems for hydroxylation of proline and lysine into the procollagen molecule that is necessary for the formation of cartilage, bones and skin and thereby contributes to growth (Barnes & Kodicek 1972; Halver1989) Thus, high vitamin C content increases survival of eggs and fry in rainbow trout Salmo gairdneri (Sandnes, Ulgenes, Brekkan & Utne 1984), tilapia (Soliman, Jauncey & Roberts 1986) and Atlantic salmon (Eskelinen 1989) A low maternal intake of AA produces juveniles with severe spinal deformities (scoliosis and lordosis) while a dietary supply of enhanced r 2011 Blackwell Publishing Ltd AA levels maintains an optimal performance of the fry (Soliman et al.1986) The importance of AA during egg development has been supported by studies in mature salmonids, where ovarian deposition of this vitamin greatly exceeds deposition in other organs (Hilton, Cho, Brown & Slinger 1979; Dabrowski 1991) Although the role of AA in channel catÂsh, Ictalurus punctatus reproduction has already been studied (Silveira, Perez, Fajer & Franco1996), there is lack of information about the importance of vitamin C transfer to larvae through sex products and its aĂect on growth of fry Merchie, Lavens, Dhert, Pector, Mai Soni, Abbes, Nelis, Ollevier, De Leenheer and Sorgeloos (1995) found signiÂcantly more positive eĂects on dry weight of Clarias gariepinus from day onwards after feeding highly supplemented AA diet, when compared with Âsh kept on lower supplementation or vitamin C deÂcient diet In sea bass (Dicentrachus labrux L.) and sea bream (Sparus aurata L) ascorbic acid given in brood stock diet is transferred to embryos and larvae and provides them protection against stress and deformities (Terova, Saroglia, Gy Papp & Cecchini 1998) The aim of the present research was to study if varying the amount of vitamin C supplementation of the diets regularly used at catÂsh hatcheries and 1899 Brood stock diet eĂects growth of catÂsh fry A Zuberi et al Aquaculture Research, 2011, 42, 1899^1904 given to the brood stock could improve the ascorbate levels in their gametes Our hypothesis was that if ascorbate levels were elevated in the gametes, particularly the eggs, a positive maternal eĂect would result for the growth of the oĂspring A total of 153 female and 36 male Kansas strain channel catÂsh were used The Âsh were divided in to three treatment groups and were stocked in 0.04-ha earthen ponds located at the Fish Genetics Research Unit, EW Shell Fisheries Research Center, Auburn University, Auburn, AL, USA, using three ponds per treatment group Three-year-old females and males with mean body weights of 2.1 ặ 0.1 and 2.5 ặ 0.3 kg, respectively, were stocked in March 2007 at a density of approximately 1500 kg and allowed to acclimate for a period of approximately month During the acclimation period the Âsh were oĂered a commercial catÂsh Êoating feed containing approximately 200 mg kg crystalline ascorbic acid, three times a week at 1.5% of their body weight Three diĂerent 36% protein experimental diets were used in this study Two of them as L -ascorbyle2-polyphosphate (APP) enriched diets at 500 and 1000 mg kg APP were used as a treated group, whereas commercially available brood stock feed designated Ccontrol (ascorbic acid in a crystalline form) for which we anticipated an approximate vitamin C level of 100 mg kg was included in the experiment as control group The experimental diets were prepared by Melick Feed Company (Melick Aquafeeds, Catawissa, PA, USA), and vitamin C levels were accomplished by changing the vitamin C level in the premix Additionally, analysis of the feeds of the feeds at the conclusion of the experiment unexpectedly showed that the control diet (33 mg kg vitamin E) was also diĂerent from the elevated vitamin C diets (65 mg kg vitamin E) for vitamin E due to miscommunication with the feed manufacturer as all diets were intended to have 33 mg kg of vitamin E The Âsh were fed with their respective diets six times a week to apparent satiation for 70 days (until spawning) The Âsh were artiÂcially