COMPARISON OF CYTOSINE DEAMINASE 5 FLUOROCYTOSINE VERSUS HERPES SIMPLEX VIRUS THYMIDINE KINASE GANCICLOVIR ENZYME PRODRUG SYSTEMS IN GLIOBLASTOMA GENE THERAPY

Comparison of Cytosine Deaminase/5-Fluorocytosine Versus Herpes Simplex Virus Thymidine Kinase/Ganciclovir Enzyme/Prodrug Systems in Glioblastoma Gene Therapy YE KAI (B.Sc.) A THESIS SUBMITTED FOR THE DEGREE OF MASTER OF SCIENCE DEPARTMENT OF BIOLOGICAL SCIENCES NATIONAL UNIVERSITY OF SINGAPORE AND INSTITUTE OF BIOENGINEERING AND NANOTECHNOLOGY 2011 Acknowledgements I want to take this precious opportunity to thank my family. I could not mange to get finish my research without their help and support. At the meanwhile, I would like to express my deepest gratitude to my supervisor, A/P Wang Shu, for his supervision and continuous support. Also I would like to thank Institute of Bioengineering and Nanotechnology for proving funding and National University of Singapore for providing research opportunity. I would like to thank Esther Lee for her help in animal study and critical review of the manuscript. Special thanks to all my colleagues and friends Chrishan, Lam, Yovita, Detu, Tim, Mohamad, Ghayathri, Yukti, Esther, Xiaoying, Jiakai, Dr. Wu Chunxiao, Dr.Zeng Jieming, Dr. Lo Seong long and Dr.Zhao Ying for their help. I TABLE OF CONTENTS ACKNOWLEDGMENTS.............................................I TABLE OF CONTENTS................................II SUMMARY............................................................V LIST OF TABLES......................................................VI LIST OF FIGURES..........................................................VII ABBREVIATION .............................................................VIII 1 Introduction......................................................................1 1.1 Characteristics and Conventional Therapies of Gliomablastoma….2 1.2 Gene Therapy for Glioma……………………..………..………..……5 1.2.1 Viral Vectors …………………..……………..……………………..5 1.2.2 Neural Stem Cells (NSCs) and the Use of NSCs for Glioma Therapy…………………………………………………………..8 1.3 Suicide Gene/Prodrug Systems Used in Gene Therapy….……...9 1.3.1Herpes Simplex Virus Type 1 (HSV-1) Thymidine Kinase(HSVtk)/Ganciclovir(GCV)…………………………. 10 1.3.2 Cytosine Deaminase(CD) / 5-Fluorocytosine(5-FC)…...13 1.4 Objectives……………………………………………………….…17 2. Materials and Methods......................................... 18 2.1 Cell Culture and Tissue samples………….……………………….…19 2.2 Plasmid Construction…………………….…………….……………..20 2.2.1 PCR Amplification of CodA and Fcy Gene……………….20 2.2.2 Cloning into pFastBacTM1 Vector……………..…..….……23 2.3 Baculovirus Production…………..………………….………..….25 2.4 Confirm of Gene Expression……..……………………….…….26 2.4.1 RNA Extraction……….………………………………………..26 2.4.2 Reverse Transcriptase PCR (RT-PCR) ……..…………27 II 2.5 Cell Transduction…………..……………………..……………..29 2.5.1 U87 Cells………………..….....…………….……...……29 2.5.2 Neural Stem Cells……………..…………………..………29 2.6 Transduction Efficiency Assay by FACS Analysis………..…30 2.7 Cell Viability Assays……….……….…………………………..….30 2.7.1 MTS Assays……………………..………………………………...30 2.7.2 MTS Assay for 5-FU Sensitivity of Glioma Cells…………….. 30 2.7.3 MTS Assay for Prodrug Cytotoxicity Assay without Suicid Gene…………………………………………………..…. 31 2.7.4 MTS Assay for Prodrug Cytotoxicity Assay with Suicide Gene……………………………………………………...31 2.7.5 MTS Assay for Examining Bystander Effects…….…..…31 2.7.5.1 Tranduced U87/NSC and nontransduced U87 Direct Coculture……………….……………………………….31 2.7.5.2 Transduced NSC and nontransduced U87 Indirect Coculture………………………………………………32 2.8 Animal studies ………………………..……………………………..33 3 Results.............................................................34 3.1 Construction of Baculoviral Vectors…………………………35 3.2 In Vitro Sensitivity of Glioma Cells to Activated Prodrug…………36 3.3 Cytotoxic Effects of Prodrugs without Suicide Gene..………..…38 3.4 In Vitro Comparisons of Three Suicide Gene/Prodrug Systems.…40 3.4.1 The Transduction Efficiency of Baculovirus….………40 3.4.2 In Vitro Sensitivity of Transduced Glioma Cells to Prodrug…42 3.4.3 Comparisons of Bystander Effects………….…………46 3.5 In vivo Comparisons of Three Suicide Gene/Prodrug Systems….54 4 Discussion.........................................................58 5 Conclusion..........................................................68 III 6 References...............................................................70 IV Summary Cytosine deaminase (CD)/5-fluorocytosine (5-FC) and herpes simplex virus thymidine kinase (HSVtk)/ganciclovir (GCV) systems are the most well-studied and extensively used suicide gene/prodrug systems in cancer gene therapy. In this study, we evaluated and compared the inhibitory effects of HSVtk/GCV and CD/5-FC on glioma development. In vitro results indicate that when delivered by suicide gene expression in the U87 glioma cell line and in neural stem cells (NSCs), the CD/5-FC system was able to induce a bystander killing effect stronger than that of the HSVtk/GCV system, thus being more effective in eliminating glioma cells. Intratumoral injection of NSCs expressing the CD gene into BALB/c nude mice harboring U87 glioma xenografts induced significant tumor regression, and tumor growth was inhibited when 5-FC was administered. Bacterial CD/5-FC and yeast CD/5-FC displayed similar anti-glioma effects in vitro and in vivo. These results suggested that the antiglioma effect of the CD/5-FC system is superior to the HSVtk/GCV system, with the former being more suitable for glioma gene therapy when used with NSCs as a delivery vehicle. V LIST OF TABLES Table 2.1 PCR conditions for amplification of CodA…………………….21 Table 2.2 PCR conditions for amplification of Fcy…………………….…22 Table 2.3 PCR conditions for amplification of cDNA……………………28 Table 2.4 Primers for RT-PCR………………………………………………..28 Table 3.1 Transduction efficiency and mean fluorescence intensity ……………………………………………………………..