Investigate the function of kinectin isoforms in endoplasmic reticulum dynamics

THE FUNCTION OF KINECTIN ISOFORMS IN ENDOPLASMIC RETICULUM DYNAMICS YAJUAN ZHU (B Eng., Zhejiang Univ., China) A THESIS SUBMITTED FOR THE DEGREE OF MASTER OF SCIENCE GRADUATE PROGRAMME IN BIOENGINEERING NATIONAL UNIVERSITY OF SINGAPORE 2006 ACKNOWLEDGEMENT First of all, I would like to express my deepest gratitude to my supervisor, Associated Professor Hanry Yu, not only for his technical direction in my research work, but also for his philosophical inspiration that would be helpful throughout my life Many of the original ideas in my research came from his inspirational suggestions and fruitful discussion I would also like to express my appreciation to Dr Lee Lee Ong, who patiently helped me through all the techniques and troubleshooting process, as well as to Mrs Pao Chun Lin and Mrs Xin Zhang for their cooperation and all beneficial suggestions on this project I am also grateful to Mr Jun Ni, Mr Xiaotao Pan, Mr Kong Heng Lee and Mr Wangxin Sun for their assistance on cellular imaging and image processing In addition, I would like to thank Dr Ser Mien Chia, Mrs Lijuan He, Mrs San San Susanne Ng and all the other members in Prof Yu’s lab for creating a friendly and happy environment for my research My deepest gratitude goes to my parents and my husband Zhiling for their love, understanding and sacrifice Their support is an indispensable source of my strength and confidence to overcome any barrier Extended appreciation goes to NUS for supporting me financially and providing me the opportunity with the research facilities during my course of research for my master degree i SUMMARY In this project, a basic cell biology problem, the function of kinectin isoforms during ER dynamics, was explored using multiple molecular and cellular imaging techniques Kinectin has been proposed as a membrane anchor for kinesin on intracellular organelles Both the 160 kDa kinectin, an integral transmembrane protein found mainly in the ER, and the 120 kDa form, a truncated version without the N-terminal transmembrane domain, have been reported In addition, there are at least five small inserts (23-33 residues, corresponding to different exons) scattered throughout the C-terminus of kinectin sequence, which also contribute to variable isoforms by alternative splicing In order to explore the function of different kinectin isoforms, a series of EGFP-tagged chimera proteins were constructed including KNT1 (no insert), KNT15 (Int3 only), KNT2 (Int4 only), KNT11 (Int5), KNT9 (Int 3, and 5) Both the 160 kDa and 120 kDa forms have been cloned A HeLa cell line constitutively expressing a DsRed-ER marker (Clontech) was also established (DsRed-ER HeLa) and EGFP-tagged kinectin isoforms were microinjected into this cell line to investigate their subcellular localization relative to ER dynamics under confocal microscopy All five 120 kDa isoforms showed diffused distribution pattern in cytosol with some organelle-like staining in perinuclear areas and obvious accumulation at lamellipodia But no co-localization with ER was observed On the contrary, all five 160 kDa isoforms revealed significant co-localization with ER throughout the cell body Interestingly, two of them, KNT2 and KNT9, which contained Int4, also co-accumulated with ER in the tips of lamellipodium-like structures Live imaging confirmed these were leading edges of migrating cells Since Int4 has been mapped into the minimal kinesin-interacting domain, these observations suggested kinesin mediated transportation along microtubules might contribute to ER dynamics ii during cell migration For the other three isoforms without Int4, neither kinectin themselves nor ER accumulated at the cell periphery To further investigate ER dynamics at the leading edge, a small kinectin fragment harboring Int4, was overexpressed in DsRed-ER HeLa cells The overexpression disrupted the endogenous kinesin-kinectin interaction and inhibited ER extension into the cell periphery The migration speed of these cells also decreased in wound healing assays and the level of decrease was similar to that in kinectin knockdown cells using RNA interference (RNAi) These results suggested kinectin isoforms with Int4 contributed to cell migration by transporting ER to the leading edge along microtubules Furthermore, the importance of Int4 in ER dynamics during cell division was also investigated Z-stack time-lapse imaging of migrating cells revealed intact ER structure with well-regulated dynamics and the strong association with the mitotic spindle throughout mitosis However, when cells were treated with morpholinos which specifically knocked down Int4 containing kinectin isoforms, neither the overall ER dynamics nor the association with the spindle was affected, indicating ER dynamics during mitosis might be kinectinindependent In summary, these results from multiple imaging techniques demonstrated the importance of kinectin isoforms with Int4 in modulating ER dynamics of interphase cells These findings would serve as a platform for more detailed studies of kinectin isoforms The opportunities opened up by quantitative bioimaging might help us to identify subtle differences in their functions in the future iii LIST OF FIGURES Fig 1.1 The structure of kinectin Fig 1.2 Novel kinectin isoforms Fig 1.3 The current model for the maintenance of ER dynamics in mammalian cells Fig 2.1 The cloning strategy of EGFP-tagged kinectin isoforms Fig 2.2 RT-PCR products of the first and second cDNA fragments of 160 kDa kinectin (160Knt1 and Knt2) Fig 2.3 PCR products of the first cDNA fragment of 120 kDa kinectin (120Knt1) Fig 2.4 PCR products of the third cDNA fragments of different kinectin isoforms (Knt3) Fig 2.5 Ligation products of EGFP-tagged kinectin isoforms examined by restriction mapping with EcoR I/Xba I/BamH I Fig 2.6 Ligation products of EGFP-tagged kinectin isoforms estimated by restriction mapping with Hind III Fig 2.7 The survival curve of wild type HeLa cells under G418 selection Fig 2.8 The screening of single clones stably expressing the DsRed-ER marker Fig 2.9 The subcellular localization of EGFP-120 kDa kinectin isoforms and soluble EGFP in DsRed-ER HeLa cells Fig 2.10 The subcellular localization of EGFP-160 kDa kinectin isoforms in DsRed-ER HeLa cells Fig 2.11 The co-accumulation of the ER and 160 kDa kinectin isoforms of Int4 at the leading edge of migrating cells Fig 3.1 The effect of stable expression of pSilencer/KNT RNAi on the endogenous kinectin protein level iv Fig 3.2 Kinectin knockdown using RNAi inhibited the migration of HeLa cells in wound healing assays Fig 3.3 The disruption of kinesin-kinectin interaction through Int4 overexpression resulted in the retraction of ER from the cell migration leading edge Fig 3.4 The overexpression of Int4 fragment inhibited HeLa cell migration in wounding healing assays Fig 3.5 The proposed model for the role of Int4 containing-kinectin isoforms in ER dynamics along microtubules Fig 3.6 Four dimensional (3D plus time) images of the mitotic ER dynamics Fig 3.7 Splicing of kinectin pre-mRNA Exon 40 and the knockdown of Int4 in the presence of morpholinos in DsRed-ER HeLa cells Fig 3.8 Mitotic ER dynamics after morpholino treatment v TABLE OF CONTENTS ACKNOWLEDGEMENT i SUMMARY .ii LIST OF FIGURES iv TABLE OF CONTENTS vi Chapter Introduction 1.1 Cytoskeleton and molecular motors 1.2 Kinectin 1.2.1 An overview of motor protein receptors 1.2.2 Kinectin: a transmembrane receptor for kinesin .6 1.2.3 Kinectin isoforms 1.2.4 Kinectin in organelle motility 11 1.2.5 Other roles of kinectin and its clinical implication 13 1.3 ER dynamics 15 1.3.1 The establishment and maintenance of organelle positions inside cells 15 1.3.2 Microtubule-dependent ER dynamics .15 1.3.3 Actin in the ER movement 18 1.4 Cell migration 19 1.4.1 The four-step concept of cell migration 19 1.4.2 The MT based membrane transport in cell migration .22 1.5 Cell division .25 1.5.1 Membrane partitioning during cell division .25 1.5.2 ER partitioning during mitosis and the role of microtubules 27 vi 1.6 The purpose and rationale of the thesis work 29 Chapter The subcellular localization of kinectin isoforms in DsRed-ER HeLa 31 2.1 The construction of EGFP-tagged kinectin isoforms 32 2.1.1 The isolation of first two fragments of full length kinectin 34 2.1.2 The isolation of variable C-terminus of different kinectin isoforms 39 2.1.3 The construction of EGFP-tagged full-length kinectin isoforms 42 2.2 The establishment of the DsRed-ER HeLa stable cell line 46 2.3 The subcellular localization of kinectin isoforms in DsRed-ER HeLa 51 2.3.1 The distribution of kinectin isoforms in fixed DsRed-ER HeLa 51 2.3.2 The co-accumulation of the ER and 160 kDa kinectin of Int4 at the leading edge of migrating cells 60 Chapter Roles of kinectin Int4 in ER dynamics during cell migration and division 63 3.1 Roles of kinectin Int4 in ER dynamics during cell migration .63 3.1.1 The HeLa cell migration is inhibited by kinectin knockdown using RNAi 64 3.1.2 Int4 overexpression affected ER extension into the leading edge and thus inhibited the HeLa cell migration 70 3.2 Roles of kinectin Int4 in ER dynamics during cell division 77 3.2.1 ER dynamics during cell division 78 3.2.2 The effect of Int4 knockdown on mitotic ER dynamics 83 Chapter Conclusions and future prospects 87 Chapter Materials and Methods 90 5.1 Isolation of kinectin cDNA 90 5.1.1 Isolation of total RNA from Swiss-3T3 cells 90 5.1.2 Quantification of total RNA .90 vii 5.1.3 Reverse Transcription (RT) 91 5.1.4 Polymerase chain reaction (PCR) amplification .91 5.1.5 Agarose gel electrophoresis 94 5.1.6 Extraction of DNA from agarose gel 95 5.1.7 TOPO TA cloning 95 5.1.8 Transformation 96 5.1.9 Small-scale plasmid preparation .96 5.1.10 Restriction endonuclease digestion .97 5.1.11 DNA sequencing 97 5.2 Construction of EGFP-tagged full length kinectin isoforms .98 5.2.1 Restriction endonuclease digestion for ligation 98 5.2.2 Ligation of the four DNA fragments 98 5.2.3 Preparation of competent cells 99 5.2.4 Transformation 99 5.2.5 Medium-scale plasmid preparation .100 5.2.6 Quantification of DNA 100 5.3 Mammalian cell culture .101 5.4 Stable HeLa cell lines expressing the DsRed-ER marker 101 5.4.1 Optimization of G418 concentration 101 5.4.2 Transfection 101 5.4.3 Selection of stably transfected cell lines .102 5.5 Subcellular localization studies of kinectin isoforms 102 5.5.1 Microinjection of EGFP fused kinectin isoforms into DsRed-ER HeLa102 5.5.2 Confocal laser scanning microscopy for fixed cell and live imaging 103 5.6 Stable kinectin knockdown cells lines using pSilencer vectors .103 viii 5.6.1 Establishment of stable lines 103 5.6.2 Estimating the knockdown efficiency by immunoblotting 104 5.7 Wound healing assay 106 5.8 Overexpression studies 106 5.8.1 Plasmid construction .106 5.8.2 Overexpression of the kinectin fragment 106 5.9 Transient knockdown of Exon40 of kinectin using morpholinos 107 5.9.1 Morpholino design 107 5.9.2 Delivery of morpholinos into cells 107 5.9.3 Estimating the knock-down efficiency at mRNA level and protein level 108 REFERENCES 110 ix META For wound healing studies after overexpression, DsRed-ER HeLa cells were plated on 13mm cover slips in 24-well plate and transfected with Int4 fragment/pEGFPC1 or pEGFP-C1 vector using LipofectamineTM 2000 (Invitrogen, USA) Briefly, µg of DNA and µl of Lipofectamine were diluted in 50 µl OPTI-MEM respectively