spawned using hand stripping procedures Quality of the eggs was determined by the criteria described by Kristanto (2004) on a 0^5 scale based on colour, bloodiness and clumpiness with being the highest quality To determine the eĂect of feeding vitamin C to the parent brood stock on fry performance, approximately 30 swim-up fry were weighed and stocked per aquaria in triplicate for each treatment The fry were fed ad libitum three times per day with 54% protein Silver Cup salmon starter (Nelson and Sons, Murray, UT, USA) Accurate determination of food consumption was not possible as uneaten powdered food was dicult to collect, dry and weigh After 30 days, the fry from each treatment group were counted and weighed The total ascorbic acid concentration in the diets and other samples was determined by HPLC with electrochemical detection using a modiÂed method of Wang, Liao, Hung and Seib (1988).Vitamin E (total tocophoral levels in the feeds) was analysed using normal phase HPLC with Êuorescence detection following the procedure described by BASF (1997) Quality of eggs, total ascorbic acid (TAA) in eggs, testes and increase in body weight of the fry were determined for each treatment and subjected to one way analysis of variance and Duncans Multiple RangeTest (Steel & Torrie 1996) The relationship of dietary vitamin C with TAA in the eggs and TAA in the testes were investigated using simple linear regression analysis Total ascorbic acid in the commercial diet (Ccontrol) and the experimental diets (group APP500/E65 and APP1000/E65) at the initiation of the feeding trial was 216.2, 494.8 and 1119.5 mg kg respectively After 70 days, there was an 82.4% loss of ascorbic acid in the commercial diet However, in the two experimental feeds (APP500/E65 and APP1000/E65) the recovery of TAA in the diet was 95.4 and 91.7%, respectively, of the initial amount of vitamin C Table Concentration of total ascorbic acid (TAA) and vitamin E in the ovulated eggs and the testes of channel catÂsh, Ictalurus punctatus, fed graded levels of TAA for 70 days before the spawning Experimental diet to brood stock Ccontrol APP500/65 APP1000/65 Concentration of TAA (mg kg 1) Concentration of vitamin E (mg kg 1) Eggs Testes Eggs Testes 39.5 ặ 1.8a 61.6 ặ 6.7b 67.9 ặ 0.6bc 39.3 ặ 8.2a 73.5 ặ 7.0b 112.5 ặ 23.1bc 29.5 ặ 1.3a 31.5 ặ 0.3ab 35.5 ặ 1.5b 12.8 ặ 1.0a 18.1 ặ 1.5b 13.8 ặ 1.2a Means followed by the same letter within a column are not signiÂcantly diĂerent (P40.05) C, crystalline ascorbic acid; APP, L -ascorbyle-2-polyphosphate 1900 r 2011 Blackwell Publishing Ltd, Aquaculture Research, 42, 1899^1904 Aquaculture Research, 2011, 42, 1899^1904 The mean concentration of TAA ặ SE in the control was 39.5 ặ 1.8 in unfertilized eggs (Table 1) This concentration was signiÂcantly lower (Po0.002) compared with supplemented groups APP500/E65 and APP1000/E65, but no signiÂcant (Po0.39) diĂerence was found between the two supplemented groups No signiÂcant (P40.17) diĂerence was found between the two vitamin C supplemented groups APP500 and APP1000 for TAA in the testes, whereas the mean of the Âsh fed commercial diets was signiÂcantly (Po0.008) less compared with two the ascorbic acid supplemented groups (Table 1) Linear regression of data (Fig.1) showed a signiÂcant increase in deposition of ascorbic acid in the eggs and in the testicular tissue with increasing vitamin C intake A 3.8- and 8.3-fold increase of vitamin C in the diet resulted in 56.0% and 71.9% increases of TAA in the eggs, respectively, and 87.0% and 286.3% increases of TAA in the testes respectively Subjective egg quality increased (P 0.025) with increasing levels of vitamin C and E, 4.13, 4.25 and 4.37 for control, APP500/65, and APP1000/65 diets respectively (Fig 2) Figure Positive linear relationship between dietary vitamin C and total ascorbic acid (TAA) in the ovulated eggs (a) and the testes (b) of channel catÂsh, Ictalurus punctatus fed-graded levels of vitamin C (mg kg 1) Brood stock diet eĂects growth of catÂsh fry A Zuberi et al Figure Relationship between