…41 VI LIST OF FIGURES Figure 2.1 Schematic representation of the pORF-CodA plasmid constructs…………….…………………………………..………21 Figure 2.2 Schematic representation of the pORF-Fcy plasmid constructs……………………………………………………22 Figure 2.3 Schematic representation of the FastBacTM1constructs…..24 Figure 3.1 Agarose gel photographs of PCR product of CodA and Fcy gene…………………………………………….…………. 35 Figure 3.2 In vitro sensitivity of glioma cells to 5-FU……………….37 Figure 3.3 Cytotoxic effects of prodrugs on nontransduced U87 ……………………..………….………………………..….39 Figure 3.4 U87 cells transduced with baculovirus expressing eGFP gene …… …… … …… …… … …… …. . …… . … …… …… … . . 4 1 Figure 3.5 In vitro sensitivity of transduced U87 cells to prodrug….…..45 Figure 3.6 In vitro cell bystander effect test (U87) …………..……….…48 Figure 3.7Transduction efficiency of baculovirus on NSCs and cytotoxic effect of prodrug on suicide genes transduced and nontransduced NSCs……………………………………..… 50 Figure 3.8 In vitro cell bystander effect test (NSCs). …………………52 Figure 3.9 In vivo comparison…………….……..…………………………56 VII ABBREVIATION 5-FC 5-Fluorocytosine BV Baculovirus CD Cytosine Deaminase CMV Cytomegalovirus DMEM Dulbecco’s modified Eagle’s Medium EGFP Emerald Green fluorescent protein FACS Fluorescence-Activated Cell Sorting FBS Fetal bovine serum GBM Glioblastoma Multiforme GCV Ganciclovir HSV Herpes Simplex Virus HSVtk Herpes Simplex Virus Thymidine Kinase Luc Luciferase MOI Multiplicity of Infection NSCs Neural Stem Cells PBS Phosphate Buffered Saline WPRE Woodchuck Hepatitis Virus Posttranscriptional Regulatory Element VIII CHAPTER I INTRODUCTION 1 1.1 Characteristics and Conventional Therapies for Glioblastoma Glioblastoma which derives from glial cells is a tumor of primary central nervous system. According to the World Health Organization (WHO), gliomas can be categorized by either their aggressiveness or by cell type. Aggressiveness ranges from grade I, the pilocytic astrocytoma of young adults and children, to grade IV, the most malignant form with the worst prognosis (Louis et al., 2007). High-grade gliomas are generally associated with poor prognosis (Kleihues et al., 2007). Indeed, the median survival of the glioblastoma multiforme (GBM) bearing patients is only ~1 year, and less than 5% of patients are able to survive 3 years or more (Hassan et al., 2007). The primary types of glioma cells are ependymomas and astrocytomas of which GBM is the most common. Hereditary genetic mutations and environmental factors may increase the risk of developing a glioma. For instance, diets high in N-nitroso compounds may elevate the risk of getting glioma for adults (Ohgaki and Kleihues, 2005). However, the main cause of gliomas still remains unknown. Gliomas are highly infiltrative and can migrate along paths which include perivascular, perineuronal and subpial spaces. Moreover, 2 gliomas can migrate into white matter (Holland, 2000). Overexpression of matrix metalloproteinases (MMPs) in gliomas influences glioma migration. Furthermore, invasion of tumor cells is regulated by several proteins, such as proline-rich tyrosine kinase (PYK2), Rho proteins and focal adhesion kinase (FAK) (Anders et al., 2007). Surgical resection together with radiotherapy and/or chemotherapy is current conventional glioma therapy. This therapeutic approach may prolong the survival of patients (ranging from 3 to 9 months) as well as improve life quality. Surgical resection alone can remove up to 99% of GBM (from 1011 cells to 109). A greater extent of tumor removal is associated with longer survival time. However, it is impossible to remove the entire tumor mass because of the invasive and infiltrative nature of gliomas. Furthermore, tumor edge cannot be clearly defined which would compromises the effect of surgery and results in tumor recurrence (Sneed et al., 1994). Surgical resection combined with radiotherapy results in better prognosis than surgical resection only. The median survival for the surgery only group is significantly less than that for the surgery and radiotherapy group (Whittle et al., 1991). However, normal brain tissues are only able to tolerate up to 60 Gy of radiation, which is below the requirement for glioma cell death. Adjuvant 3 chemotherapy plays a role in improving the survival of BGM. Radiotherapy combined with chemotherapy yields an increase in survival at 1 and 2 years by 10.1 and 8.6%, respectively (Fine et al., 1993). However, the existence of the blood-brain barrier may hinder the transport of many chemical drugs and causes the failure of chemotherapy. Hence, the current conventional curative treatment for glioblastomas is generally inefficient (Kalevi and Seppo, 2005). 4 1.2 Gene Therapy for Gliomas Because the outcome of conventional approaches is unsatisfactory, novel therapeutic strategies are urgently needed. As a promising new cancer therapy approach, gene therapy is a technique which involves introduction or removal of genes within cells to treat diseases. Since the first clinical trial involving human gene therapy in 1989 (Rosenberg et al., 1990), more than 1340 trials have been completed, and most of them (65%) aim to treat cancer (Edelstein et al., 2007). The location of a glioma in the CNS (where it is anatomically restricted and lacks metastases outside the CNS) makes it an attractive target for gene therapy by allowing the vector to deliver therapeutic genes directly to tumor. Furthermore, it could avoid damage to normal tissue and reduces side effects (Immonen et al., 2004). 