and incubated for The two solutions were combined and allowed to stand for another 20 The medium in 24-well plate was replaced with 500 µl fresh medium and 100 µl of mixture prepared was added into each well The plate was rocked gently before returned back to incubator The mixture was then replaced with fresh medium after 5h incubation Transfected cells were allowed to grow to confluence over 24h and followed by wound healing assay 5.9 Transient knockdown of Exon40 of kinectin using morpholinos 5.9.1 Morpholino design Morpholino oligonucleotides were synthesized by Gene Tools in USA The 25nucleotide morpholino was designed (as below) to target the exon-intron boundary of exon 40 of human kinectin gene (position 3754-3837 in kinectin cDNA sequence GenBankTM accession number: Z22551) The oligos were synthesized with carboxyfluorescein on the 3’ end Target Sequence Int4M Kinectin Exon 40 5'- GGACAAGCTTCTTACCAAATTTAGC -3' CtrM Standard control 5'- CCTCTTACCTCAGTTACAATTTATA -3' 5.9.2 Delivery of morpholinos into cells Morpholinos from Gene Tools were dissolved in sterile DI water to achieve 200 µM of solution Re-constituted oligos were aliqoted and stored in -20oC 400 µM of Endo-Porter of a 100% aqueous solution was from Gene Tools and kept at 4oC 107 DsRedER-HeLa cells were seeded in 48-well plates the day before delivery For each well of 48-well plate, the medium was then replaced with 0.25 ml OPTI-MEM with 12.5 µl morpholinos (final concentration 10 µM) and 3.75 µl Endo-Porter (final concentration µM) After 24h’s incubation, cells were washed with PBS twice, re-fed with fresh complete medium and allowed to grow for 10h to 14h until the cell recovered from serum starving Cells were then trypsinized and transferred into 24-well plate After another 36h’s incubation, cells were re-treated with morpholino (0.5 ml OPTI-MEM with 25 µl morpholinos and 7.5 µl Endo-Porter for each well of 24-well plate) and incubated for 24h After another 10 to 14h’s recovering in complete medium cells were re-trypsinized and plated in 6-well plate or 35 mm culture dish for proper assessment 5.9.3 Estimating the knock-down efficiency at mRNA level and protein level For mRNA analysis using semi-quantitative RT-PCR, total RNA was isolated from cells treated with morpholinos and analyzed by primers flanking the knock-down region (Exon 40) A set of control primers which amplifies the constant domain was used as control Another set of control primers which amplifies the G3PDH gene was used as house keeping gene control The primers design, PCR reaction mix and the cycling programs are listed below Position (bp) Primer 3672-3967 (Exon40) Primer 3244-3578 (Constant Domain) Primer G3PDH Primers 5' GAGAAGAGAACGAGAACATTTG 3' 5' CAATAACAGTAGTGTCTCCAGC 3' 5' GAAAGGCAGCAACAGGTGGA 3' 5' CTGTTTAATAGTCTTGTGTG 3' 5' CCATCACCATCTTCCAGGAG 3' 5' CCTCTGACGCCTGCTTCACC 3' 108 Final Components Volume/Reaction Concentration 10× Taq Buffer with (NH4)2SO4 µl 1× 2.5 mM dNTP mix µl 0.25 mM 10 µM forward primer µl 0.6 µM 10 µM reverse primer µl 0.6 µM Template µl 25mM MgCl2 µl 1.5 mM Taq DNA polymerase (1 u/µl) 1.25 µl 0.02 u/µl DI water 27.75 µl Total Volume 50 µl Total Cycles Step Temperature Duration Initiation 94oC Denaturation 94oC 45 sec Annealing 52.7oC 45 sec Extension 72oC 30 sec Final extension 72oC Numbers 25 For protein analysis using immunoblotting, cells treated with morpholinos were harvested in lysis buffer as descried (5.6.2) 15 µg of proteins were resolved by SDSPAGE on 10% gels and followed by Western blotting for detection of kinectin with Int4 using Anti-Int4 polyclonal antibody (Samtama et al., 2004) Anti-actin polyclonal antibody (Sigma) was used as a loading control 109 REFERENCES Aizawa, H., Sekine, Y., Takemura, R., Zhang, Z., Nangaku, M., and Hirokawa, N (1992) Kinesin family in murine central nervous system J Cell Biol 119: 1287-1296 Alberts, A S., Bouquin, N., Johnston, L H., and Treisman, R (1998) Analysis of RhoAbinding proteins reveals an interaction domain conserved in heterotrimeric G protein beta subunits and the yeast response regulator protein Skn7 J Biol Chem 273: 8616-8622 Alberts, B., Johnson, A., Lewis, J., Raff, M., Roberts, K., and Walter, P (2002) Molecular Biology of the Cell, 4th Edition Chapter 16: 907-982 Allan, V J., and Vale, R D (1991) Cell cycle control of microtubule-based membrane transport and tubule formation in vitro J Cell Biol 113: 347-359 Bergmann, J E., Kupfer, A and Singer, S J (1983) Membrane insertion at the leading edge of motile fibroblasts Proc Natl Acad Sci USA 80: 1367-1371 Bobinnec, Y., Marcaillou, C., Morin, X and Debec, A (2003) Dynamics of the endoplasmic reticulum during early development of Drosophila melanogaster Cell Motil Cytoskeleton 54: 217-225 Blocker, A., Severin, F F., Burkhardt, J K., Bingham, J B., Yu, H., Olivo, J C., Schroer, T A., Hyman, A A., and Griffiths, G (1997) Molecular requirements for bi-directional movement of phagosomes along microtubules J Cell Biol 137: 113-129 Bowman, A B., Kamal, A., Ritchings, B W., Philp, A V., McGrail, M., Gindhart, J G., and Goldstein, L S (2000) Kinesin-dependent axonal transport is mediated by the sunday driver (SYD) protein Cell 103: 583-594 Brady, S T., Pfister, K K., and Bloom, G S (1990) A monoclonal antibody to the heavy chain of kinesin inhibits both anterograde and retrograde axonal transport in squid axoplasm Proc Natl Acad Sci USA 87: 1061-1065 Bretscher, M S (1996) Moving membrane up to the front of migrating cells Cell 85: 465-467 Bridgman, P C (1999) Myosin Va movements in normal and dilute-lethal axons provide support for a dual filament motor complex J Cell Biol 146: 1045-1060 Brooks, P C., Klemke, R L., Schon, S., Lewis, J M., Schwartz, M A and Cheresh, D A (1997) Insulin-like growth factor receptor cooperates with integrin αvβ5 to promote tumor cell dissemination in vivo J Clin Invest 99: 1390-1398 Burridge, K., Chrzanowska-Wodnicka, M and Zhong, C (1997) Focal adhesion assembly Trends Cell Biol 7: 342-347 110 Chang, L., and Goldman, R D (2004) Intermediate filaments mediate cytoskeletal crosstalk Nat Rev Mol Cell Biol 5: 601-613 Clark, E A and Brugge, J S (1995) Integrins and signal transduction pathways: the road taken Science 268: 233-239 Chalfie, M., Tu, Y., Euskirchen, G., Ward, W W., Prasher, D C (1994) Green fluorescent protein as a marker for gene expression Science 263: 802-805 Cole, N B., and Lippincott-Schartz, J (1995) Organization of organelles and membrane traffic by microtubules Curr Opin Cell Biol 7: 55-64 Cooper, M S., Cornell-Bell, A H., Chernjavsky, A., Dani, J W., and Smith, S J (1988) Tubulovesicular processes emerge from the trans-Golgi cisternae, extended along microtubules and interlink adjacent trans-Golgi elements into a reticulum Cell 62: 135145 Condeelis, J (1993) Life at the leading-edge: the formation of cell protrusions Annu Rev Cell Biol 9: 411-444 Cortese, J., Schwab, B., Frieden, C., and Elson, E L (1989) Actin polymerization induces a shape change in actin-containing vesicles Proc Natl Acad Sci USA 86: 57735777 Dagenbach, E M., and Endow, S A (2004) A new kinesin tree J Cell Sci 117: 3-7 Dailey, M E and Bridgman, P C (1989) Dynamics of the endoplasmic reticulum and other membranous organelles in growth cones of cultured neurons J Neurosci 9: 18971909 Danowski, B A (1989) Fibroblast contractility and actin organization are stimulated by microtubule inhibitors J Cell Sci 93: 255-266 Du, Y., Ferro-Novik S and Novick, P (2004) Dynamics and inheritance of the endoplasmic reticulum J Cell Sci 117: 2871-2878 Duband, J L., Rocher, S., Chen, W T., Yamada, K M and Thiery, J P (1986) Cell adhesion and migration in the early vertebrate embryo: location and the possible role of the putative bronectin receptor complex J Cell Biol 102: 160-178 Dunlevy, J R and Couchmann, J R (1995) Interleukin-8 induces motile behavior and loss of focal adhesions in primary fibroblasts J Cell Sci 108: 311-321 Ellenberg, J., Siggia, E D., Moreira, J E., Smith, C L., Presley, J F., Worman, H J and Lippincott-Schwartz, J (1997) Nuclear membrane dynamics and reassembly in living cells: targeting of an inner nuclear membrane protein in interphase and mitosis J Cell Biol 138: 1193-1206 111 Enomoto, T (1996) Microtubule disruption induces the formation of actin stress fibers and focal adhesions in cultured cells: possible involvement of the rho signal cascade Cell Struct Funct 21: 317-326 Etienne-Manneville, S (2004) Actin and microtubules in cell motility: which one is in control? Traffic 5: 470-477 Euteneuer, U and Schliwa, M (1984) Persistent, directional motility of cells and cytoplasmic fragments in the absence of microtubules Nature 310: 58-61 Feiguin, F., Ferreira, A., Kosik, K., Caceres, A (1994) Kinesin mediated organelle translocation revealed by specific cellular manipulations J Cell Biol 127: 1021-1039 Ferrara, N., Gerber, H P and LeCouter, J (2003) The biology of VEGF and its receptors Nat Med 9(6): 669-76 Friedl, P., Brocker, E B and Zanker, K S (1998) Integrins, cell matrix interactions and cell migration strategies: fundamental differences in leukocytes and tumor cells Cell Adhesion Commun 6: 225-236 Friedl, P., Entschladen, F., Conrad, C., Niggemann, B and Zanker, K S (1998) T lymphocytes migrating in 3-D collagen lattices lack focal adhesions and utilize β1 integrin-independent strategies for polarization, interaction with collagen fibers, and migration Eur J Immunol 28: 2331-2343 Firtel, R A., and Chung, C Y (2000) The molecular genetics of chemotaxis: sensing and responding to chemoattractant gradients Bio Essays 22: 603-615 Fuchs, E., and Karakeisoglou, I (2001) Bridging cytoskeletal intersections Genes Dev 15: 1-14 Futterer, A., Kruppa, G., Kramer, B., Lemke, H., and Kronke, M (1995b) Molecular cloning and characterization of human kinectin Mol Biol Cell 6: 161-170 Gho, M., McDonald, K., Ganetzky, B., and Saxton, W M (1992) Effects of kinesin mutations on neuronal functions Science 258: 313-316 Goldstein, L., and Gunawardena, S (2000) Flying through the drosophila cytoskeletal genome J Cell Biol 150: F63-68 Goshima, G and Vale, R D (2003) The roles of microtubule-based motor proteins in mitosis: comprehensive RNAi analysis in the Drosophila S2 cell line J Cell Biol 162(6): 1003-1016 Gundersen, G G and Bulinski, J C (1988) Selective stabilization of microtubules oriented toward the direction of cell migration Proc Natl Acad Sci USA 85: 5946-5950 Haas, J., Park, E C and Seed, B (1996) Codon usage limitation in the expression of HIV-1 envelope glycoprotein Curr Biol 6: 315-324 112 Hall, A (1994) Small GTP-binding protein and the regulation of actin cytoskeleton Annu Rev Cell Biol 10: 31-54 Heidmann, S R and Buxbaum, R E (1998) Cell crawling: first the motor, now the transmission J Cell Biol 141: 1-4 Helfand, B T., Mikami, A., Vallee, R B., and Goldman, R D (2002) A requirement for cytoplasmic dynein and dynactin in intermediate filament network assembly and organization J Cell Biol 157: 795-806 Henson, J H., Nesbitt, D., Wright, B D., and Scholey, J M (1992) Immunolocalization of kinesin in sea urchin coelomocytes Association of kinesin with intracellular organelles J Cell Sci 103: 309-320 Hermann, H., Hesse, M., Reichenzeller, M., Aebi, U., and Magin, T M (2003) Functional complexity of intermediate filament cytoskeletons, from structure to assembly to gene ablation Int Rev Cytol 223: 83-175 Heuser, J (1989) Changes in lysosome shape and distribution correlated with changes in cytoplasmic pH