subjective egg quality and levels of vitamin C in 36% protein diets fed channel catÂsh, Ictalurus punctatus, brood stock R2 is signiÂcant (P 0.025) In the case of vitamin E, there appears to be interactions with vitamin C For APP500/65, there is no signiÂcant increase (P40.05) in vitamin E in the eggs compared with the control (Table 1) However, vitamin E was increased (Po0.05) in the eggs for the treatment, APP1000/65 In the case of the testes, vitamin E was higher than the control for APP500/65, but not for APP1000/65 For the eggs, a twofold increase of vitamin E in the diet resulted in a 6.8^13.6% increase in vitamin E, whereas, vitamin E increased 7.8^ 41.4% for the testes The fry produced from the parents fed with elevated vitamin C diets showed higher growth performance as compared with the control group (C) After month of feeding the fry with Silver Cup starter (54% protein), a signiÂcant (P 0.014) increase in body weight of fry produced from parents given APP500/65 (1.84 g) and APP1000/65 (1.96 g) vitamin C feed was observed, as compared with fry from parents fed commercial catÂsh feed (C) (0.90 g) (Table 2) Regression analysis of individual data revealed a positive relationship between dietary ascorbic acid fed to the parent stock and increase in body weight of fry (Fig 3) Positive strong correlation existed between the ascorbic acid status of the eggs and better performance of fry in terms of increase in body weight (Fig 3) However, ascorbic acid status in the testes of male parent was not correlated signiÂcantly with the increase in body weight of the fry (Fig 4) The result of the present study establishes the essentiality of ascorbic acid in the channel catÂsh brood stock diet Supplemented vitamin C (APP) diet improved quality of eggs compared with the commercial diet (Ccontrol) We cannot be absolutely certain that these improvements are due solely to enhancement of the feeds with vitamin C or if there are also improvements due to the elevated vitamin E However, vitamin C levels were more dramatically chan- r 2011 Blackwell Publishing Ltd, Aquaculture Research, 42, 1899^1904 1901 Brood stock diet eĂects growth of catÂsh fry A Zuberi et al Aquaculture Research, 2011, 42, 1899^1904 Table Mean initial and Ânal body weight (BW) after 30 days for channel catÂsh, Ictalurus punctatus, fry from brood stock fed with graded levels of vitamin C, APP mg ặ SE BW of fry mg ặ SE Experimental diet Mean initial Mean final Mean BW gain Specific growth rate (% body weight/day) Ccontrol APP500 APP1000 22.0 ặ 1.0a 22.0 ặ 3.0a 20.0 ặ 3.0a 930 ặ 90a 1860 ặ 270b 1980 ặ 150b 900 ặ 90a 1840 ặ 270b 1960 ặ 150b 12.5a 14.8b 15.3b Means followed by the same letter within a column are not signiÂcantly diĂerent (P40.05) C, crystalline ascorbic acid; APP, L-ascorbyle-2-polyphosphate, survival (%) was 100.0 for all treatments Figure Positive linear relation between total ascorbic acid (mg g 1) in eggs and increase in body weight of fry channel catÂsh, Ictalurus punctatus, fry ged in the gametes compared with vitamin E, and egg quality increased incrementally with increases in vitamin C indicating that the major eĂects were likely due to the vitamin C supplementation The most pronounced eĂect of the brood stock diets in the present study was found on the amount of TAA in the ovulated eggs The Âsh that had increasing availability of vitamin C in the diet had signiÂcantly higher TAA concentration in the eggs as compared with Âsh that received commercial diet (Ccontrol) Several other studies with silver bream (Dabrowski 1976) and rainbow trout (Dabrowski & Blom 1994) have reported a rise in ascorbic acid concentration in oocytes or total ascorbic acid content in ovaries with increasing levels of vitamin C in the diet Studies by Dabrowski (1991) and Hilton et al (1979) have also suggested that in mature salmonids, deposition of ascorbic acid in the gonads highly exceeds the deposition in other organs, which may indicate the importance of ascorbic acid during egg development Although the role of vitamin