1.2.1 Viral Vectors Several viral vectors have been employed in cancer gene therapy, with retroviral and adenoviral vectors being the most common for glioma therapy. During retrovirus transduction, double-stranded DNA which is transcribed from viral RNA is able to integrate into the chromosome of transduced cells. Hence, target cells display high and stable expression of the transduced gene. However, random gene integration is a 5 controversial safety issue. In addition, low transduction efficiency in vivo limits the further application of retroviral vectors (Rainov and Ren, 2003; Vile and Russell, 1995). In contrast to retroviruses, adenoviruses have high transduction efficiency. However, because there is no integration into the host genome, the use of adenoviral vectors does not cause unwanted mutagenesis. The safety of adenoviral vectors has been proven in several clinical trials (Trask et al., 2000, Immonen et al., 2004). Another advantage of adenoviral vectors is that they can elicit immune responses, which may provide additional antitumor effects (Danthinne and Imperiale, 2000; Kay et al., 2001; Sandmair et al., 2000). However, several weaknesses of adenoviral vectors limit their application. The expression of the transduced gene is transient because no DNA integration is involved. In addition, the adenovirus is a common human pathogen. Hence, pre-existing immune responses may hamper the in vivo delivery of adenoviruses. Baculoviruses (Autographa californica multiple nucleopolyhedrovirus) are emerging as vectors for gene therapy. Compared with conventional viral vectors, the baculovirus has several attractive features that make it 6 a promising viral vector for gene therapy. As an insect virus, baculovirus does not replicate within mammalian cells. Viral gene integration is rare, and no viral genes are expressed during viral transduction. (Ghosh et al., 2002). The side effects are minimal, and no safety issues have been reported thus far. Because humans are not the natural host for baculovirus, no pre-existing specific immune response against the baculovirus exists, which provides an additional advantage. Scientists have successfully transduced the baculoviruses which undergo genetic modification to contain mammalian expression cassettes into a broad range of mammalian cells, including embryonic stem cells (Zeng et al., 2007), mesenchymal stem cells (Ho et al., 2005), keratinocytes (Condreay et al., 1999) and chondrocytes (Ho et al., 2004). Besides, Baculoviruses can be employed to transduce cancer cells with high efficiency. Wang et al. (2006) showed that the baculovirus transduction efficiency of glioma cells can reach 98%. Other advantages of baculoviruses include a large (100-kb) cloning capacity, ease of vector construction, a simple virus preparation procedure and the virtual absence of cytotoxicity (Zeng et al., 2007). 7 1.2.2 Neural Stem Cells (NSCs) and the Use of NSCs for Glioma Therapy NSCs are a self-renewing and multi-potent population that gives rise to three major neural lineages: neurons, astrocytes and oligodendrocytes. NSCs reside in neurogenic regions in the brain, such as the subventricular zone (SVZ), from which NSCs can be obtained (James, 2004). Embryonic stem cells are also able to generate NSCs (Alvarez-Buylla and Doetsch, 2002). Attracted by various signals such as growth factors and chemokines, NSCs display migratory behavior toward intracranial pathologies, including neoplastic lesions. Furthermore, transplanted NSCs demonstrate a tropism both toward a glioma mass as well as infiltrative “satellite” glioma cells in animal models (Aboody et al., 2000; Benedetti et al., 2000; Glass et al., 2005). The gliomatropism of NSCs suggest that they are an ideal vector for delivering therapeutics to gliomas. NSCs expressing suicide genes produce powerful cytotoxicity toward glioma cells via a bystander effect (Aboody et al., 2000; Barresi et al., 2003; Boucher et al., 2006; Danks et al., 2007; Herrlinger et al., 2000; Li et al., 2005; Uhl et al., 2005). 8 1.3 Suicide Gene/Prodrug System Used in Gene Therapy Gene therapy is one of the most promising new frontiers in medical therapeutic intervention, especially in tumor therapy. Currently used applications in glioma gene therapy are primarily tumor suppressor and cell cycle modulation, genetic immune modulation, transfer of anti-angiogenic factors and prodrug-activating gene therapy (Kaveh and Antonio, 2009). The suicide gene/prodrug system is an approach which is commonly used in glioma gene therapy. Cells which were transduced with specific suicide genes can produce enzymes which catalyze the conversion of prodrug, from its non-toxic form to toxic form, allowing it to induce a therapeutic effect on tumor cells. High level of intratumoral chemotherapy can be achieved by conversion of prodrug, which is a remarkable benefit of the suicide gene/prodrug system. 9 1.3.1 Herpes Simplex Virus Type 1 (HSV-1) Thymidine Kinase(HSVtk)/Ganciclovir(GCV) Moolten (1986) first reported the HSVtk/GCV system. Nontoxic GCV is converted into monophosphorylated GCV-p by the HSVtk protein. The travel of GCV-p to neighboring cells depends on gap junctions (Drake et al., 2000; Sanson et al., 2002). GCV-p is able to be further phosphorylated to cytotoxic GCV triphosphate. Incorporation of GCV triphosphate into newly synthesized DNA causes chain termination and breaks the double-stranded DNA, ultimately resulting in cell death via apoptosis (Beltinger et al., 1999; Boucher et al., 2006; Molten et al., 1986; Moolten 1990). The bystander effect of HSVtk/GCV is exerted by transportation of phosphorylated GCV to HSVtk-negative cells through gap junctions. Over-expression of connexin43, which is a key gap junction-related protein, can enhance the bystander effect (Yang et al., 1998; Vrionis et al., 1997). As the most well-studied suicide gene therapy system, HSVtk/GCV has received increasing attention recently. Intra-tumoral injection of NSC expressing HSVtk followed by GCV administration is reported to completely eliminate gliomas, and experimental rats can be maintained tumor-free for 10 weeks under this regime (Li et al., 2005). A previous 10 study in our lab also suggests that HSVtk/GCV is efficient in preventing tumor growth in glioma animal model (Bak et al., 2010). This