Identification of peroxiredoxin 5 interactome in hypoxic kidney

Doctoral Dissertation Identification of peroxiredoxin interactome in hypoxic kidney Department of Molecular Medicine Graduate School, Chonnam National University Tran Giabuu August 2015 Identification of peroxiredoxin interactome in hypoxic kidney Department of Molecular Medicine Graduate School, Chonnam National University Tran Gia-Buu Supervised by Professor Lee Tae-Hoon The thesis entitled above, by the graduate student named above, in partial fulfillment of the requirements for the Doctor of Philosophy in Science has been deemed acceptable by the individuals below Committee in Charge: Park Byung-Ju Chay Kee-Oh Lee Seung-Rock Kim Jong-Suk Lee Tae-Hoon August 2015 Contents Contents I List of Figures IV List of Tables VI List of Abbreviation VII Chapter Proteomic analysis of peroxiredoxin interacting proteins in hypoxic kidney Abstract (in English) 1 Introduction 2 Materials and methods 1) Hypoxic treatment 2) Extraction of total RNA 3) Reverse-transcription polymerase chain reaction 4) Producing Prdx5 antibody 5) Protein extraction and immunoprecipitation 6) Interactome analysis by nano UPLC-MS/MS 7) Confirmation of Prdx5 interacting protein via western blot analysis .8 Results .9 1) Confirmation of Prdx5 antibody ability to immunoprecipitate 2) Confirmation of hypoxic stress in mouse kidney 3) The short-list of putative proteins altered in hypoxic kidneys 4) Confirmation of the data collected from LC-MS/MS analysis by reverse immunoprecipitation .10 Discussion 22 References .24 I Abstract (in Korean) 29 Chapter Interaction between peroxiredoxin and dihydrolipoamide branched chain transacylase E2 under hypoxic condition Abstract (in English) 30 Introduction 31 Materials and methods 34 1) Reagents 34 2) Hypoxic treatment 34 3) Protein extraction and immunoprecipitation 34 4) Determination of DBT enzymactic activity 34 5) Cell culture and plasmid construction 35 6) Confocal fluorescence microscopy .35 7) Analysis of the role of Prdx5 cysteine residues in interaction between Prdx5 and DBT in hypoxic stress 36 Results .37 1) Analysis of Prdx5 and DBT interaction under hypoxic stress 37 2) The effect of hypoxic stress on DBT enzymatic activity 37 3) Confirmation of DBT overexpressing construct 37 4) The co-localization of Prdx5 and DBT under hypoxic stress .38 5) The role of Prdx5 cysteine residues in the Prdx5-DBT interaction 38 Discussion 51 References .54 Abstract (in Korean) 57 II Chapter Primary evaluation of interaction between Prdx5 and Alb, Rab43, Pcca and Pccb Abstract (in English) 58 Introduction 59 Materials and methods 61 1) Vibrio vulnificus-infected mouse model .61 2) Staphylococcus aureus-infected cell model 61 3) Protein extraction and immunoprecipitation 62 4) Pcca and Pccb overexpressing vector construction 62 5) Escherichia coli culture and IPTG induction .62 6) Protein purification .62 Results 64 1) Interaction between Prdx5 and Alb in human serum albumin administered Vibrio vulnificus-infected mouse model 64 2) Expression of Prdx5 and Rab43 in Staphylococcus aureus-infected macrophages 64 3) Interaction between Prdx5 and Rab43 in Staphylococcus aureus-infected cell model 64 4) Confirmation of Pcca and Pccb relating constructs 64 5) Examination of solubility of mature Pcca and Pccb .64 6) Optimization of Pcca and