supplements on the reproductive performance of channel catÂsh has been studied by Silveira et al (1996), there is a lack of information about the role of vitamin C in fry produc- 1902 Figure Relationship between ascorbic acid status in the testes of channel catÂsh, Ictalurus punctatus, and its eĂect on increase in body weight of fry R2 is not signiÂcant (P 0.36) tion and their growth performance Ascorbic acid plays an important role in certain aspect of protein metabolism (Chatterjee 1967) and (Ram 1966) has suggested that ascorbic acid has a speciÂc eĂect on growth This may help to explain the enhancement in protein eciency ratio and speciÂc growth rate for fry originating from the parent fed with APP diets in the present study The diĂerence in growth of fry from APP and C diets parent stock suggests that ascorbic acid may be transferred from the ovary of the female to the eggs and hence to the fry; providing store of ascorbic acid for fry after hatching, the most critical stage for the fry survival Eskelinen (1989) observed positive eĂect of high vitamin C on survival of eggs and fry in Atlantic salmon, whereas vitamin C unsupplemented diet greatly depressed the survival rate and fry performance in Oreochromis mossambicus (Soliman et al 1986) Again, we can not partition potential eĂects of vitamin E Growth enhancement for fry from APP1000/65-treated parents was observed to be slightly higher, but not signiÂcantly diĂerent from fry of APP500/65-treated parents One explanation could be that we have neared the peak for the r 2011 Blackwell Publishing Ltd, Aquaculture Research, 42, 1899^1904 Aquaculture Research, 2011, 42, 1899^1904 eĂects of vitamin C on the maternal eĂect on fry growth Alternatively, because vitamin E was at the same concentration for these two enhanced diets, the enhancement could be due to the vitamin E instead or there could by synergistic eĂects between the two vitamins and an increased amount of vitamin E is needed to obtain further beneÂts from the vitamin C No signiÂcant correlation was found between TAA content of the testes and the growth rate of fry This, of course, makes sense as one would expect the yolk and cytoplasm of the egg to have greater impact than the minimal cytoplasm entering the zygote from the sperm There does appear to be interactions between the two vitamins The vitamin E in the testes of APP500/ 65-treated Âsh increased However, the vitamin E in testes of APP1000/65-treated Âsh decreased compared with APP500/65-treated Âsh, suggesting that as vitamin C increased to mega levels incorporation of vitamin E in the testes diminished In conclusion,TAA content of eggs and testes, and egg quality in channel catÂsh were positively correlated to the dietary vitamin C content and enhanced signiÂcantly in the APP supplemented groups as compared with Âsh fed a commercial control diet Feeding elevated levels of vitamin C to brood stock doubled the growth rate of channel catÂsh fry in aquaria during the Ârst 30 days of feeding Approximately 500 mg kg vitamin C (APP500) is adequate for better reproductive performance of channel catÂsh and for sucient deposition of ascorbic acid in the eggs for higher performance of the fry The enhanced vitamin C diets also had elevated vitamin E, so we cannot partition the possible eĂect of the two nutrients, although regression analysis indicates progressively increasing levels of vitamin C are beneÂcial Until further experimentation is conducted to determine the relative eĂects and interactions of vitamin C and E data, vitamin E in the diet should also be increased to 65 mg kg diet Additional experiments are needed to see if the increased growth performance of fry from brood Âsh fed the enhanced diet (1)continues longer than 30 days, (2) will also be seen in ponds at higher densities and (3) will it translate to faster growth of hybrid fry as well as channel catÂsh fry Acknowledgments This research was partially supported by the SRAC project Improving reproductive eciency to produce Brood stock diet eĂects growth of catÂsh