therapeutic effect against gliomas can be further improved by enhancing the gap junctions between tumor cells. Histone deacetylase inhibitor 4-phenylbutyrate (4-PB) is able to enhance gap junction communication in vitro. Thus, by the co-administration of the 4-PB and HSVtk/GCV, the bystander effect against glioma can be dramatically enhanced compared to single use of HSVtk/GCV (Ammerpohl et al., 2004). Gap junction may be restored by the over-expression of connexin43 which leads to the enhancement of bystander effect induced by HSVtk/GCV system. Expression of HSVtk combined with the over-expression of Cx43 has shown promising anti-glioma effects and holds potential for future glioma gene therapy as a novel approach (Huang et al., 2010). The bystander effect induced by HSVtk/GCV may also be further improved by creating a fusion protein containing HSVtk and a TAT peptide as a cargo carrier for different proteins (Dietz and Bahru, 2004). Thus, the fusion of HSVtk and TAT enhances the bystander effect of HSVtk/GCV by encouraging suicidal protein to move to non-transduced neighboring cells (Merilainen et al., 2005). HSVtk gene therapy has gone through clinical trial and the phase I 11 clinical trial protocols have been conducted. The first clinical trial was performed by Klatzmann in 1998, and other groups have followed suit (Kun et al., 1995; Oldfield et al., 1993; Raffel et al., 1994). Retroviral vector-producing cell (VPC)-mediated HSVtk was proven to be safe by the injection of HSVtk-positive VPCs into gliomas. Subsequently, HSVtk/GCV treatment increases the survival times of patients who suffer from malignant gliomas. In one study, the mean survival of patients who received HSVtk/GCV treatment increased to 71 weeks, while that of the control group was only 39 weeks. (Immonen et al., 2004). 12 1.3.2 Cytosine Deaminase(CD) / 5-Fluorocytosine(5-FC) Both the codBA operon from Escherichia coli and the FCY1 gene from yeast (Saccharomyces cerevisiae) are able to encode cytosine deaminase (Danielsen et al., 1992; Erbs et al., 1997). CD deaminates nontoxic 5-fluorocytosine (5-FC) into the potent chemotherapeutic drug 5-fluorouracil (5-FU). 5-FU can be converted into 5-fluoro-20-deoxyuridine-50-monophosphate (5-FdUMP), which blocks thymidylate synthase, or into 5-fluorouridine-50-triphosphate (5-FUTP), which disrupts RNA functions by incorporation. 5-FdUTP can be metabolized from the precursor’s 5-FUTP and 5-FUDP, and incorporated into DNA, leading to cell death in the S-phase of the cell cycle (Thomas and Zalcberg, 1998). CD/5-FC treatment has pronounced antitumor effects toward gliomas. Chen et al. (2007) reported that the combination of hypoxia-inducible CD/5-FC treatment and radiotherapy exerts stronger bystander effect and radiosensitizing effect, without causing damage to normal cells (Chen et al., 2007). Furthermore, yeast CD/5-FC therapy can remarkably prolong the survival time of mice harboring orthotopic human glioma xenografts (Tai et al., 2005). 13 Yeast Cytosine Deaminase (yCD) and bacterial Cytosine Deaminase (bCD) are two separate forms of naturally evolved CD. Both forms have been extensively used and studied in gene therapy. However, the use of bCD is limited by its poor efficiency in deaminating 5-FC (West et al., 1982). Compared to bCD, Kievit and colleagues have reported that yCD has a 22-fold lower Km for the prodrug 5-FC and the amount of 5-FU produced by yCD in vivo is 15-fold higher. In addition, yCD/5-FC has shown improved radiosensitivity and a stronger bystander effect in nude mice bearing human colorectal cancer xenografts compared to bCD/5-FC (Kievit et al., 1999; Kievit et al., 2000). Although yCD/5-FC has promising antitumor effects, the fact that yCD is less thermostable than bCD limits its application. Furthermore, the product released from yCD is rate limiting (Katsuragi et al., 1987; Yao et al., 2005). Unlike cytotoxic GCV-TP, 5-FC can diffuse out of the cell and produce a powerful bystander effect. CD-expressing tumor cells under 5FC treatment can result in great tumor regression even when the percentage of CD positive tumor cells is as low as 5% (Kuriyama et al., 1998). 5-FC can diffuse freely through the cell membrane by non-facilitated diffusion (Huber et al., 1994; Miller et al., 2002) and doesn’t depend on gap junctions that require close proximity between 14 cells. In addition, 5-FU is a radiosensitizing chemotherapeutic anti-carcinomas agent (Austin and Huber, 1993). Thus, CD/5-FC treatment is able to induce radiosensitization in tumor cells (Khil et al., 1996; Rogulski et al., 2008; Stackhouse et al., 2007). Because gene therapy cannot be the sole treatment in patients, the radiosensitizing effects of CD can augment treatment regimens, yielding an additional advantage of CD/5-FC treatment. As CD/5-FC and HSVtk/GCV are widely used in cancer gene therapy, several studied have compared the efficiency of these two systems in eliminating tumors in vitro as well as in vivo. Compared to HSVtk/GCV system, the use of CD/5-FC in cancer gene therapy causes a greater bystander effect. The major reason for this greater effect is that the diffusion of 5-FU does not require gap junctions, which are required for the transportation of GCV-p (Holder et al., 1993; Hotz et al., 1993). Because gap junctions are often absent in tumor cells, CD/5-FC may induce a stronger bystander effect and thus be superior to the HSVtk/GCV system. In the R3327 AT‐1 rat prostate tumor cell line transfected with a bifunctional fusion gene CDglyTK which is able to express a CD-TK fusion protein fused by the linkage of glycine spacer, CD/5-FC displays a more pronounced anti-tumor effect in vitro, but this system is less effective in eliminating the tumor in vivo (Corban et al., 2003). In other experiments, CD/5-FC therapy produces 15 a stronger bystander effect than HSVtk/GCV both in vitro (Kuriyama et al., 1999) and in vivo (Quynh et al., 1995). Synergistic anticancer effects of HSVtk/GCV and CD/5-FC therapies have also been studied. The combination of both gene-directed enzyme/prodrug therapy systems demonstrates an enhanced inhibitory effect on different cancer cell lines (Boucher et al., 2006; Uckert et al., 1998; Xia et al., 2004). 