J Cell Biol 108: 855-864 Hirano, N., Butler, M O., Guinan, E C., Nadler, L M., and Kojima, S (2005) Presence of anti-kinectin and anti-PMS1 antibodies in Japanese aplastic anaemia patients Br J Haematol 128: 221-223 Hirano, N., Butler, M O., Bergwelt-Baildon, M S., Maecker, B., Schultze, J L., O'Connor, K C., Schur, P H., Kojima, S., Guinan, E C., and Nadler, L M (2003) Autoantibodies frequently detected in patients with aplastic anemia Blood 102: 45674575 Hirokawa, N (1998) Kinesin and dynein superfamily proteins and the mechanism of organelle transport Science 279: 519-526 Hirokawa, N., Pfister, K K., Yorifuji, H., Wagner, M C., Brady, S T., and Bloom, G S (1989) Submolecular domains of bovine brain kinesin identified by electron microscopy and monoclonal antibody decoration Cell 56: 867-878 Hollenbeck, P J (1989) The distribution, abundance and subcellular localization of kinesin J Cell Biol 108: 2335-2342 Hopkins, C R., Gibson, A., Shipman, M., Strickland, D K and Trowbridge, I S (1994) In migrating fibroblasts, recycling receptors are concentrated in narrow tubules in the pericentriolar area, and then routed to the plasma membrane of the leading lamella J Cell Biol 125: 1265-1274 Hopkins, C R., Gibson, A., Shipman, M., and Miler, K (1990) Movement of internalized ligand-receptor complexes along a continuous endosomal reticulum Nature 346: 335-339 113 Hotta, K., Tanaka, K., Mino, A., Kohno, H., and Takai, Y (1996) Interaction of the Rho family small G proteins with kinectin, an anchoring protein of kinesin motor Biochem Biophys Res Commun 225: 69-74 Howard, J., and Hyman, A A (2003) Dynamics and mechanics of the microtubule plus end Nature 422: 753-758 Hughes, P.E and Pfaff, M (1998) Integrin affinity modulation Trends Cell Biol 8: 359364 Hurtley, S H., and Helenius, A (1989) Protein oligomerization in the endoplasmic reticulum Ann Rev Cell Biol 5: 277-307 Huttenlocher, A., Sandborg, R R and Horwitz, A F (1995) Adhesion in cell migration Curr Opin Cell Biol 7: 697-706 Ilic, B., Furuta, Y., Kanazawa, S., Takeda, N., Sobue, K., Nakatsuji, M., Nomura, S., Fujimoto, J., Okada, M., Yamamoto, T (1995) Reduced motility and enhanced focal adhesion contact formation in cells from FAK-deficient mice Nature 377: 539-543 Ioshii, S O., Yoshida, T., Imanaka-Yoshida, K and Izutsu, K (1995) Distribution of a Ca2+ storing site in PtK2 cells during interphase and mitosis An immunocytochemical study using an antibody against calreticulin Eur J Cell Biol 66: 82-93 Jockusch, B M., Bubeck, P., Giehl, J., Kroemker, M., Moschner, J., Rothkegel, M., Rudiger, M., Schluter, K., Stanke, G., Winkler, J (1995) The molecular architecture of focal adhesions Annu Rev Cell Biol 11: 379-416 Kachar, B and Reese, T S (1988) The mechanism of cytoplasmic streaming in characean algal cells: sliding of endoplasmic reticulum along actin filaments J Cell Biol 106: 1545-1552 Kamal, A., Goldstein, L S (2002) Principles of cargo attachment to cytoplasmic motor proteins Curr Opin Cell Biol 14(1): 63-68 Kamal, A., Almenar-Queralt, A., LeBlanc, J F., Roberts, E A., and Goldstein, L S (2001) Kinesin-mediated axonal transport of a membrane compartment containing betasecretase and presenilin-1 requires APP Nature 414: 643-648 Kamal, A., and Goldstein, L S (2000) Connecting vesicle transport to the cytoskeleton Curr Opin Cell Biol 12: 503-508 Kaverina, I., Rottner, K and Small, J V (1998) Targeting, capture, and stabilization of microtubules at early focal adhesions J Cell Biol 142: 181-190 Kaverina, I., Krylyshkina, O and Small, J V (1999) Microtubule targeting of substrate contacts promotes their relaxation and dissociation J Cell Biol 146: 1033-1044 114 Keller, H U., Naef, A., Zimmermann, A (1984) Effects of colchicine, vinblastine and nocodazole on polarity, motility, chemotaxis and cAMP levels of human polymorphonuclear leukocytes Exp Cell Res 153: 173-185 Klopfenstein, D R., Vale, R D., and Rogers, S L (2000) Motor protein receptors: moonlighting on other jobs Cell 103: 537-540 Krijnse-Locker, J., Parton, R G., Fuller, S D., Griffiths, G., and Dotti, C G (1995) The organization of the endoplasmic reticulum and the intermediate compartment in cultured rat hippocampal neurons Mol Biol Cell 6: 1315-1332 Krylyshkina, O., Anderson, K I., Kaverina, I., Upmann, I., Manstein, D J., Small, J V and Toomre, D K (2003) Nanometer targeting of microtubules to focal adhesions J Cell Biol 161(5): 853-859 Kumar, J., Erickson, H P., and Sheetz, M P (1998) Ultrastructural and biochemical properties of the 120-kDa form of chick kinectin J Biol Chem 273: 31738-31743 Kumar, J., Yu, H., and Sheetz, M P (1995) Kinectin, an essential anchor for kinesindriven vesicle motility Science 267: 1834-1837 Lane, J., and Allan, V (1998) Microtubule-based membrane movement Biochim Biophys Acta 1376: 27-55 Lane, J D., and Allan, V J (1999) Microtubule-based Endoplasmic Reticulum Motility in Xenopus laevis: Activation of Membrane-associated Kinesin during Development Mol Biol Cell 10: 1909-1922 Langford, G M (1995) Actin- and microtubule-dependent organelle motors: interrelationships between the two motility systems Curr Opin Cell Biol 7: 82-88 Lee, C., Ferguson, M., and Chen, L B (1989) Construction of the endoplasmic reticulum J Cell Biol 109: 2045-2055 Lee, C., and Chen, L B (1988) Behavior of endoplasmic reticulum in living cells Cell 54: 37-46 Leung, E., Print, C G., Parry, D A., Closey, D N., Lockhart, P J., Skinner, S J., Batchelor, D C., and Krissansen, G W (1996) Cloning of novel kinectin splice variants with alternative C-termini: structure, distribution and evolution of mouse kinectin Immunol Cell Biol 74: 421-433 Liao, G., Nagasaki, T and Gundersen, G G (1995) Low concentrations of nocodazole interfere with fibroblast