Pccb induction .65 7) Examination of the ability of Pcca and Pccb to produce PCC complex in vitro 65 Discussion 82 References .84 Abstract (in Korean) 87 III List of Figures Chapter Proteomic analysis of peroxiredoxin interacting proteins in hypoxic kidney Figure Alignment of amino acid sequence of human Prdx5 and orthologues in some species 16 Figure Immunoprecipitation using mouse anti-Prdx5 antibody 17 Figure Confirmantion of VEGFa expression in hypoxia treated kidney via semiquantified RT-PCR and realtime-PCR 18 Figure Work-flow to identify putative target protein interacted with Prdx5 in hypoxic kidney 19 Figure Confirmation of putative target proteins interacted with Prdx5 by reverse immunoprecipitation 21 Chapter Interaction between peroxiredoxin and dihydrolipoamide branched chain transacylase E2 under hypoxic condition Figure Scheme of function of BCKDH complex in BCAAs catabolic pathway 40 Figure Coprecipitation of endogenous Prdx5 with DBT in normoxic and hypoxic mouse kidney 42 Figure In vitro assay of DBT enzymatic activity in normoxic and hypoxic mouse kidneys 43 Figure Cloning DBT/pCMV construct 44 Figure Confirmation of WT and mutant Prdx5 constructs 47 Figure Co-localization of Prdx5 and DBT in normoxic and hypoxic HEK293 cells 49 Figure Comparative interactions of Prdx5 WT or cysteine mutants with DBT in normoxic and hypoxic cells 50 IV Chapter Primary evaluation of interaction between Prdx5 and Alb, Rab43, Pcca and Pccb Figure Schematic representation to generate V vulnificus-infected mouse model 67 Figure Interaction between Prdx5 and albumin in the spleens and livers collected from V vulnificus-infected mice 68 Figure Expression of Prdx5 and Rab43 in S aureus-infected macrophages 69 Figure Interaction between Prdx5 and Rab43 in S aureus-infected macrophages 71 Figure Confirmation of Pcca and Pccb overexpressing vectors 72 Figure Examination of solubility of Pcca and Pccb 75 Figure Optimization IPTG induction to improve Pccb solubility 76 Figure Purification of Pcca and Pccb 78 Figure Examination of the ability of Pcca and Pccb to generate PCC complex 80 V List of Tables Chapter Proteomic analysis of peroxiredoxin interacting proteins in hypoxic kidney Table Schematic representation of mammalian peroxiredoxin family members 11 Table The list of primers used for RT-PCR and Realtime-PCR 12 Table Putative target protein showing altered interaction by Prdx5 immunoprecipitation under hypoxic stress 13 Table List of proteins interacted with Prdx5 is not altered during hypoxic stress 15 Chapter Primary evaluation of interaction between Prdx5 and Alb, Rab43, Pcca and Pccb Table The list of primers used for cloning and sequencing Pcca and Pccb constructs 74 VI List of Abbreviation AEBSF 4-(2-Aminoethyl) benzenesulfonyl fluoride hydrochloride Ala Alanine Alb Albumin Arg Arginine ATP Adenosine triphosphate BCA Bicinchoninic acid BCAAs Branched chain amino acids BCKDH Brached chain alpha keto-acid dehydrogenase Cys Cysteine DBT Dihydrolipoamide branched chain transacylase E2 DTT Dithiothreitol ECM Extracellular matrix EDTA Ethylenediaminetetraacetic acid EGTA Ethylene glycol tetraacetic acid E.coli Escherichia coli Gba2 Glucosidase, beta (bile acid) Gln Glutamine Glu Glutamic acid GSH Glutathione GTP Guanosine-5'-triphosphate HA Human influenza hemagglutinin HEK Human embryonic kidney