16 1.4 Objectives 5-FU is widely believed to freely diffuse through the cellular membrane, delivering cytotoxic metabolic product to cells distant from the CD-expressing cells. Hence, CD/5-FC is considered superior to the HSVtk/GCV system for cancer gene therapy. Although several reports have compared the antitumor effects of these suicide gene/prodrug systems in different cancer cell lines, the inhibitory effects of the CD/5-FC and HSVtk/GCV systems directed by neural stem cells on glioma development have not been systematically studied. In addition, the anti-glioma effect of yCD/5-FC and bCD/5-FC have not been evaluated and compared. Thus, this study aimed to directly compare the efficiency of the bystander killing effects of yCD/5-FC, bCD/5-FC and HSVtk/GCV on gliomas. We analyzed the cytotoxic effect of these three systems on glioma cells in vitro and in a xenograft glioma mouse model in vivo. 17 CHAPTER II MATERIALS AND METHODS 18 2.1 Cell culture and Tissue samples Human glioblastoma U87MG cell line was purchased from ATTC (Manassas, VA, USA) and cultured in Dulbecco’s Modified Eagle’s Medium (DMEM) supplemented with 10% Fetal Bovine Serum (FBS), 1% penicillin-streptomycin and 1% L-glutamine at 37°C, 5% CO2. U87MG cell was subcultured at ratio of 1:4 to 1:6 twice or three times a week. The stable U87 cell clone expressing luciferase gene (U87-luc) was derived from U87MG cell. U87-luc cell was maintained in U87 medium supplemented with additional 500 mg/ml geneticin at 37°C, 5% CO2. Neural stem cells which were derived from human embryonic stem cells b were maintained in DMEM/f12(1:1) (Invitrogen, CA, USA) containing 1% penicillin and streptomycin, 1% L-glutamine, 20ng/ml basic Fibroblast growth factors (bFGF), 20ng/ml Epidermal growth factor (EGF) and 2% B27. 19 2.2 Plasmid Construction 2.2.1 PCR Amplification of CodA and Fcy Genes Vector pORF-CodA and pORF-Fcy were purchased from Invivogen, USA. Vector NTI program was used to design relevant primers for the PCR amplification. The PCR SuperMix High Fidelity kit (Invitrogen, CA, USA) was used to carry out the PCR and the PCR product was analyzed on a 1.2% agarose gel containing 0.1μl/ml of SYBR Green. The PCR product was purified using the QIAgen PCR Purification Kit. 20 Figure 2.1 Schematic representation of the pORF-CodA plasmid constructs. Step Conditions cycles 1 94°C, 3 min 1 2 94°C, 45 sec 3 55°C, 45 sec 4 72°C, 90 sec 5 4°C 30 hold Table 2.1 PCR conditions for amplification of CodA from vector pORF-CodA. CodA Primers: Forward Primer: 5’- GCGGAATTCATGAGCAATAACGCTTTAC -3’ Reverse Primer: 5’- ACGCTCGAGTCAACGTTTGTAATCGA -3’ 21 Figure 2.2 Schematic representation of the pORF-Fcy plasmid constructs. Step Conditions cycles 1 94°C, 3 min 1 2 94°C, 45 sec 3 55°C, 45 sec 4 72°C, 45 sec 5 4°C 30 hold Table 2.2 PCR conditions for amplification of Fcy from vector pORF-Fcy Fcy Primers Forward Primer: 5’- AGGAATTCATGGTGACAGGGGGAATG -3’ Reverse Primer: 5’- CCGCTCGAGCTACTCACCAATATCTTCA -3’ 22 2.2.2 Cloning into pFastBacTM1 Vector pFastBacTM1 containing CMV promoter, Woodchuck Hepatitis Virus (WHP) Posttranscriptional Regulatory Element (WPRE) and HSVtk gene with flanking EcoRI and XhoI sites was generated by Bak Xiaoying. The vector was double-digested by EcoRI and XhoI restriction enzyme (Fermentas, USA) and the HSVtk gene was replaced by CodA or Fcy gene. 23 (a) (b) (i) (ii) (iii) Figure 2.3 Schematic representation of the pFastBacTM1constructs. The figure shows the constructs used to produce recombinant baculoviruses. a) pFastBacTM1 vector map b) (i) CMV-HSVtk-WPRE (ii) CMV-CodA-WPRE and (iii) CMV-Fcy-WPRE. 24 2.3 Baculovirus Production Baculoviruses were produced and propagated in Spodoptera frugiperda (Sf9) insect cells grown in Sf-900 II serum-free medium according to the manual of the Bac-to-Bac Baculovirus Expression System (Invitrogen, CA). For bacmid production, 9 X 105 Sf9 cells per well were seeded in a 6-well plate and allowed to attach for an hour. The diluted bacmid DNA was combined with the diluted Cellfectin@Reagent (Invitrogen, CA) and incubated for 15 to 45 minutes at room temperature. The medium was then replaced by the combination of bacmid DNA and Cellfectin reagent in unsupplemented Grace’s Medium (Invitrogen, CA, USA). Cells were incubated in 27°C incubator for 5 hours and then the unsupplemented Grace’s Medium was replaced with Sf-900 II serum-free medium. P1 virus can be harvested after 72 hours incubation in 27°C incubator. P3 virus was propagated from P1 virus according to the manual. Budded viruses in the Sf-900 II serum-free medium were centrifuged at 500 g for 5 min to remove cell debris. The supernatant was stored at 4°C and kept from light. The viral titres were determined by qPCR. 25 2.4 Confirmation of Gene Expression 2.4.1 RNA Extraction Cells were transduced by baculovirus 1 day before the RNA extraction. TRIZOL® Reagent (innitrogen, CA) was used to extract total RNA from transduced U87 cells or NSC stem cells according to manufacturer’s manual. Briefly, 1ml TRIZOL reagent was used to homogenize cells growing on 6-well plate, followed by centrifugation at 12000g for 10 min at 2-8°C. 0.2 ml of chloroform per 1 ml of TRIZOL Reagent was added and mixed with homogenized samples by vigorous shaking. Sample was incubated at room temperature for 3 minutes and then centrifuged at 12,000 g for 15 minutes at 4°C. The aqueous phase was transferred to another fresh tube and mixed with isopropyl alcohol to precipitate the RNA. After 75% ethanol washing, the briefly dried RNA pellet was dissolved in RNase-free water and stored at -70°C. 26 2.4.2 Reverse transcriptase PCR (RT-PCR) Turbo DNA-freeTM kit (Ambion Inc.) was used to remove contaminating DNA from extracted RNA. The SuperScript™ III First-Strand Synthesis System for RT-PCR kit (Invitrogen, CA) was used to synthesize cDNA from extracted RNA. Vector NTI program was used to design relevant primers for the PCR amplification. PCR Master Mix kit (Fermentas) was used to carry out the PCR and the PCR product was analyzed on a 1.5% agarose gel containing 0.1μl/ml of SYBR Green. 