Examination of the ability of Pcca and Pccb to pro- 123docz.net

Chapter 2. Interaction between peroxiredoxin 5 and dihydrolipoamide branched

7) Examination of the ability of Pcca and Pccb to produce PCC complex in vitro

After induction and culturing in optimal condition, bacteria were homogenized in in the lysis buffer containing 50 mM Tris-HCl, 1 mM EDTA, pH 8.0, and proteinase inhibitors cocktail. The bacteria were broken by sonication, and protein extracts were collected by centrifugation. The protein extracts then were applied into Ni-NTA agarose column, the histidine-tagged proteins were eluted in the buffer containing 50 mM Tris-HCl, 1 mM EDTA, pH 8.0, 300 mM imidazole and proteinase inhibitors cocktail. As shown in Figure 8, Pcca was successfully purified with major band at 72 kDa, whereas Pccb existed in elution fraction with one band at 60 kDa and other proteins. These results suggested that Pcca and Pccb were partially purified in this experiment, thus I used these proteins to examine whether they could produce PCC complex in vitro. On the other hand, the purification process need to be improved and more purification steps are required to isolate the high quality Pcca and Pccb for other experiments, such as ion exchange column chromatography.

To test whether Pcca and Pccb can form the PCC complex, I tried to dialysis Pcca and Pccb in the buffer containing 20 mM HEPES, 1mM EDTA, pH 7.4, then Pcca and Pccb were incubated together overnight at 4oC on rotator in molar ratio 1:1. The Pcca, Pccb and Pcca-Pccb complex were loaded and run under reducing SDS-PAGE and native gel condition. As shown in Figure 9, PCC complex did not exist in Pcca-Pccb complex lane in native gel (expected size~750 kDa, a docamer with hexameric Pcca and hexameric Pccb subunits).

Basing on PCC complex structure, hexameric of Pccb forms the central core decorating with monomers of Pcca in each ends of Pccb subunits, I suggested one of possible explanation: Pcca might form the longer chain molecule via oligomerization instead of monomer which in turn prevented PCC complex formation. To investigate this hypothesis, I loaded Pcca, Pccb and Pcca-Pccb complex into SDS-polymer acrylamide gel and run in non-reducing condition. The result revealed that Pcca did not exist in monomer; instead of that, Pcca formed oligomeric molecules which could not enter the gel. This result suggested that PCC complex could not form in vitro with my expression system due to Pcca oligomerization. One of putative solution for producing PCC complex is that Pcca, Pccb and chaperonin proteins, such as groES and groEL, must be co-overexpressed in E. coli system as previous study (19).

Figure 1. Schematic representation to generate V. vulnificus-infected mouse model. For antibiotics treatment, fresh water supplemented with penicillin 100 U/ml, streptomycin 100 àg/ml and amphotericin B 250 ng/ml was supplied during one week. Then, the fresh water without antibiotics was replaced. The mice were kept in starvation one day before experiment.

At the day 0, experiment started with oral infection of 1.0 x 109 CFUs V. vulnificus in 0.1 ml PBS, the mice were intravenously injected with 5% human serum albumin solution (5% HSA) in the dose 0.1 ml/10 g of body weight. The mice were observed, if they died, immediately livers and spleens were collected and stored in -80 oC.

Figure 2. Interaction between Prdx5 and albumin in the spleens and livers collected from V. vulnificus-infected mice. Sham mouse was age-matched mouse with the V. vulnificus- infected mice but it was not infected with V. vulnificus and not injected with human serum albumin. Mice were divided into two groups, with (+) or without (-) albumin administration. To pull down the putative protein interacting with Prdx5, 200 àg of protein extracts from spleens (A) and livers (B) were incubated with 10 àl mouse Prdx5 antibody producing in my laboratory overnight at 4oC, the immunoprecipitated complexes were isolated by protein G agarose (Invitrogen, USA) and were eluted in sample buffer by boiling. The immnunoprecipitated complexes were analysis by western blotting with mouse Prdx5 antibody or albumin antibody (#sc-58688, Santa Cruz, USA). These results revealed that Prdx5 did not interact with albumin in V. vulnificus-infected mice.