locomotion without significantly affecting microtubule level: implications for the role of dynamic microtubules in cell locomotion J Cell Sci 108: 3473-3483 Lichtscheidl, I K., Lancelle, S A and Hepler, P K (1990) Actinendoplasmic reticulum complexes in Drosera Protoplasma 155: 116-126 115 Lippincott-Schwartz, J., Cole, N B., Marotta, A., Conrad, P A., and Bloom, G S (1995) Kinesin is the motor for microtubule-mediated Golgi-to-ER membrane traffic J Cell Biol 128: 293-306 [published errata appear in J Cell Biol 1995 Mar 128(5): 988 and 1995 May 129(3): 893] Lippincott-Schwartz, J., Glickman, J., Donaldson, J G., Robbins, J., Kreis, T E., Seamon, K B., Sheetz, M P., and Klausner, R D (1991) Forskolin inhibits and reverses the effects of brefeldin A on Golgi morphology by a cAMP-independent mechanism J Cell Biol 112: 567-577 Longhurst, C M and Jennings, L K (1998) Integrin-mediated signal transduction Cell Mol Life Sci 54: 514-526 Machleidt, T., Geller, P., Schwandner, R., Scherer, G., and Kronke, M (1998) Caspase 7-induced cleavage of kinectin in apoptotic cells FEBS Lett 436: 51-54 Masurosky, E., Peterson, E., Crain, S., and S., H (1981) Microtubule arrays in taxoltreated mouse dorsal root ganglion-spinal cord cultures Brain Res 217: 392-398 Matheson, J., Yu, X., Fielding, A.B., Gould, G.W (2005) Membrane traffic in cytokinesis Biochem Soc Trans 33(Pt 6): 1290-1294 Matz, M V., Fradkov, A F., Labas, Y A., Savitsky, A P., Zaraisky, A G., Markelov, M L and Lukyanov, S A (1999) Fluorescent proteins from nonbioluminescent Anthozoa species Nature Biotechnology 17: 969-973 Meyer, G., and Feldman, E L (2002) Signalling mechanisms that regulate actinbased motility processes in the nervous system J Neurochem 83: 490-503 Miki, H., Setou, M., Kaneshiro, K., and Hirokawa, N (2001) All kinesin superfamily protein, KIF, genes in mouse and human Proc Natl Acad Sci USA 98: 7004-7011 Nabi, I R (1999) The polarization of the motile cell J Cell Sci 112: 1803-1811 Nakagawa, T., Setou, M., Seog, D., Ogasawara, K., Dohmae, N., Takio, K., and Hirokawa, N (2000) A novel motor, KIF13A, transports mannose-6-phosphate receptor to plasma membrane through direct interaction with AP-1 complex Cell 103: 569-581 Niclas, J., Navone, F., Hom-Booher, N., and Vale, R D (1994) Cloning and localization of a conventional kinesin motor expressed exclusively in neurons Neuron 12: 1059-1072 Nogales, E., Whittaker, M., Milligan, R A., and Downing, K H (1999) Highresolution model of the microtubule Cell 96: 79-88 Ong, L L (2005) Characterization the role of Kinectin in assembly of translation elongation complex to endoplasmic reticulum and its involvement in organelle motility PhD dissertation at National University of Singapore 116 Ong, L L., Er, C P., Ho, A., Aung, M T., and Yu, H (2003) Kinectin Anchors the Translation Elongation Factor-1δ to the Endoplasmic Recticulum J Biol Chem 278: 32115-32123 Ong, L L., Lim, A P., Er, C P., Kuznetsov, S A., and Yu, H (2000) Kinectin-Kinesin binding domains and their effects on organelle motility J Biol Chem 275: 32854-32860 Parton, R G., Dotti, C G., Bacallo, R., Kurtz, I., Simons, K., and Prydz, K (1991) pHinduced microtubule -dependent redistribution of late endosomes in neuronal and epithelial cells J Cell Biol 113: 261-274 Pearson, H (2002) Surviving a knockout blow Nature 415: 8-9 Pfister, K K., Wagner, M C., Stenoien, D L., Brady, S T., and Bloom, G S (1989) Monoclonal antibodies to kinesin heavy and light chains stain vesicle-like structures, but not microtubules, in cultured cells J Cell Biol 108: 1453-1463 Plitz, T., and Pfeffer, K (2001) Intact lysosome transport and phagosome function despite kinectin deficiency Mol Cell Biol 21: 6044-6055 Prinz, W A., Grzyb, L., Veenhuis, M., Kahana, J A., Silver, P A and Rapoport, T A (2000) Mutants affecting the structure of the cortical endoplasmic reticulum in Saccharomyces cerevisiae J Cell Biol 150: 461-474 Rodionov, V I., Gyoeva, F K., Tanaka, E., Bershadsky, A D., Vasiliev, J M and Gelfand, V I (1993) Microtubule-dependent control of cell shape and pseudopodial activity is inhibited by the antibody to kinesin motor domain J Cell Biol 123: 1811-1820 Romberg, L., Pierce, D W., and Vale, R D (1998) Role of the kinesin neck region in processive microtubule-based motility J Cell Biol 140: 1407-1416 Rubin, G M., Yandell, M D., Wortman, J R., Gabor Miklos, G L., Nelson, C R., Hatiharan, I K., Fortini, M E., Li, P W., Apweiler, R., and Fleischmann, W (2000) Comparative genomics of the eukaryotes Science 287: 2204-2215 Santama, N., Er, C P N., Ong, L L and Yu, H (2004) Distribution and functions of kinectin isoforms J Cell Sci 117: 4537-4549 Schafer, D A., and Cooper, J A (1995) Control of actin assembly at filament ends Annu Rev Cell Biol 11: 497-518 Schmitz, F., Wallis, K T., Rho, M., Drenckhahn, D., and Murphy, D B (1994) Intracellular distribution of kinesin in chromaffin cells Eur J Cell Biol 63: 77-83 Schroer, T A., and Sheetz, M P (1991) Two activators of microtubule-based vesicle transport J Cell Biol 115: 1309-1318 Sheetz, M P., Felsenfeld, D P and Galbraith, G (1998) Cell migration: regulation of force on extracellular matrix-integrin complexes Trends Cell Biol 8: 51-54 117 Sheetz, M P., and Yu, H (1996) Regulation of the kinesin and cytoplasmic dynein driven organelle motility Seminars Cell & Devel Biol 7: 329-334 Smilenov, L B., Mikhailov, A., Pelham, R J Jr, Marcantonio, E E and Gundersen, G G (1999) Focal adhesion motility revealed in stationary broblasts Science 285: 1172-1174 Snapp, E L., Hegde, R S., Francolini, M., Lombardo, F., Colombo, S., Pedrazzini, E., Borgese, N., Lippincott-Schwartz, J (2003) Formation of stacked ER cisternae by low affinity protein interactions J Cell Biol 