HIF Hypoxia-inducible factor HRP Horseradish peroxidase IAM Iodoacetamide VII Ile Isoleucine IPTG Isopropyl β-D-1-thiogalactopyranoside Krt Keratin Leu Leucine NAD+/ NADH Oxidized /reduced form of nicotinamide adenine dinucleotide PBS Phosphate buffered saline PCC Propionyl-CoA carboxylase Pcca Propionyl-CoA carboxylase, alpha polypeptide Pccb Propionyl-CoA carboxylase, beta polypeptide PCR Polymerase chain reaction PMSF Phenylmethylsulfonyl fluoride PPIA Peptidylprolyl isomerase A Prdx Peroxiredoxin PVDF Polyvinylidene difluoride Rab43 Ras-related protein Rab43 RIPA Radioimmunoprecipitation assay ROS/RNS Reactive oxygen species/ reactive nitrogen species RT-PCR Reverse-transcription polymerase chain reaction SDS Sodium dodecyl sulfate SPF Specific-pathogen free TCEP Tris-2-carboxyethyl phosphine TEABC Tetra ethyl ammonium bicarbonate TEMED Tetramethylethylenediamine TFA Trifluoroacetic acid Thr Threonine Txn1 Thioredoxin VIII C gb|BC037082.1|_21-1646 PCCB-2_T7terminator CTCCAAACACCTTCTTGGTGACACCAACTATGCCTGGCCCACAGCTGAGA 1384 CTCCAAACACCTTCTTGGTGACACCAACTATGCCTGGCCCACAGCTGAGA 982 ************************************************** gb|BC037082.1|_21-1646 PCCB-2_T7terminator TTGCAGTCATGGGAGCAAAGGGTGCTGTGGAGATCATCTTCAAAGGACAC 1434 TTGCAGTCATGGGAGCAAAGGGTGCTGTGGAGATCATCTTCAAAGGACAC 1032 ************************************************** gb|BC037082.1|_21-1646 PCCB-2_T7terminator CAAGATGTCGAAGCCGCCCAGGCAGAGTATGTGGAGAAGTTCGCCATCCC 1484 CAAGATGTCGAAGCCGCCCAGGCAGAGTATGTGGAGAAGTTCGCCATCCC 1082 ************************************************** gb|BC037082.1|_21-1646 PCCB-2_T7terminator TTTCCCAGCAGCCGTGAGAGGGTTTGTGGATGACATCATCCAGCCATCCT 1534 TTTCCCAGCAGCCGTGAGAGGGTTTGTGGATGACATCATCCAGCCATCCT 1132 ************************************************** gb|BC037082.1|_21-1646 PCCB-2_T7terminator CTACTCGTGCTCGGATATGCTGTGACCTGGAAGTCCTGGCCAGCAAGAAG 1584 CTACTCGTGCTCGGATATGCTGTGACCTGGAAGTCCTGGCCAGCAAGAAG 1182 ************************************************** gb|BC037082.1|_21-1646 PCCB-2_T7terminator GTCCATCGTCCCTGGAGGAAACATGCAAATATCCCACTGTGA 1626 GTCCATCGTCCCTGGAGGAAACATGCAAATATCCCACTGCTCGAGCACCA 1232 *************************************** gb|BC037082.1|_21-1646 PCCB-2_T7terminator 1626 CCACCACCACCACTGAGATCCGGCTGCTAACAAAGCCCGAAACGTAGCTG 1282 Figure Confirmation of Pcca and Pccb overexpressing vectors The vector maps of Pcca and Pccb relating construct were represented (A) To confirm the sequence of Pcca overexpressing vector, Pcca overexpressing vector was sent to nucleotide sequencing analysis, then the result was aligned with reference sequence (Accession number: BC006915) and the hexahistidine tag region was highlighted (B) The sequence of Pccb overexpressing vector was compared with reference sequence (Accession number: BC037082) and the hexahistidine tag region was marked (C) 73 Table Gene The list of primers used for cloning and sequencing Pcca and Pccb constructs Primer Sequence Purpose Pcca-F 5’-GGGGCTAGCTCTGTGGAATATGAGCCTAAA-3’ Cloning Pcca-R 5’-GGGCTCGAGTTCCAGCTCCACAAGCAG-3’ Pccb-F 5’-GGGGCTAGCGGCCTTTGCAGCCAGCCG-3’ Pccb-R 5’-GGGCTCGAGCAGTGGGATATTTGCATGTTTCC-3’ T7terminator 5’-GCTAGTTATTGCTCAGCGG-3’ name Pcca Pccb 74 Cloning Sequencing Figure Examination of solubility of Pcca and Pccb In brief, small scale of Pcca and Pccb overexpressing bacteria were induced at mid log phase OD600~0.6 in mM IPTG at 37oC