Figure 3. Expression of Prdx5 and Rab43 in S. aureus-infected macrophages. In brief, 30 àg of protein extract was subjected into 15% SDS-polyacrylamide gel and expression of Prdx5 and Rab43 were revealed by western blotting with mouse Prdx5 antibody, Rab43 antibody (#sc- 100113, Santa Cruz, USA), and β-actin antibody (#A5441, Sigma, USA). Prdx5 expression was upregulated after infection, reached the peak at 3 hours post infection (p.i). During 6-9 hours p.i Prdx5 was decreased but did not turn back to normal level, then it reached the second maximal peak at 24 hours p.i. In case of Rab43, I observed the decrease of Rab43 expression right after infection, but then Rab43 expression turned back into normal level at 12 hours p.i. These results indicated that S. aureus could upregulate Prdx5 in macrophages.

Figure 4. Interaction between Prdx5 and Rab43 in S. aureus-infected macrophages. 100 àg of protein extract from S. aureus-infected Raw 267.4 cells was incubated with mouse Prdx5 antibody (A) or Rab43 antibody (B). The immnunoprecipitated complex was pulled down by protein G agarose, and results were analyzed by western blotting with mouse Prdx5 antibody and Rab43 antibody (#sc-100113, Santa Cruz, USA). These results showed that Rab43 was not the Prdx5 interactor in S. aureus-infected macrophages.

gb|BC006915.1|_37-2211 AGGTCAACACAATCCCTGGTTTTGATGGGGTAGTAAAGGATGCAGATGAA 600 PCCA-1_T7promoter AGGTCAACACAATCCCTGGTTTTGATGGGGTAGTAAAGGATGCAGATGAA 526 **************************************************

gb|BC006915.1|_37-2211 CCTTATTGTCTGTCAACGTTGATGGCACGCAGAGGACTGTGCAGTGTCTT 1839 PCCA-1_T7terminator CCTTATTGTCTGTCAACGTTGATGGCACGCAGAGGACTGTGCAGTGTCTT 766 **************************************************

gb|BC006915.1|_37-2211 TCTCGGGAAGCAGGTGGAAACATGAGCATCCAGTTTCTTGGCACAGTGTA 1889 PCCA-1_T7terminator TCTCGGGAAGCAGGTGGAAACATGAGCATCCAGTTTCTTGGCACAGTGTA 816 **************************************************

gb|BC006915.1|_37-2211 CAAAGTGCACATTTTAACCAAGCTTGCTGCAGAGCTGAACAAATTCATGC 1939 PCCA-1_T7terminator CAAAGTGCACATTTTAACCAAGCTTGCTGCAGAGCTGAACAAATTCATGC 866 **************************************************

gb|BC006915.1|_37-2211 TTGAAAAAGTGCCCAAGGACACCAGCAGCACTCTGTGCTCCCCGATGCCT 1989 PCCA-1_T7terminator TTGAAAAAGTGCCCAAGGACACCAGCAGCACTCTGTGCTCCCCGATGCCT 916 **************************************************

gb|BC006915.1|_37-2211 GGAGTGGTGGTGGCCGTTTCTGTCAAGCCTGGAGACATGGTAGCAGAAGG 2039 PCCA-1_T7terminator GGAGTGGTGGTGGCCGTTTCTGTCAAGCCTGGAGACATGGTAGCAGAAGG 966 **************************************************

gb|BC006915.1|_37-2211 TCAGGAAATCTGTGTGATTGAAGCTATGAAAATGCAGAACAGTATGACAG 2089 PCCA-1_T7terminator TCAGGAAATCTGTGTGATTGAAGCTATGAAAATGCAGAACAGTATGACAG 1016 **************************************************

gb|BC006915.1|_37-2211 CTGGGAAAATGGGCAAGGTGAAATTGGTGCACTGCAAAGCTGGAGACACA 2139 PCCA-1_T7terminator CTGGGAAAATGGGCAAGGTGAAATTGGTGCACTGCAAAGCTGGAGACACA 1066 **************************************************