27 Step Conditions cycles 1 94°C, 3 min 1 2 94°C, 45 sec 3 55°C, 45 sec 4 72°C, 30 sec 5 4°C 30 hold Table 2.3 PCR conditions for amplification of cDNA extract from NSC or U87 cells HSVtk CodA Sense primer Anti-sense primer 5'-CCCATATCGGGGACACGT 5'-GATAAAGACGTGCATGGAA TATTT-3' CGGAG-3' 5'-CCTGGATGCCGAACAAG 5'-CCAGCGTTCAATGCCTTCA GTTTA-3' AAC-3' 5'Fcy TCTCCATGCGACATGTGTAC AGGT-3' 5'-CGTCAACAACAACAACCTC GTGAC-3' Table 2.4 Primers for RT-PCR 28 2.5 Cell Transduction 2.5.1 U87 Cells 3 X 106 U87 cells per well were seed in a 6-well plate and allowed to attach for overnight at 37°C, 5% CO2. The medium was replaced with fresh DMEM. Baculovirus supernatant was then added at multiplicity of infection (MOI) of 20, 50 and 100. After 1-2 hours incubation at 37°C, 5% CO2, DMEM containing virus was removed and replaced with fresh U87 growth medium which is described in section 2.1. Cells were harvested and counted 1 day after transduction. 2.5.2 Neural Stem Cells When the NSCs were 90% confluent in 6-wells plate, the cells were trypsinized and counted. Baculovirus supernatant was added to medium at MOI=100 according to the cell number. Medium containing virus was replaced with fresh NSC medium after incubation overnight at 37°C, 5% CO2. Cells were harvested and counted 1 day after transduction. 29 2.6 Transduction Efficiency Assay by FACS Analysis NSC or U87 cells were transduced with baculovirus containing EGFP gene 1 day before the fluorescence-activated cell sorting (FACS) analysis. Cells were trypsinized and resuspended in PBS before analysis with the FACS Calibur flow cytometer (BD Biosciences, San Diego, CA, USA). Nontransduced cells were set as control. 2.7 Cell Viability Assays 2.7.1 MTS Assay Cell viability was measured by MTS assay. 20 μl CellTiter 96 AQueous One Solution Reagent (Promega) was added into each well of the 96-well plate containing the samples in 100μl of culture medium. After 1-4 hours incubation at 37°C, 5% CO2, the absorbance was recorded at 490nm using a 96-well plate reader. 2.7.2 MTS Assay for 5-FU Sensitivity of Glioma Cells U87 cells were seeded in 96-well plate at density of 1000 cells per well and allowed to attach overnight. Fresh U87 culture medium containing 5-FU was used to replace the old medium every other day. MTS assay was performed to evaluate cytotoxicity after 5 days 5-FU treatment. 30 2.7.3 MTS Assay for Prodrug Cytotoxicity without Suicide Gene U87 cells were seeded in 96-well plate at density of 1000 cells per well and allowed to attach overnight. Fresh U87 culture medium containing 5-FC or GCV was used to replace the old medium every other day. MTS assay was performed to evaluate cytotoxicity after 5 days prodrug treatment. 2.7.4 MTS Assay for Prodrug Cytotoxicity with Suicide Gene U87 cells were transduced by recombinant baculovirus at MOI of 20, 50 and 100. After one day, the transduced cells were trypinized and seeded in 96-well plate at density of 1000 cells per well. Cells were allowed to grow overnight to attach. Fresh U87 cell culture medium containing 5FC or GCV was used to replace the old medium. After 5 days of 5-FC or GCV treatment, MTS assay was performed to evaluate cytotoxicity. 2.7.5 MTS Assay for Examining Bystander Effects 2.7.5.1 Tranduced U87/NSC and nontransduced U87 Direct Coculture. U87 cells or NSCs were transduced by recombinant baculovirus at MOI of 100. After one day, the transduced cells were trypinized and mixed 31 with nontransduced U87 cells at ratio of 1:0, 1:1, 1:3 and 1:9(transduced U87: nontransduced U87) or 50:50, 20:80, 10:90, 5:95 and 2:98 (transduced NSCs:nontransduced U87). NSCs and U87 cell mixture were seeded in 96-well plate at density of 1000 or 2000 cells per well, respectively, and allowed to attach overnight. Fresh U87 or NSC cell culture medium containing 5FC or GCV was used to replace the old medium. After 5 days of 5-FC or GCV treatment, MTS assay was performed to evaluate cytotoxicity 2.7.5.2 Transduced NSC and nontransduced U87 Indirect Coculture NSCs were transduced by recombinant baculovirus at MOI of 100 one day before cell seeding. Transduced NSCs were trypsinized and seeded in upper chamber of transwell 96-well plate at density of 1000 cells per well. U87 cells were seeded in bottom well at density of 1000 cells per well. Fresh NSC cell culture medium containing 5FC or GCV was used to replace the old medium. After 5 days of 5-FC or GCV treatment, MTS assay was performed to evaluate cytotoxicity. 32 2.8 Animal studies Each adult Balb/c nude mouse received subcutaneously injection of 1.5 X 106 U87-luc cells to establish glioma xenograft model. Eight days after tumor inoculation, mice were divided into 4 groups for intratumoral injection of PBS or 1 X 105 NSCs expressing HSVtk, CodA or Fcy gene. Daily Intraperitoneally injection of 500 mg/ml/kg 5-FC or 50 mg/ml/kg of GCV as treatment or PBS as control were given 10 days after tumor inoculation. Duration of drug administration was 14 days. Tumor size was measured and analyzed by detection of bioluminescent singles of U87-luc cells using IVIS imaging system (Xenogen, Alameda, CA, USA) and Xenogen living imaging software v2.5. Each mouse received intraperitoneally injection of 200 μl of D-luciferin (5mg/ml, Promega) dissolved in PBS 20 minutes before luminescent images taking to generate bioluminescent signals. All the experiments were performed according to IBN and BRC’s IACUC. 