during hours, then the bacteria were harvested by centrifugation Negative control, without IPTG induction, or total lysate was prepared by boiling the bacteria in sample buffer Bacteria were broken in lysis buffer by sonication The clear extract was collected by centrifugation and indicated as supernatant (supt); on the other hand, the pellet (pelt) was collected by suspension the same volume of lysis buffer using to homogenize bacteria These results indicated that Pcca and Pccb were successfully induced, and 90% of Pcca and Pccb existed in insoluble fraction This required optimization for improving Pcca and Pccb solubility 75 A B 76 Figure Optimization of IPTG induction to improve Pccb solubility Pccb overexpressing bacteria were induced in mid log phase OD600~0.6 at 16oC overnight in different concentration of IPTG (1.0, 0.5, 0.2, 0.1 mM) The bacteria were harvested and broken in lysis buffer, the soluble (S) and insoluble (P) fraction were separated by centrifugation The result showed that lower concentration of IPTG could produce more total soluble protein Thus, I chose 0.1 mM IPTG for IPTG induction to harvest higher amount of total protein in the soluble fraction (A) To examine whether inducing IPTG in early log phase could improve Pccb solubility or not, Pccb overexpressing bacteria were induced with 0.1 mM IPTG in early phase (OD600~0.3) for overnight at 4oC (B) Even the total soluble protein was decreased in early-phase-induction, amount of Pccb increased in soluble fraction comparing with mid-log-phase-induction These data suggested that early phase induction combining with low IPTG concentration was the optimal condition to improve soluble Pccb Control, the cells without IPTG induction, and total lysate from IPTG induced the cells were boiling in sample buffer and loaded into SDSpolyacrylamide with the same volume 77 A B 78 Figure Purification of Pcca and Pccb In brief, the protein extracts from Pcca and Pccb overexpressing bacteria were applied into the Ni-NTA agarose column according to the manufacturer’s instruction The unbound protein was removed by washing several times with the buffer containing 50 mM Tris-HCl, 1mM EDTA, 30 mM imidazole, pH 8.0 The target protein containing hexahistidine tag (His-tag) was eluted and fractionated in the buffer containing 50 mM Tris-HCl, 1mM EDTA, 300 mM imidazole, pH 8.0 in 1ml per fraction 10 µl of elution fractions (E1-E9) was subjected into SDS-polyacrylamide and visualized by Coomassie blue staining The result indicated that Pcca was successful purified with major band about 72 kDa in gel (A) Pccb was partly purified with predicted band about 60 kDa and other proteins (B) This result suggested that Pccb needed to be further purified to get the high quality Pccb 79 A B C 80 Figure Examination of the ability of Pcca and Pccb to generate PCC complex To form PCC complex, Pcca and Pccb were dialyzed in the buffer containing 20 mM HEPES, 1mM ETDA, pH 7.4, then Pcca and Pccb were incubated together in molar ratio 1:1 at oC for overnight in rotator To investigate whether PCC complex was successfully formed or not, I loaded µg of Pcca, 10 µg of Pccb, and 10 µg of Pcca-Pccb complex into reducing gel (A) or native gel (B), and visualized by Coomassie blue staining Unfortunately, I could not observed the band in 750 kDa, expected size of PCC complex, on