fry A Zuberi et al channel blue hybrid catÂsh fryand by the Alabama Agricultural Experiment Station The experimental diets were donated by Melick Aquafeeds, Catawissa, PA, USA References Barnes M.J & Kodicek E (1972) Biological hydroxylations and ascorbic acid with special regard to collagen metabolism.Vitamins and Hormones 30,1^43 BASF (1997) AnalyticalWorkshop Manual BASF,Wyandothe, MI, USA Chatterjee G.C (1967) EĂects of ascorbic acid deÂciency in animals In:TheVitamins (ed byW.H Sebrell Jr & R.S Harris), Vol 1, pp 407^456 Academic Press, New York, NY, USA Dabrowski K (1976) The content of ascorbic acid in organs of silver bream (Vimba vimba L.) Polish Archives of Hydrobiology 24, 569^573 Dabrowski K (1991) Ascorbic acid status in high-mountain charr (Salvelinus alpinus L.) in relation to the reproductive cycle Environmental Biology of Fishes 31, 213^217 Dabrowski K & Blom J.H (1994) Ascorbic acid deposition in rainbow trout (Oncorhyncbus mykiss) eggs and survival of embryos Comparative Biochemistry and Physiology 108A, 129^135 Eskelinen P (1989) EĂects of diĂerent diets on eggs production and egg quality of Atlantic salmon (Salmo salar L.) Aquaculture 79, 275^281 Halver J.E (1989) The vitamins In: Fish Nutrition (ed by J.E Halver), 2nd edn (pp 32^109 Academic Press, San Diego, CA, USA Hilton J.W., Cho C.Y., Brown R.G & Slinger S (1979) The synthesis, half-life and distribution of ascorbic acid in rainbow trout Comparative Biochemistry and Physiology 63A, 447^453 Kristanto A (2004) Evaluation of various factors to increase the eciency of channel-blue hybrid catÂsh embryo pro duction PhD thesis, Auburn University, Auburn, AL, USA Merchie G., Lavens P., Dhert P., Pector R., Mai Soni A.F., Abbes M., Nelis H., Ollevier F., De Leenheer A & Sorgeloos P (1995) Live food mediated vitamin C transfer to Dicentrarchus labrax and Clarias gariepinus Journal of Applied Ichthyology 11, 336^341 Ram M.M (1966) Growth rate and protein utilization in vitamin C deÂciency Indian Journal of Medical Research 54, 964^970 Sandnes K., Ulgenes Y., Brekkan O.R & Utne F (1984) The eĂect of ascorbic acid supplementation in broodstock feed on reproduction in rainbow trout (Salmo gairdneri) Aquaculture 43,167^177 Silveira A.R., Perez J., Fajer E & Franco A (1996) Efecto del suplemento de vitaminas sobre el comportamiento repro- r 2011 Blackwell Publishing Ltd, Aquaculture Research, 42, 1899^1904 1903 Brood stock diet eĂects growth of catÂsh fry A Zuberi et al ductivo de Ictalurus punctatus Revista Cubana de Investigaciones Pesqueras 20, 28^30 Soliman A.K., Jauncey K & Roberts R.J (1986) The eĂect of dietary ascorbic acid supplementation on hatchability, survival rate and fry performance in Oreochromis mossambicus Aquaculture 59, 197^208 Steel R.G.D & Torrie J.H (1996) Principles and Procedures of Statistics ^ A Biomedical Approach McGraw Hill Book, London, UK Terova G., Saroglia M., Gy Papp Z & Cecchini S (1998) Ascorbate dynamics in embryos and larvae of sea bass and sea bream, originating from broodstocks fed supplements of ascorbic acid Aquaculture International 6, 357^367 Tyler C.R., Sumpter J.P & Bromage N.R (1988a) In vivo ovarian uptake and processing of vitellogenin in the rainbow trout, Salmo gairdneri Journal of Experimental Zoology 246,171^179 1904 Aquaculture Research, 2011, 42, 1899^1904 Tyler C.R., Sumpter J.P & Bromage N.R (1988b) Selectivity of protein sequestration by vitellogenic oocytes of rainbow trout, Salmo gairdneri Journal of Experimental Zoology 248,199^206 Waagbo R., Thorsen T & Sandnes K (1989) Role of dietary ascorbic acid in vitellogenesis in rainbow trout (Salmo gairdneri) Aquaculture 80, 301^314 Wang X., Liao M., Hung T & Seib P.A (1988) Liquid chromatographic determination of L-ascorbate-2-polyphosphate in Âsh feeds by enzymatic release of L-ascorbate Journal 71,1158^1161 Keywords: ascorbic acid, brood stock, eggs, Ictalurus punctatus, fry, APP r 2011 Blackwell Publishing Ltd, Aquaculture Research, 42, 1899^1904 [...]