33 CHAPTER III RESULTS 34 3.1 Construction of Baculoviral Vectors The CodA and Fcy genes were successfully cloned in the pFastBac1 vector, as shown in Figure 3.3. EcoRI and XhoI enzymes were used for cloning the CD genes into the pFastBac1 vector. Figure 3.1 Agarose gel photographs of PCR products of CodA(1.3kb) and Fcy(0.5 kb). Gene Ruler 1 kb DNA Ladder (Fermentas, Canada) was used. 35 3.2 In Vitro Sensitivity of Glioma Cells to Activated Prodrug The cytotoxic effect of 5-FU was assessed by measuring the viability of the U87, T98G and SW1783 glioma cell lines. In the T98G cell line, inhibition of cell growth was observed 5 days after 5-FU treatment, and as the concentration of 5-FU increased, the cytotoxic killing effect was enhanced. As shown in figure 3.2, a toxicity of 77.9 ± 2.2% killing effect was observed at 30 μg/ml 5-FU. Approximately 60% inhibition was observed at 10 μg/ml 5-FU in SW1783, but the cytotoxic killing effect remained at 60% as the 5-FU concentration increased. Thus, it is possible that a significant proportion of our SW1783 cells have 5-FU resistance. The highest cytotoxic effect of 5-FU was observed in the U87 cell line. The LD50 was approximately 0.75 μg/ml, which is much lower than that in T98G and SW1783 cell lines (LD50s > 2.5 μg/ml). Only 13.7 ± 2.2% U87 cells survived with 10 μg/ml of 5-FU, and the viability further decreased to 8.3 ± 1.3% when the concentration of 5-FU was increased to 30 μg/ml. These results suggested that U87 had the highest sensitivity to 5-FU among all the glioma cell lines tested. 36 120 100 T9 98G+5FU SW W1783+5FU Viability(%) 80 U8 87+5FU 60 40 20 0 0.25 0.5 0.7 75 1 2.5 5‐FU U, μg/ml 10 20 30 0 Figure 3.2 2. In vitro sensitivity of o glioma cells c to 5-FU. Glioma cells were e plated in 96-well 9 pla ates, and the t effect of 5-FU was w measu ured by the e MTS assa ay after 5 days. Each bar repres sents the average a cell viability ± standard deviation d o eight we of ells. The viability v of glioma ce ells without 5-FU was 100% and d used as a control. 37 7 3.3 Cytotoxic Effects of Prodrugs without the Suicide Gene To determine the concentration of prodrug to be used in subsequent experiments, we first tested the cytotoxic effect of 5-FC and GCV on non-transduced U87 cells in vitro. Concentrations of up to 200 μg/ml 5-FC itself did not inhibit cell growth, whereas 7.6 ± 6.0% and 26.8 ± 5.2% inhibition were observed at higher concentrations of 5-FC (Figure 3.3). No significant cytotoxic effect was observed until the concentration of GCV reached 20 μM; inhibition of 10.0 ± 9.2 % and 26.3 ± 10.0% was measured at concentrations of 20 and 100 μM, respectively. 38 (b) 120 120 100 100 80 80 Viability(%) Viability(%) (a) 60 40 20 60 40 20 0 50 100 200 500 5‐FC, μg/ml 800 0 2 5 10 20 GCV, μM 100 Figure 3.3. Cytotoxic effects of prodrugs on non-transduced U87 cells. The graphs show the cell viability of non-transduced U87 cells after 5 days of treatment with 5-FC (a) or GCV (b). Each bar represents the average cell viability ± standard deviation of eight wells. 39 3.4 In Vitro Comparisons of Three Suicide Gene/Prodrug Systems 3.4.1 The Transduction Efficiency of Baculoviruses Baculoviruses can transduce U87 cells, and the expression of the transgene can be maintained for at least 2 weeks. The CMV-eGFP-WPRE baculoviral vector, which expresses fluorescent eGFP, was used to measure baculovirus transduction efficiency in U87 cells. As shown in Figure 3.4 and Table 3.1, the transduction efficiency increased with an increase in MOI. The percentages of eGFP-positive U87 cells were nearly 100% at all MOI tested and the mean fluorescence intensity is higher than 5000 at all the MOI. 40 (a) (b) (c) MOI=20 MOI=100 MOI=50 Figure 3.4. U87 cells transduced with baculovirus expressing the eGFP gene at MOI of 20 (a), 50 (b) and 100 (c). Pictures were taken with a digital camera attached to an Olympus IX71 inverted fluorescence microscope 1 day after transduction. MOI 20 50 100 Transduction efficiency (%) 98.10 99.29 99.81 Mean fluorescence intensity 5060.63 7294.11 8540 Table 3.1 Transduction efficiency and mean fluorescence intensity of BV-EGFP transduced U87 cells. The data were analyzed by FACS. 41 3.4.2 In Vitro Sensitivity of Transduced Glioma Cells to Prodrug The HSVtk/GCV and CD/5-FC systems are commonly used in cancer gene therapy, and both exhibit strong anti-tumor effects. To compare the killing effect of these suicide gene/prodrug systems, we constructed baculoviral vectors expressing the suicide genes HSVtk, E. coli CD CodA and yeast CD Fcy with the CMV promoter and WPRE. Expression of HSVtk and CD followed by the administration of the prodrugs GCV and 5-FC, respectively, kills the transduced cells, as well as neighboring cells, through a bystander killing effect. To test the in vitro sensitivity of transduced U87 cells to the prodrugs, U87 cells that were transduced at different MOI (from 20 to 100) were seeded in 96-well plates 1 day after transduction and cultured in medium containing 10 μM GCV or 200 μg/ml 5-FC, which represent the maximum prodrug dosage that does not cause cytotoxic effects (Figure 3.3), for 5 days (Figure 3.5a). At MOI of 20, > 80% of HSVtk-expressing U87 cells were killed after 5 days of GCV treatment. However, only approximately 55% of CodA- or Fcy-expressing U87 cells were killed after 5-FC treatment. With an increase in MOI, HSVtk-expressing U87 cells maintained an ~80% killing effect; 23.1 ± 4.9% and 16.0 ± 7.9% cell viability was observed at MOI of 50 and 100, respectively. When 42 MOI increased, the viability of CD-expressing cells decreased significantly. The viability of CodA-expressing U87 cells decreased from 54.4 ± 6.7% at MOI of 20 to 37.4 ± 4.4% at MOI of 50 and 33.0 ± 5.3% at MOI of 100. A significant cell viability decrease was similarly observed in Fcy-expressing cells with cell viability decreased, from 56.4 ± 4.0% at MOI of 20 to 33.6 ± 2.8% at MOI of 50 and 31.0 ± 