the native gel in lane of Pcca-Pccb complex, this suggested that Pcca and Pccb could not make the PCC complex in this condition One of possibility explaining for this phenomenon is that Pcca might be formed oligomer that in turn prevented interaction between Pcca and Pccb The results from non-reducing gel (C) revealed that Pcca formed oligomers, and Pcca could not enter the gel, even I tried to use lower acrylamide concentration gel (6%) and run longer time (8 hours versus hours in the voltage 80 V) These data suggest that to generate PCC complex, I need more optimization for purification of Pccb and prevent the Pcca oligomerization 81 Discussion Peroxiredoxin (Prdx) is thought as the family of enzymes ubiquitously expressing in organisms from all kingdoms with variety cellular localizations and exerting the oxidative stress scavenger via its peroxidase activity A growing body of evidence indicates Prdx not only plays the role in cellular protective function but also involves in host-bacterial defense To escapes challenges of oxidative burst in macrophages, bacteria evolve the many defense mechanisms, including the simplest way to remove oxidative stress via upregulation of antioxidant enzymes Recently, Kaihami and collaborators suggested that LsfA, bacterial 1-Cys peroxiredoxin, protected Pseudomonas aeruginosa against ROS generated via NADPH oxidase in P aeruginosa-infected macrophages (20) AhpC, one of the orthologues of peroxiredoxin, was reported that related with Mycobacterium tuberculosis survival in macrophages and combined with KatE, the orthologue of catalse, to enhance the Brucella aborttus 2308 infection in C57BL/6 and BALB/c mice (21-22) In contrast, Prdx also involves in bacteria elimination in host cells For an example, proteomics analysis revealed that Prdx6, one member of 1-Cys Prdx family, was induced in Opisthorchis viverrini infection model, special in cytoplasm inflammatory cells (23) Moreover, Prdx6 also was suggested as enhancer requiring for optimization of NADPH oxidase in neutrophils (24) Prdx5 also was reported that it upregulated in LPS or bacteria infected cell lines, and regulated interleukin expression, a proinflammatory cytokine (7-10) My data were consistent with previous reports that Prdx5 was upregulated not only in LPS treated macrophages but also in S aureus-infected macrophages On the other hand, Rab43 was proved as the Rab GTPase playing the important role for maturation of phagosome in S aureus-infected macrophages In chapter 1, I identified the interaction between Rab43 and Prdx5 in hypoxic kidney To investigate the possible role of Prdx5 on S aureus-host defense via novel Prdx5-Rab43 interaction, I tried to examine interaction of Prdx5 with Rab43 in S aureusinfected macrophages The results revealed that Rab43 did not interacted with Prdx5 in S aureus-infected macrophages and Prdx5’s role on S aureus-host defense might be related with other mechanism Furthermore, albumin has reported for its enhancement on the virulence factor of bacteria As the results, it alters the host-bacterial defense, such as in preventing hemolysin oligomerization in V vulnificus-infected mouse model The interaction between Prdx5 and albumin was proved in hypoxic kidney, but whether Prdx5-Alb interaction exists in V vulnificus-infected mouse model or not is still the question My