163(2): 257-269 Southern, P J and Berg, P (1982) Transformation of mammalian cells to antibiotic resistance with a bacterial gene under control of the SV40 early region promoter J Mol Appl Gen 1: 327-341 Staehelin, L A (1997) The plant ER: a dynamic organelle composed of a large number of discrete functional domains Plant J 11: 1151-1165 Stürmer, K., Baumann, O and Walz, B (1995) Actin-dependent lightinduced translocation of mitochondria and ER cisternae in the photoreceptor cells of the locust Schistocerca gregaria J Cell Sci 108: 2273-2283 Sun, H Q., Kwiatkowska, K., and Yin, H L (1995) Actin monomer binding proteins Curr Opin Cell Biol 7: 102-119 Swanson, J., Burke, E., and Silverstein, S C (1987) Tubular lysosomes accompany stimulated pinocytosis in macrophages J Cell Biol 104: 1217-1222 Tabb, J S., Molyneaux, B J., Cohen, D L., Kuznetsov, S A., and Langford, G M (1998) Transport of ER vesicles on actin filaments in neurons by myosin V J Cell Sci 111: 3221-3234 Takeda, S., Yamazaki, H., Seog, D H., Kanai, Y., Terada, S., and Hirokawa, N (2000) Kinesin superfamily protein (KIF3) motor transports fodrin- associating vesicles important for neurite building J Cell Biol 148: 1255-1265 Tanaka, Y., Kanai, Y., Okada, Y., Nonaka, S., Takeda, S., Harada, A., Hirokawa, N (1998) Targeted disruption of mouse conventional kinesin heavy chain, kif5B, results in abnormal perinuclear clustering of mitochondria Cell 93:1147-1158 Terasaki, M (2000) Dynamics of the endoplasmic reticulum and golgi apparatus during early sea urchin development Mol Biol Cell 11: 897-914 Terasaki, M and Reese, T S (1994) Interactions among endoplasmic reticulum, microtubules, and retrograde movements of the cell surface Cell Motil Cytoskeleton 299: 291-300 Terasaki, M., Chen, L B., and Fujiwara, K (1986) Microtubules and the endoplasmic reticulum are highly interdependent structures J Cell Biol 103: 1557-1568 118 Tokunaga, S., Friedman, T., Toyama, Y., Pacifici, M., and Holtzer, H (1983) Taxol induces microtubule-rough endoplasmic reticulum complexes and microtubulebundles in cultured chondroblasts Differentiation 24: 39-47 Toyoshima, I., Yu, H., Steuer, E R., and Sheetz, M P (1992) Kinectin, a major kinesinbinding protein on ER J Cell Biol 118: 1121-1131 Tran, H., Pankov, R., Tran, S D., Hampton, B., Burgess, W H., and Yamada, K M (2002) Integrin clustering induces kinectin accumulation J Cell Sci 115: 2031-2040 Tuschul, T (2002) Expanding small RNA interference Nat Biotechnology 20: 446-448 Tzivion, G., Luo, Z J., and Avruch, J (2000) Calyculin A-induced vimentin phosphorylation sequesters 14-3-3 and displaces other 14-3-3 partners in vivo J Biol Chem 275: 29772-29778 Vale, R D., and Fletterick, R J (1997) The design plan of kinesin motors Annu Rev Cell Dev Biol 13: 745-777 van Horck, F P., Ahmadian, M R., Haeusler, L C., Moolenaar, W H and Kranenburg, O (2001) Characterization of p190 RhoGEF, a RhoA-specific guanine nucleotide exchange factor that interacts with microtubules J Biol Chem 276: 4948-4956 Vancoillie, G., Lambert, J., Mulder, A., Koerten, H K., Mommaas, A M., Van Oostveldt, P., and Naeyaert, J M (2000) Kinesin and kinectin can associate with the melanosomal surface and form a link with microtubules in normal human melanocytes J Invest Dermatol 114: 421-429 Verhey, K J., Meyer, D., Deehan, R., Blenis, J., Schnapp, B J., Rapoport, T A and Margolis, B (2001) Cargo of kinesin identified as JIP scaffolding proteins and associated signaling molecules J Cell Biol 152: 959-970 Vignal, E., Blangy, A., Martin, M., Gauthier-Rouviere, C., and Fort, P (2001) Kinectin is a key effector of RhoG microtubule-dependent cellular activity Mol Cell Biol 21: 8022-8034 Wang, H C., Su, Y R., Han, K J., Pang, X W., Peng, J R., Liang, B., Wang, S., and Chen, W F (2004) Multiple variants and a differential splicing pattern of kinectin in human hepatocellular carcinoma Biochemistry and Cell Biology 82(2): 321-327 Wadsworth, P (1999) Regional regulation of microtubule dynamics in polarized, motile cells Cell Motil Cytoskeleton 42: 48-59 Warren, G (1993) Membrane partitioning during cell division Annu Rev Biochem 62: 324-348 Watanabe, T., Noritake, J., Kaibuchi, K (2005) Regulation of microtubules in cell migration Trends Cell Biol 15(2): 76-83 119 Waterman-Storer, C M., Worthylake, R A., Liu, B P., Burridge, K and Salmon, E D (1999) Microtubule growth activates Rac1 to promote lamellipodial protrusion in fibroblasts Nat Cell Biol 1: 45-50 Waterman-Storer, C M., Sanger, J W and Sanger, J M (1993) Dynamics of organelles in the mitotic spindles of living cells: membrane and microtubule interactions Cell Motil Cytoskeleton 26: 19-39 Waterman-Storer, C M., and Salmon, E D (1998) Endoplasmic reticulum membrane tubules are distributed in living cells by three distinct microtubule dependent mechanisms Curr Biol 8: 798-806 Wittmann, T and Waterman-Storer, C M (2001) Cell motility: can Rho GTPases and microtubules point the way? J Cell Sci 114: 3795-3803 Xu, J., Bird, P H., Bradley, M P., Janssens, P A., and Hardy, C M (2002) Molecular cloning and characterization of fox testis kinectin Mol Reprod Dev 62: 37-46 Yabe, J T., Jung, C., Chan, W K., and Shea, T B (2000) Phospho-dependent association of neurofilament proteins with kinesin in situ Cell Motil Cytoskeleton 45: 249-262 Yamada, K M and Geiger, B (1997) Molecular interactions in cell adhesion complexes Curr Opin Cell Biol 9: 76-85 Yang, L., Guan, T and Gerace, L (1997) Integral membrane proteins of the nuclear envelope are dispersed throughout the endoplasmatic reticulum during mitosis J Cell Biol 137: 1199-1210 Yonekawa, Y., Harada, A., Okada, Y., Funakoshi, T., Kanai, Y., Takei, Y., Terada, S., Noda, T., and Hirokawa, N (1998) Defect in synaptic vesicle