gb|BC006915.1|_37-2211 GTTGGTGAAGGAGACCTGCTTGTGGAGCTGGAATGA--- 2175 PCCA-1_T7terminator GTTGGTGAAGGAGACCTGCTTGTGGAGCTGGAACTCGAGCACCACCACCA 1116 *********************************

gb|BC006915.1|_37-2211 --- PCCA-1_T7terminator CCACCACTGAGATCCGGCTGCTAACAAAGCCCGAAAGAAGCTGAGGGCCC 1166

gb|BC037082.1|_21-1646 CTCCAAACACCTTCTTGGTGACACCAACTATGCCTGGCCCACAGCTGAGA 1384 PCCB-2_T7terminator CTCCAAACACCTTCTTGGTGACACCAACTATGCCTGGCCCACAGCTGAGA 982 **************************************************

gb|BC037082.1|_21-1646 TTGCAGTCATGGGAGCAAAGGGTGCTGTGGAGATCATCTTCAAAGGACAC 1434 PCCB-2_T7terminator TTGCAGTCATGGGAGCAAAGGGTGCTGTGGAGATCATCTTCAAAGGACAC 1032 **************************************************

gb|BC037082.1|_21-1646 CAAGATGTCGAAGCCGCCCAGGCAGAGTATGTGGAGAAGTTCGCCATCCC 1484 PCCB-2_T7terminator CAAGATGTCGAAGCCGCCCAGGCAGAGTATGTGGAGAAGTTCGCCATCCC 1082 **************************************************

gb|BC037082.1|_21-1646 TTTCCCAGCAGCCGTGAGAGGGTTTGTGGATGACATCATCCAGCCATCCT 1534 PCCB-2_T7terminator TTTCCCAGCAGCCGTGAGAGGGTTTGTGGATGACATCATCCAGCCATCCT 1132 **************************************************

gb|BC037082.1|_21-1646 CTACTCGTGCTCGGATATGCTGTGACCTGGAAGTCCTGGCCAGCAAGAAG 1584 PCCB-2_T7terminator CTACTCGTGCTCGGATATGCTGTGACCTGGAAGTCCTGGCCAGCAAGAAG 1182 **************************************************

gb|BC037082.1|_21-1646 GTCCATCGTCCCTGGAGGAAACATGCAAATATCCCACTGTGA--- 1626 PCCB-2_T7terminator GTCCATCGTCCCTGGAGGAAACATGCAAATATCCCACTGCTCGAGCACCA 1232 ***************************************

gb|BC037082.1|_21-1646 --- 1626 PCCB-2_T7terminator CCACCACCACCACTGAGATCCGGCTGCTAACAAAGCCCGAAACGTAGCTG 1282

Figure 5. Confirmation of Pcca and Pccb overexpressing vectors. The vector maps of Pcca and Pccb relating construct were represented (A). To confirm the sequence of Pcca overexpressing vector, Pcca overexpressing vector was sent to nucleotide sequencing analysis, then the result was aligned with reference sequence (Accession number: BC006915) and the hexahistidine tag region was highlighted (B). The sequence of Pccb overexpressing vector was compared with reference sequence (Accession number: BC037082) and the hexahistidine tag region was marked (C).

Table 1. The list of primers used for cloning and sequencing Pcca and Pccb constructs.

Gene Primer name

Sequence Purpose

Pcca

Pcca-F 5’-GGGGCTAGCTCTGTGGAATATGAGCCTAAA-3’ Cloning Pcca-R 5’-GGGCTCGAGTTCCAGCTCCACAAGCAG-3’

Pccb

Pccb-F 5’-GGGGCTAGCGGCCTTTGCAGCCAGCCG-3’ Cloning Pccb-R 5’-GGGCTCGAGCAGTGGGATATTTGCATGTTTCC-3’

T7terminator 5’-GCTAGTTATTGCTCAGCGG-3’ Sequencing

Figure 6. Examination of solubility of Pcca and Pccb. In brief, small scale of Pcca and Pccb overexpressing bacteria were induced at mid log phase OD600~0.6 in 1 mM IPTG at 37oC during 4 hours, then the bacteria were harvested by centrifugation. Negative control, without IPTG induction, or total lysate was prepared by boiling the bacteria in sample buffer. Bacteria were broken in lysis buffer by sonication. The clear extract was collected by centrifugation and indicated as supernatant (supt); on the other hand, the pellet (pelt) was collected by suspension the same volume of lysis buffer using to homogenize bacteria. These results indicated that Pcca and Pccb were successfully induced, and 90% of Pcca and Pccb existed in insoluble fraction.