results suggested that albumin’s role in V vulnificus- host defense was not involved with Prdx5 82 Prdx5 knock-down mouse was proved the alteration in metabolism pathway in hypoxic kidney via shotgun proteomic analysis, especially in fatty acid metabolism Enzymes relating with fatty acid metabolism pathway were increased in Prdx5 knock-down mice during hypoxic stress such as acetyl coA acyltransferase 2, long chain acyl coA dehydrogenase, short chain enyol coA hydratase 1, 3’-phosphoadenosine 5’-phosphosulfate synthase 2, mitochondrial aldehyde dehydrogenase family, member A1 of aldehyde dehydrogenase family, propionyl coA carboxylase beta polypeptide (Pccb) (25) Additionally, in chapter 1, I suggested the novel interaction between Prdx5 with Pcca and Pccb, two components of the propionyl coA carboxylase enzyme-PCC To further study the effect of Prdx5 on fatty acid metabolism, I tried to purify the PCC complex in vitro from Pcca and Pccb From my experiments, I established the optimal IPTG induction for improving Pcca and Pccb’s solubility I also found that Pcca formed the high molecular weight oligomers which in turn prevented PCC complex formation in vitro In previous report, Kelson and collaborators mentioned that Pcca and Pccb oligimerization can reduce the PCC complex productive efficiency about 100 folds, and the possible solution for that problem is co-expressing Pcca, Pccb and some chaperonin proteins (19) These results suggest that the further studies are required to improve the Pcca, Pccb purification process as well as to solve protein oligomerization, special in Pcca 83 References 1) Rhee, S G.; Chae, H.; Kim, K., Peroxiredoxins: a historical overview and speculative preview of novel mechanisms and emerging concepts in cell signaling Free Radic Biol Med, 2005, 38(12): 1543-1552 2) Dubuisson, M.; Vander Stricht, D.; Clippe, A.; Etienne, F.; Nauser, T.; Kissner, R.; Koppenol, W H.; Rees, J F.; Knoops, B., Human peroxiredoxin is a peroxynitrite reductase FEBS Lett, 2004, 571(1-3): 161-165 3) Trujillo, M.; Clippe, A.; Manta, B.; Ferrer-Seuta, G.; Smeets, A.; Declercq, J.P.; Knoops, B.; Radi, R., Pre-steady kinetic characterization of human peroxiredoxin 5: taking advantage of Trp84 fluorescence increase upon oxidation Arch Biochem Biophys, 2007, 467(1): 95-106 4) Knoops, B.; Goemaere, J.; Vander Ecken, V.; Declercg, J P., Peroxiredoxin 5: structure, mechanism, and function of the mammalian atypical 2-Cys peroxiredoxin Antioxid Redox Signal, 2011, 15(3): 817-829 5) Knoops, B.; Clippe, A.; Bogard, C; Arsalane, K.; Wattiez, R.; Hermans, C.; Duconseille, E.; Falmagne, P.; Bernard, A., Cloning and characterization of AOEB166, a novel mammalian antioxidant enzyme of the peroxiredoxin family J Biol Chem, 1999, 274: 30451–30458 6) Avila, P C.; Kropotov, A V.; Krutilina, R.; Krasnodembskay, A.; Tomilin, N V.; Serikov, V B., Peroxiredoxin V contributes to antioxidant defense of lung epithelial cells Lung, 2008, 186(2): 103-114 7) Abbas, K.; Breton, J.; Picot, C R.; Quesniaux, V.; Bouton, C.; Drapier, J C., Signaling events leading to peroxiredoxin up-regulation in immunostimulated macrophages Free Radic Biol Med, 2009, 47(6): 794-802 8) Duan, Y.; Liu, P.; Li, J.; Gao, B.; Chen, P., cDNA cloning, characterization and expression analysis of peroxiredoxin gene in the ridgetail white prawn Exopalaemon