... of rock bream (Oplegnathus fasciatus) iridovirus Process Biochemistry 42,1 34^140 Kimmel C.B., BallardW.W., Kimmel S.R., Ullmann B & Schilling T.F (1995) Stages of embryonic development of the zebra¢sh Developmental Dynamics 203, 253^310 r 2011 Blackwell Publishing Ltd, Aquaculture Research, 42, 1764^1777 Aquaculture Research, 2011, 42, 1764^1777 Kreiling J.A., Prabhat,Williams G & Creton R (2007) Analysis... di¡erent protein levels The GSIs were a¡ected signi¢cantly by the formulated feeds in this experiment (Table 2) The highest r 2011 Blackwell Publishing Ltd, Aquaculture Research, 42, 1752^1763 1755 E¡ects of low dietary protein level in M albus H Yuan et al Aquaculture Research, 2011, 42, 1752^1763 Table 2 Variance analysis for E2and T concentrations and gonadosomatic index (GSI) with di¡erent dietary protein... di¡erent dietary protein levels, the highest female ratio occurred at the 400 g kg À 1 dietary protein level, followed by 250, 200, 150 and 100 g kg À 1 diet- r 2011 Blackwell Publishing Ltd, Aquaculture Research, 42, 1752^1763 Aquaculture Research, 2011, 42, 1752^1763 E¡ects of low dietary protein level in M albus H Yuan et al Table 4 Results of variance analysis for sex ratio and survival with di¡erent dietary... the process of sex di¡erentiation in ¢sh Many studies on sex steroids regulation of gametogenesis of teleost ¢sh have r 2011 Blackwell Publishing Ltd, Aquaculture Research, 42, 1752^1763 1757 E¡ects of low dietary protein level in M albus H Yuan et al Aquaculture Research, 2011, 42, 1752^1763 Figure 4 Transverse sections of gonads of adult female Monopterus albus (a) Ovary of 250 g kg À 1 protein level... Lin 1995; Chang & Lin 1998; Piferrer 2001; Lee,Yueh, Du, Sun & Chang 2002; Lange, Hartel & Meyer 2003;Wu, Tomy, Nakamura & Chang 2008) E2 has been re- r 2011 Blackwell Publishing Ltd, Aquaculture Research, 42, 1752^1763 Aquaculture Research, 2011, 42, 1752^1763 E¡ects of low dietary protein level in M albus H Yuan et al Figure 5 Transverse sections of gonads of intersex and male Monopterus albus (a)... are some exogenous factors that could also in£uence the sex ratio in a ¢sh population (Fishelson 1970; Yamamoto 1999; r 2011 Blackwell Publishing Ltd, Aquaculture Research, 42, 1752^1763 1759 E¡ects of low dietary protein level in M albus H Yuan et al Aquaculture Research, 2011, 42, 1752^1763 Van, Verheyen & Witters 2003) Santiago, Aldaba and Laron (1982) reported that survival ratio was in£uenced... cephalus Aquaculture 177, 37^45 Chu Z.J., Gong S.Y., Zhang G.B., Zhang L., Yuan Y.C & Yuan Z.J (2009) E¡ects of estradiol valerate on steroid hormones and sex reversal of female rice ¢eld eel, Monopterus albus Journal of theWorld Aquaculture Society (accepted) r 2011 Blackwell Publishing Ltd, Aquaculture Research, 42, 1752^1763 1761 E¡ects of low dietary protein level in M albus H Yuan et al Aquaculture Research,. .. between sex reversal, body weight and age of Monopterus albus Journal ofYangtze University (Natural Science Edition) Agricultural Science 4, 45^47 1762 r 2011 Blackwell Publishing Ltd, Aquaculture Research, 42, 1752^1763 Aquaculture Research, 2011, 42, 1752^1763 E¡ects of low dietary protein level in M albus H Yuan et al Yang F.Q., Zhou Q.B., ZhangY.P & Li X.H (2005) Variation of esterase isoenzyme... Development 66, 211^217 Zou J.X (2000) Analysis of the relationship between sexual reversal and serum proteins Reservoir Fisheries 1, 13^15 (in Chinese) r 2011 Blackwell Publishing Ltd, Aquaculture Research, 42, 1752^1763 1763 Aquaculture Research, 2011, 42, 1764^1777 doi:10.1111/j.1365-2109.2010.02774.x Stages of rock bream oplegnathus fasciatus (Temminck et Schlegel 1844): embryonic development Tao He1,2,... centrosomes, and the spindle ¢bres that grow-out from the centrosomes (Fig 2, 1), are distinctly visible in an optic microscope r 2011 Blackwell Publishing Ltd, Aquaculture Research, 42, 1764^1777 1765 Stages of rock bream embryonic development T He et al Aquaculture Research, 2011, 42, 1764^1777 1 2 3 4 5 6 7a 7b 8a 8b 9a 9b 10a 10b 11a Figure 1 Stages of rock bream embryonic development (in vivo) (1) Two-cell