This required optimization for improving Pcca and Pccb solubility.

Figure 7. Optimization of IPTG induction to improve Pccb solubility. Pccb overexpressing bacteria were induced in mid log phase OD600~0.6 at 16oC overnight in different concentration of IPTG (1.0, 0.5, 0.2, 0.1 mM). The bacteria were harvested and broken in lysis buffer, the soluble (S) and insoluble (P) fraction were separated by centrifugation. The result showed that lower concentration of IPTG could produce more total soluble protein. Thus, I chose 0.1 mM IPTG for IPTG induction to harvest higher amount of total protein in the soluble fraction (A). To examine whether inducing IPTG in early log phase could improve Pccb solubility or not, Pccb overexpressing bacteria were induced with 0.1 mM IPTG in early phase (OD600~0.3) for overnight at 4oC (B). Even the total soluble protein was decreased in early-phase-induction, amount of Pccb increased in soluble fraction comparing with mid-log-phase-induction. These data suggested that early phase induction combining with low IPTG concentration was the optimal condition to improve soluble Pccb. Control, the cells without IPTG induction, and total lysate from IPTG induced the cells were boiling in sample buffer and loaded into SDS- polyacrylamide with the same volume.

Figure 8. Purification of Pcca and Pccb. In brief, the protein extracts from Pcca and Pccb overexpressing bacteria were applied into the Ni-NTA agarose column according to the manufacturer’s instruction. The unbound protein was removed by washing several times with the buffer containing 50 mM Tris-HCl, 1mM EDTA, 30 mM imidazole, pH 8.0. The target protein containing hexahistidine tag (His-tag) was eluted and fractionated in the buffer containing 50 mM Tris-HCl, 1mM EDTA, 300 mM imidazole, pH 8.0 in 1ml per fraction. 10 àl of elution fractions (E1-E9) was subjected into SDS-polyacrylamide and visualized by Coomassie blue staining. The result indicated that Pcca was successful purified with major band about 72 kDa in gel (A). Pccb was partly purified with predicted band about 60 kDa and other proteins (B). This result suggested that Pccb needed to be further purified to get the high quality Pccb.

A B

C A B

Figure 9. Examination of the ability of Pcca and Pccb to generate PCC complex. To form PCC complex, Pcca and Pccb were dialyzed in the buffer containing 20 mM HEPES, 1mM ETDA, pH 7.4, then Pcca and Pccb were incubated together in molar ratio 1:1 at 4 oC for overnight in rotator. To investigate whether PCC complex was successfully formed or not, I loaded 5 àg of Pcca, 10 àg of Pccb, and 10 àg of Pcca-Pccb complex into reducing gel (A) or native gel (B), and visualized by Coomassie blue staining. Unfortunately, I could not observed the band in 750 kDa, expected size of PCC complex, on the native gel in lane of Pcca-Pccb complex, this suggested that Pcca and Pccb could not make the PCC complex in this condition.

One of possibility explaining for this phenomenon is that Pcca might be formed oligomer that in turn prevented interaction between Pcca and Pccb. The results from non-reducing gel (C) revealed that Pcca formed oligomers, and Pcca could not enter the gel, even I tried to use lower acrylamide concentration gel (6%) and run longer time (8 hours versus 4 hours in the voltage 80 V). These data suggest that to generate PCC complex, I need more optimization for purification of Pccb and prevent the Pcca oligomerization.