carinicauda Mol Biol Rep, 2013, 40(12): 6569-6577 9) Krutilina, R.; Kropotov, A V.; Leutenegger, C.; Serikov, V B., Migrating leukocytes are the sources of peroxiredoxin V during inflammation in the airway J Inflamm (Lond), 2006, 3(13): 1-12 10) Choi, H I.; Chung, K J.; Yang, H Y.; Ren, L N.; Sohn, S.; Kim P R.; Kook, M S.; Choy, H E.; Lee, T H., Peroxiredoxin V selectively regulates IL-6 production by modulating the Jak2-Stat5 pathway Free Radic Biol Med, 2013, 65: 270-279 84 11) Liu, J W.; Lee, I K.; Tang, H J.; Ko, W C.; Lee, H C.; Liu, Y C.; Hsueh, P R.; Chuang Y C.; Prognostic factors and antibiotics in Vibrio vulnificus septicemia Arch Intern Med, 2006, 166(19): 2117-2123 12) Choi, M H.; Sun, H Y.; Park, R Y.; Bai, Y H.; Chung, Y Y.; Kim, C M.; Shin, S H., Human serum albumin enhances the hemolytic activity of Vibrio vulnificus Biol Pharm Bull, 2006, 29(1): 180-182 13) Haas, A K.; Yoshimura, S.; Stephens, D J.; Preisinger, C.; Fuchs, E.; Barr, F A., Analysis of GTPase-activating proteins: Rab1 and Rab43 are key Rabs required to maintain a functional Golgi complex in human cells J Cell Sci, 2007, 120(Pt 17): 22973010 14) Seto, S.; Tsujimura, K.; Koide, Y., Rab GTPases regulating phagosome maturation are differentially recruited to mycobacterial phagosomes Traffic, 2011, 12(4): 407-420 15) Zenner, H L.; Yoshimura, S.; Barr, F A.; Crump, C M., Analysis of Rab GTPaseactivating proteins indicates that Rab1a/b and Rab43 are important for herpes simplex virus secondary envelopment J Virol, 2011, 85(16): 8012-8021 16) Kalousek, F.; Darigo, M D.; Rosenberg, L E., Isolation and characterization of propionyl-CoA carboxylase from normal human liver Evidence for a protomeric tetramer of nonidentical subunits J Biol Chem, 1980, 255(1): 60-65 17) Huang, C S.; Sadre-Bazzaz, K.; Shen, Y.; Deng, B.; Zhou, Z H.; Tong, L., Crystal structure of the α6β6 holoenzyme of propionyl-coezyme A carboxylase Nature, 2010, 466(7309): 1000-1005 18) San-Miguel, T.; Perez-Bermudez, P.; Gavidia, I., Production of soluble eukaryotic recombinant proteins in E.coli is favoured in early log-phase cultures induced at low temperature Springerplus, 2013, 2(1): 89 19) Kelson, T L.; Ohura, T.; Kraus, J P., Chaperonin-mediated assembly of wildtype and mutant subunits of human propionyl-CoA carboxylase expressed in Escherichia coli Hum Mol Genet, 1996, 5(3): 331-337 20) Kaihami, G H.; Almeida, J R.; Santos, S S.; Netto, L E.; Almeida, S.R.; Baldini R L., Involvement of a 1-Cys peroxiredoxin in bacterial virulence PloS Pathog, 2014, 10(10): e1004442 21) Master, S S.; Springer, B.; Sander, P.; Bogettger, E C.; Deretic, V.; Timmins, G S., Oxidative stress reponse genes in Mycobacterum tuberculosis: role of ahpC in resistance 85 to peroxynitrite and stage-specific survival in macrophages Microbiology, 2002, 148(Pt 10): 3139-3144 22) Steele, K H.; Naumgartner, J E.; Valderas, M W.; Roop, R M 2nd, Comparative study of the roles of AhpC and KatE as respiratory antioxidants in Brucella abortus 2308 J Bacteriol, 2010, 192(19): 4912-4922 23) Khoontawad, J.; Wongkham, C.; Hiraku, Y.; Yongvanit, P.; Prakobwong, S.; Boonmars, T.; Pinlaor, P.; Pinlaor, S., Proteomic identification of peroxiredoxin for host defence against Opisthorchis viverrini infection Parasite Immunol, 2010, 32(5): 314-323 24) Ambruso, D R.; Ellison, M A.; Thurman, G W.; Leto, T