precursor transport and neuronal cell death in KIF1A motor protein-deficient mice J Cell Biol 141: 431-441 Yu, H., Nicchitta, C V., Kumar, J., Becker, M., Toyoshima, I., and Sheetz, M P (1995) Characterization of kinectin, a kinesin-binding protein: primary sequence and N-terminal topogenic signal analysis Mol Biol Cell 6: 171-183 Yvon, A M and Wadsworth, P (2000) Region-specific microtubule transport in motile cells J Cell Biol 151: 1003-1012 Zhao, C., Takita, J., Tanaka, Y., Setou, M., Nakagawa, T., Takeda, S., Yang, H W., Terada, S., Nakata, T., Takei, Y., Saito, M., Tsuji, S., Hayashi, Y., Hirokawa, N (2001) Charot-Marie-Tooth disease type 2A caused by mutation in a microtubule motor KIF1Bβ Cell 105: 587-597 Zhelev, D V., Alteraifi, A M., and Chodniewicz, D (2004) Controlled pseudopod extension of human neutrophils stimulated with different chemoattractants, Biophys J 87: 688-695 120 Zigmond, S H (1996) Signal transduction and actin filament organization Curr Opin Cell Biol 8: 66-73 121 [...]... complexes The minimal kinesin-interacting domain of kinectin has been mapped between residue 1188-1288, which consists of the part of insert 3 (Int3), the whole of Int4 and the constant domain linking Int3 and Int4 (Ong et al., 2000) This region enhances the microtubule stimulated ATPase activity of kinesin and inhibits the kinesin-dependent lysosome motility Isoforms containing Int2 are overexpressed in. .. recognizing the N-terminal end of kinectin failed to reveal the localization of kinectin to mitochondria, a recent study reported the specific accumulation of 120 kDa kinectins but not 160 kDa ones in the mitochondrialenriched fraction (Santama et al., 2004) Overexpression of kinesin binding fragment of kinectin resulted in perinuclear clustering of mitochondria, which is strikingly reminiscent of the. .. that the overexpression of kinesin binding fragments of kinectin in COS7 cells inhibited the kinesin-mediated redistribution of lysosomes to the cell periphery upon acetate treatment, which indicates a role of kinectin in the motility of lysosomes (Ong et al., 2000) In the same study, it was also reported that kinectin can bind to the neuronal kinesin heavy chain subunits, KIF5A and KIF5C, as well as the. .. significance of kinectin in organelle motility remains to be elucidated in vivo 12 1.2.5 Other roles of kinectin and its clinical implication Besides the interaction with kinesin, the evidence that kinectin functions in some other specialized pathways is emerging Hotta et al (1996) found the interaction of kinectin with Rho family GTPases during a yeast two-hybrid screen for RhoA-interacting proteins The Rho... C-terminal coiled coilforming cytoplasmic part A shorter 120-kDa kinectin, lacking the initial 232 N-terminal residues, may bind to 160-kDa kinectin as a heterodimer Either 160 kDa or 120 kDa kinectin alone may also form homodimers There are at least five short inserts scattered throughout the C-terminus, whose alternative splicing contributes to variable isoforms 1.2.3 Kinectin isoforms Two kinectin isoforms. .. identification of total of 16 kinectin isoforms 9 reveals the long-suspected existence of a family of kinectin isoforms Since the C-domain is exposed for interaction with motor proteins or other molecules whereas N-terminus is embedded in the membrane, the existence of alternative C-terminal ends may have functional relevance such as determining the directionality of transport or modulating motility of motor-membrane... Yu et al., 1995) In motor neurons, the cell bodies and dendrites were punctuately stained with anti -kinectin antibodies However, kinectin was not found in the axons where kinesin was detected (Hollenbeck, 1989; Niclas et al., 1994) ER TM Int1 Int2 Int3 Int4 Int5 Kinectin Fig 1.1: The structure of kinectin The full length kinectin comprises an N-terminal transmembrane domain spanning the ER membrane... consistent with the inhibition of ER motility by anti-kinesin or anti -kinectin antibodies in in vitro assays (Land and Allan, 1999; Kumar et al., 1995) There are contradicting evidences of the roles of cytoplasmic dynein in ER dynamics in vivo (Lane and Allan, 1999) 17 ER ? Kinesin (Kif 5) Nuclear Actin? MT (dynein)? MT (-) MTOC (+) Fig 1.3: The current model for the maintenance of ER dynamics in mammalian... phenotype in conventional kinesin heavy chain deficient cells (Tanaka et al., 1998) The author concluded from these observation that the interaction of 120 kDa kinectin with kinesin influence mitochondrial dynamics Besides ER and mitochondrial, kinectin was also found on isolated phagosomes (Blocker et al., 1997) The function- blocking kinectin antibodies have the capacity to inhibit phagosome motility in. .. found in distinct cell types and developmental stages in mouse hippocampus (Santama et al., 2004) Isoforms marked with a star were constructed for our work 10 1.2.4 Kinectin in organelle motility Consistent with its predominant expression in ER, kinectin is reported to contribute to ER dynamics through anchoring ER to kinesin motor proteins The antibody against kinectin inhibits conventional kinesin binding ... brings the total known number of kinectin isoforms in mouse to 16 (Fig 1.2) The identification of total of 16 kinectin isoforms reveals the long-suspected existence of a family of kinectin isoforms. .. kDa kinectin of Int4 at the leading edge of migrating cells 60 Chapter Roles of kinectin Int4 in ER dynamics during cell migration and division 63 3.1 Roles of kinectin Int4 in ER dynamics. .. demonstrated the importance of kinectin isoforms with Int4 in modulating ER dynamics of interphase cells These findings would serve as a platform for more detailed studies of kinectin isoforms The opportunities