82 4. Discussion

Peroxiredoxin (Prdx) is thought as the family of enzymes ubiquitously expressing in organisms from all kingdoms with variety cellular localizations and exerting the oxidative stress scavenger via its peroxidase activity. A growing body of evidence indicates Prdx not only plays the role in cellular protective function but also involves in host-bacterial defense. To escapes challenges of oxidative burst in macrophages, bacteria evolve the many defense mechanisms, including the simplest way to remove oxidative stress via upregulation of antioxidant enzymes.

Recently, Kaihami and collaborators suggested that LsfA, bacterial 1-Cys peroxiredoxin, protected Pseudomonas aeruginosa against ROS generated via NADPH oxidase in P.

aeruginosa-infected macrophages (20). AhpC, one of the orthologues of peroxiredoxin, was reported that related with Mycobacterium tuberculosis survival in macrophages and combined with KatE, the orthologue of catalse, to enhance the Brucella aborttus 2308 infection in C57BL/6 and BALB/c mice (21-22). In contrast, Prdx also involves in bacteria elimination in host cells. For an example, proteomics analysis revealed that Prdx6, one member of 1-Cys Prdx family, was induced in Opisthorchis viverrini infection model, special in cytoplasm inflammatory cells (23). Moreover, Prdx6 also was suggested as enhancer requiring for optimization of NADPH oxidase in neutrophils (24). Prdx5 also was reported that it upregulated in LPS or bacteria infected cell lines, and regulated interleukin 6 expression, a proinflammatory cytokine (7-10). My data were consistent with previous reports that Prdx5 was upregulated not only in LPS treated macrophages but also in S. aureus-infected macrophages. On the other hand, Rab43 was proved as the Rab GTPase playing the important role for maturation of phagosome in S. aureus-infected macrophages. In chapter 1, I identified the interaction between Rab43 and Prdx5 in hypoxic kidney. To investigate the possible role of Prdx5 on S. aureus-host defense via novel Prdx5-Rab43 interaction, I tried to examine interaction of Prdx5 with Rab43 in S. aureus- infected macrophages. The results revealed that Rab43 did not interacted with Prdx5 in S.

aureus-infected macrophages and Prdx5’s role on S. aureus-host defense might be related with other mechanism. Furthermore, albumin has reported for its enhancement on the virulence factor of bacteria. As the results, it alters the host-bacterial defense, such as in preventing hemolysin oligomerization in V. vulnificus-infected mouse model. The interaction between Prdx5 and albumin was proved in hypoxic kidney, but whether Prdx5-Alb interaction exists in V.

vulnificus-infected mouse model or not is still the question. My results suggested that albumin’s role in V. vulnificus- host defense was not involved with Prdx5.

Prdx5 knock-down mouse was proved the alteration in metabolism pathway in hypoxic kidney via shotgun proteomic analysis, especially in fatty acid metabolism. Enzymes relating with fatty acid metabolism pathway were increased in Prdx5 knock-down mice during hypoxic stress such as acetyl coA acyltransferase 2, long chain acyl coA dehydrogenase, short chain enyol coA hydratase 1, 3’-phosphoadenosine 5’-phosphosulfate synthase 2, mitochondrial aldehyde dehydrogenase 2 family, member A1 of aldehyde dehydrogenase 9 family, propionyl coA carboxylase beta polypeptide (Pccb) (25). Additionally, in chapter 1, I suggested the novel interaction between Prdx5 with Pcca and Pccb, two components of the propionyl coA carboxylase enzyme-PCC. To further study the effect of Prdx5 on fatty acid metabolism, I tried to purify the PCC complex in vitro from Pcca and Pccb. From my experiments, I established the optimal IPTG induction for improving Pcca and Pccb’s solubility. I also found that Pcca formed the high molecular weight oligomers which in turn prevented PCC complex formation in vitro.

In previous report, Kelson and collaborators mentioned that Pcca and Pccb oligimerization can reduce the PCC complex productive efficiency about 100 folds, and the possible solution for that problem is co-expressing Pcca, Pccb and some chaperonin proteins (19). These results suggest that the further studies are required to improve the Pcca, Pccb purification process as well as to solve protein oligomerization, special in Pcca.