L., Peroxiredoxin translocates to the plasma membrane during neutrophil activation and is required for optimal NADPH oxidase activity Biochim Biophys Acta, 2012, 1823(2): 306-315 25) Yang, H Y.; Kwon, J.; Cho, E J.; Choi, H I.; Park, C.; Park, H R.; Park, S H.; Chung, K J.; Ryoo, Z Y.; Cho, K O.; Lee, T H., Proteomic analysis of protein expression affected by peroxiredoxin V knock-down in hypoxic kidney J Proteome Res., 2010, 9(8):4003-4015 26) Kropotov, A V.; Grudinkin, P S.; Pleskach, N M.; Gavrilov, B A.; Tomilin, N V.; Zhivotovsky, B.; Downregulation of peroxiredoxin V stimulates formation of etoposideinduced double strand DNA breaks FEBS Lett, 2004, 572(1-3): 75-79 86 퍼옥시리독신 와 Alb, Rab43, Pcca, Pccb 의 상호작용 Tran Gia-Buu 전남대학교 대학원 분자의과학 협동과정 (지도교수: 이태훈) (국문초록) Prdx5 는 퍼록시다아제의 활성을 통해 DNA 손상과 세포 자멸사를 유도하는 스트레스를 막는 것과 같은 세포성 보호 역할들을 한다고 잘 알려져 있는 티올 의존성 퍼록시다아제이다 Prdx5 는 염증반응과 연관이 있다고 보고되었으며, 예를 들어, LPS 를 처리하거나 박테리아에 감염된 동안 토끼의 폐에서 Prdx5 의 발현이 증가하였다 또한 제 장에 제시된 저산소 스트레스 조건에서 Prdx5 상호작용자로 추정한 17 가지 단백질 중 Alb 와 Rab43 은 숙주의 박테리아 감염 방어를 위해 중요한 역할을 하는 것으로 알려져 있다 Prdx5 와 Alb 와 Rab43 사이의 상호작용을 조사하기 위해 세포모델(in vitro)뿐만 아니라 박테리아를 감염시킨 동물 모델(in vivo)을 준비하였고, Prdx5 와 Alb 그리고 Rab43 사이의 상호작용을 각각 조사하였다 본 연구에서는 황색포도상구균에 감염된 모델에서 Prdx5 와 Rab43 의 상호작용, 그리고 비브리오 불니피쿠스가 감염된 모델에서 Prdx5 와 Alb 상호작용을 조사하였다 또한 새로운 타깃 단백질인 Pcca 와 Pccb 는 PCC 복합체의 구성요소이고, 이 단백질 복합체는 프로피오닐 CoA 에서 D-메틸말로닐 CoA 로 전환시키는 반응에 영향을 미친다 만약 이것들이 결핍된다면, 프로피온산에 의해 산성혈증이 유도된다 PCC 활성에 대한 Prdx5 의 효과를 조사하기 위해서 각각의 Pcca 와 Pccb 유전자가 도입된 E-coli 에서 Pcca 와 Pccb 를 과발현시키고 이를 정제하여 in vitro 복합체를 구성해 보고자 하였으나 성공하지 못하였다 추후 지속적인 연구개발을 통해 PCC 복합체 활성에 미치는 Prdx5 의 역할을 규명할 수 있을 것으로 판단된다 87 [...]... comparing the interacted partners in kidneys under normoxia versus hypoxia Here, I suggested Prdx5 interactome using the strategy of immunoprecipitation complex in hypoxic kidney These data will reveal the interaction between putative proteins and Prdx5 in hypoxic kidney and provide better understanding about metabolic homeostasis in hypoxic kidney 4 2 Materials and methods 1) Hypoxic treatment Mice (C57BL/6J)... catalase, Mn-SOD) ( 25- 26) However, the role of peroxireodoxin family in renal hypoxic response, especially Prdx5, have not elucidated yet Recently, Yang and collaborators reported that Prdx5 exerted protective effects in hypoxic kidney by regulating a variety of individual proteins in a set of protein network (27) To gain further insights into the mechanisms regulated by Prdx5 in hypoxic condition,... Valine VEGF Vascular endothelial growth factor VHL Von Hippel-Lindau IX Proteomic analysis of peroxiredoxin 5 interacting proteins in hypoxic kidney Tran Gia-Buu Department of Molecular Medicine Graduate School, Chonnam National University (Supervised by Professor Lee Tae-Hoon) (Abstract) Peroxiredoxin 5 (Prdx5) plays a major role in preventing oxidative damage as an effective antioxidant protein within... interacting partners of Prdx5 in mouse kidney during hypoxia A total of 17 proteins were identified as potential interacting partners of Prdx5 by a comparative interactomic analysis in kidney between normoxia and hypoxia These results will contribute to enhance the understanding of Prdx5’s role in hypoxic stress and may suggest new directions for future research 1 1 Introduction Peroxiredoxin (Prdx, formerly... β-actin and represented in mean ± standard deviation, p