84 5. References

1) Rhee, S. G.; Chae, H.; Kim, K., Peroxiredoxins: a historical overview and speculative preview of novel mechanisms and emerging concepts in cell signaling. Free Radic Biol Med, 2005, 38(12): 1543-1552.

2) Dubuisson, M.; Vander Stricht, D.; Clippe, A.; Etienne, F.; Nauser, T.; Kissner, R.;

Koppenol, W. H.; Rees, J. F.; Knoops, B., Human peroxiredoxin 5 is a peroxynitrite reductase. FEBS Lett, 2004, 571(1-3): 161-165.

3) Trujillo, M.; Clippe, A.; Manta, B.; Ferrer-Seuta, G.; Smeets, A.; Declercq, J.P.; Knoops, B.; Radi, R., Pre-steady kinetic characterization of human peroxiredoxin 5: taking advantage of Trp84 fluorescence increase upon oxidation. Arch Biochem Biophys, 2007, 467(1): 95-106.

4) Knoops, B.; Goemaere, J.; Vander Ecken, V.; Declercg, J. P., Peroxiredoxin 5: structure, mechanism, and function of the mammalian atypical 2-Cys peroxiredoxin. Antioxid Redox Signal, 2011, 15(3): 817-829.

5) Knoops, B.; Clippe, A.; Bogard, C; Arsalane, K.; Wattiez, R.; Hermans, C.; Duconseille, E.; Falmagne, P.; Bernard, A., Cloning and characterization of AOEB166, a novel mammalian antioxidant enzyme of the peroxiredoxin family. J Biol Chem, 1999, 274:

30451–30458.

6) Avila, P. C.; Kropotov, A. V.; Krutilina, R.; Krasnodembskay, A.; Tomilin, N. V.;

Serikov, V. B., Peroxiredoxin V contributes to antioxidant defense of lung epithelial cells.

Lung, 2008, 186(2): 103-114.

7) Abbas, K.; Breton, J.; Picot, C. R.; Quesniaux, V.; Bouton, C.; Drapier, J. C., Signaling events leading to peroxiredoxin 5 up-regulation in immunostimulated macrophages. Free Radic Biol Med, 2009, 47(6): 794-802.

8) Duan, Y.; Liu, P.; Li, J.; Gao, B.; Chen, P., cDNA cloning, characterization and expression analysis of peroxiredoxin 5 gene in the ridgetail white prawn Exopalaemon carinicauda. Mol Biol Rep, 2013, 40(12): 6569-6577.

9) Krutilina, R.; Kropotov, A. V.; Leutenegger, C.; Serikov, V. B., Migrating leukocytes are the sources of peroxiredoxin V during inflammation in the airway. J Inflamm (Lond), 2006, 3(13): 1-12.

10) Choi, H. I.; Chung, K. J.; Yang, H. Y.; Ren, L. N.; Sohn, S.; Kim P. R.; Kook, M. S.;

Choy, H. E.; Lee, T. H., Peroxiredoxin V selectively regulates IL-6 production by modulating the Jak2-Stat5 pathway. Free Radic Biol Med, 2013, 65: 270-279.

11) Liu, J. W.; Lee, I. K.; Tang, H. J.; Ko, W. C.; Lee, H. C.; Liu, Y. C.; Hsueh, P. R.; Chuang Y. C.; Prognostic factors and antibiotics in Vibrio vulnificus septicemia. Arch Intern Med, 2006, 166(19): 2117-2123.

12) Choi, M. H.; Sun, H. Y.; Park, R. Y.; Bai, Y. H.; Chung, Y. Y.; Kim, C. M.; Shin, S. H., Human serum albumin enhances the hemolytic activity of Vibrio vulnificus. Biol Pharm Bull, 2006, 29(1): 180-182.

13) Haas, A. K.; Yoshimura, S.; Stephens, D. J.; Preisinger, C.; Fuchs, E.; Barr, F. A., Analysis of GTPase-activating proteins: Rab1 and Rab43 are key Rabs required to maintain a functional Golgi complex in human cells. J Cell Sci, 2007, 120(Pt 17): 2297- 3010.

14) Seto, S.; Tsujimura, K.; Koide, Y., Rab GTPases regulating phagosome maturation are differentially recruited to mycobacterial phagosomes. Traffic, 2011, 12(4): 407-420.

15) Zenner, H. L.; Yoshimura, S.; Barr, F. A.; Crump, C. M., Analysis of Rab GTPase- activating proteins indicates that Rab1a/b and Rab43 are important for herpes simplex virus 1 secondary envelopment. J Virol, 2011, 85(16): 8012-8021.

16) Kalousek, F.; Darigo, M. D.; Rosenberg, L. E., Isolation and characterization of propionyl-CoA carboxylase from normal human liver. Evidence for a protomeric tetramer of nonidentical subunits. J Biol Chem, 1980, 255(1): 60-65.

17) Huang, C. S.; Sadre-Bazzaz, K.; Shen, Y.; Deng, B.; Zhou, Z. H.; Tong, L., Crystal structure of the α6β6 holoenzyme of propionyl-coezyme A carboxylase. Nature, 2010, 466(7309): 1000-1005.

18) San-Miguel, T.; Perez-Bermudez, P.; Gavidia, I., Production of soluble eukaryotic recombinant proteins in E.coli is favoured in early log-phase cultures induced at low temperature. Springerplus, 2013, 2(1): 89.

19) Kelson, T. L.; Ohura, T.; Kraus, J. P., Chaperonin-mediated assembly of wildtype and mutant subunits of human propionyl-CoA carboxylase expressed in Escherichia coli. Hum Mol Genet, 1996, 5(3): 331-337.

20) Kaihami, G. H.; Almeida, J. R.; Santos, S. S.; Netto, L. E.; Almeida, S.R.; Baldini R. L., Involvement of a 1-Cys peroxiredoxin in bacterial virulence. PloS Pathog, 2014, 10(10):

e1004442.

21) Master, S. S.; Springer, B.; Sander, P.; Bogettger, E. C.; Deretic, V.; Timmins, G. S., Oxidative stress reponse genes in Mycobacterum tuberculosis: role of ahpC in resistance

to peroxynitrite and stage-specific survival in macrophages. Microbiology, 2002, 148(Pt 10): 3139-3144.

22) Steele, K. H.; Naumgartner, J. E.; Valderas, M. W.; Roop, R. M. 2nd, Comparative study of the roles of AhpC and KatE as respiratory antioxidants in Brucella abortus 2308. J Bacteriol, 2010, 192(19): 4912-4922.

23) Khoontawad, J.; Wongkham, C.; Hiraku, Y.; Yongvanit, P.; Prakobwong, S.; Boonmars, T.; Pinlaor, P.; Pinlaor, S., Proteomic identification of peroxiredoxin 6 for host defence against Opisthorchis viverrini infection. Parasite Immunol, 2010, 32(5): 314-323.

24) Ambruso, D. R.; Ellison, M. A.; Thurman, G. W.; Leto, T. L., Peroxiredoxin 6 translocates to the plasma membrane during neutrophil activation and is required for optimal NADPH oxidase activity. Biochim Biophys Acta, 2012, 1823(2): 306-315.

25) Yang, H. Y.; Kwon, J.; Cho, E. J.; Choi, H. I.; Park, C.; Park, H. R.; Park, S. H.; Chung, K. J.; Ryoo, Z. Y.; Cho, K. O.; Lee, T. H., Proteomic analysis of protein expression affected by peroxiredoxin V knock-down in hypoxic kidney. J. Proteome Res., 2010, 9(8):4003-4015.

26) Kropotov, A. V.; Grudinkin, P. S.; Pleskach, N. M.; Gavrilov, B. A.; Tomilin, N. V.;

Zhivotovsky, B.; Downregulation of peroxiredoxin V stimulates formation of etoposide- induced double strand DNA breaks. FEBS Lett, 2004, 572(1-3): 75-79

Examination of the ability of Pcca and Pccb to produce PCC complex in vitro

Confirmation of Prdx5 antibody ability to immunoprecipitate