4.0% at MOI of 100. Although the CD-expressing U87 cells produced a stronger killing effect at higher MOI, the cell viability of HSVtk-expressing U87 cells was significantly lower than CodA- and Fcy-expressing cells at all MOI, indicating that U87 cells expressing HSVtk are more sensitive to GCV than CD-expressing U87 cells. Suicide gene expression followed by prodrug treatment achieved the highest killing effect at MOI of 100 in all groups. Therefore, MOI was fixed at 100 in subsequent experiments. To further test the in vitro sensitivity of transduced U87 cells to the prodrugs, cells transduced with BV-HSVtk, BV-CodA or BV-Fcy (at MOI of 100) and determined to be expressing the suicide genes were subjected to prodrug treatment at various concentrations. Transduced U87 cells were cultured and treated with various concentrations of GCV, ranging from 1 to 20 μM, or 5-FC, ranging from 50 to 500 μg/ml. After 5 days of treatment with 50 μg/ml 5-FC, 80.0 ± 12.3% of Fcy– and 58.9 ± 43 12.9% of CodA-expressing U87 cells survived (Figure 3.5b). The cell viability decreased to ~33% when the concentration of 5-FC was increased to 200 μg/ml. Cell survival continued to decrease when the concentration increased from 200 to 500 μg/ml. However, this additional ~10% killing effect may be due to a nonspecific effect of 5-FC at high concentrations (Figure 3.3a). HSVtk-expressing U87 cells treated with GCV also displayed dose-dependent cytotoxic killing effects. This cell viability decreased from 36.1 ± 10.0% at 1 μM GCV to ~5% at 10 and 20 μM GCV (Figure 3.5c). Concentrations as low as 1 μM of GCV produced cytotoxic effects in HSVtk-expressing U87 cells that were no worse than the killing effects of 200 μg/ml 5-FC on CodA- and Fcy-expressing U87 cells. Combined with our previous results (Figure 3.5a), these data indicate that the in vitro sensitivity of HSVtk-expressing U87 cells to GCV is superior to that of CodA- and Fcy-expressing cells to 5-FC. 44 (a) 70 ** U87 7‐HSV+GCV U87 7‐CodA+5FC 60 U87 7‐Fcy+5FC ** Viability(%) 50 ** 40 30 20 10 0 MOI=20 MOI=50 MOI MOI=100 (c) (b) 100 U87‐CodA+5 5FC 80 U87‐HSV++GCV 80 Viability(%) Viability(%) U87‐Fcy+5FC C 100 60 60 40 40 20 20 0 0 50 100 150 200 5FC, μ μg/ml 50 00 1 2 5 10 GCV, μM 20 Figure 3.5 5. In vitro se ensitivity of o transduc ced U87 ce ells to the p prodrugs at different MOI M (a) and d different concentrat c tions of the e prodrugs (b, c) after 5 days of GCV or 5-FC 5 treatm ment. ** P < 0.001 by ANOVA A analysis. Each bar representss the averrage cell viability v ± standard s d deviation of eight wellss. 45 5 3.4.3 Comparisons of Bystander Effects To test the bystander effect, baculovirus-transduced U87 cells and non-transduced U87 cells were mixed at different percentages (between 10% and 100%) one day after transduction and cultured in U87 culture medium containing GCV or 5-FC for 5 days before measuring viability. 1 μM GCV and 200 μg/ml 5-FC were used in this experiment because Tk- and CD- expressing U87 cells produced similar anti-tumor effects under these concentrations. As shown in Figure 3.6, when all of the U87 cells were transduced, the cell survival in HSVtk and CD groups were approximately 35% and the difference between them was insignificant. When the percentage of transduced U87 decreased to 50%, the killing effect of HSVtk-expressing U87 cells decreased to 52.2 ± 3.8%, while the anti-tumor effects of CodA- and Fcy-expressing U87 cells increased (but not significantly) from 61.7 ± 3.2% to 66.8 ± 3.1% and 67.9 ± 5.9% to 73.5 ± 3.6%, respectively. The killing effect of HSVtk-expressing U87 cells significantly decreased when the percentages of transduced U87 cells were further decreased to 25 and 10%; these decreases were associated with 41.8 and 45.1 decreases in viability, respectively, whereas a < 15% decrease of killing effect was observed in CodA- and 46 Fcy-expressing cells. The cell viability of HSVtk-expressing U87 cells was significantly higher than CodA- and Fcy-expressing cells when the percentage of transduced cells was < 50%, indicating that the CD/5-FC system produces a stronger bystander effect than the HSVtk/GCV system, despite the lower prodrug sensitivity. 47 100 U87‐HSV+G GCV 90 U87‐CodA++5FC 80 U87‐Fcy+5 5FC Viability(%) 70 * ** ** ** 60 50 40 30 20 10 0 100% 5 50% 25% Percen ntage of transsdued U87 cells  1 10% 6. In vitro cell bystand der effect test. t U87 cells c were ttransduced d Figure 3.6 with BV-H HSV, BV-F Fcy or BV--CodA at MOI M of 10 00. Transd duced cells s were mixe ed with no on-transdu uced cells at differe ent percen ntages and d treated witth 1 μM GCV G or 200 0 μg/ml 5-F FC for 5 days. d ** P < 0.001 by y ANOVA Analysis. A E Each bar represents s the ave erage cell viability ± standard deviation d o eight wellls. of 48 8 To further test the bystander effect of transduced NSCs, we prepared cell mixtures by mixing the baculovirus-transduced NSCs and U87 cells at ratios of 50 to 50. These cells were then cultured in NSC culture medium containing GCV or 5-FC for 5 days. NSCs could be transduced effectively by baculovirus at MOI of 100; up to 99% of NSCs were transduced (Figure 3.7a). Coculture of transduced NSCs and U87 treated with GCV or 5FC displayed dose-dependent cytotoxic killing effects. This killing effect of TK/GCV increased from 25.3% ± 4.3% at 0.1 μM GCV to ~70% at 10 μM GCV while that of Coda/5FC and Fcy/5FC increased from almost 0% at 10 μg/ml 5FC to ~75% at 200 μg/ml 5FC(Figure 3.7 b and c). Only less than 15% of cell death caused by prodrug without expression of suicide genes was recorded (Figure 3.7 b and c) which suggested that the killing effect of transduced NSCs is mostly because of the cytotoxic effect coming from the combination of suicide genes and prodrug. 49 a) NSCs-EGFP 97.52% b) NSC/U87+5FC 120 NSCfcy/U87+5FC 100 NSCcoda/U87+5FC Viability(%) 80 60 40 20 0 10 50 100 5FC,μg/ml 150 200 c) NSC/U87+GCV 100 NSCtk/U87+GCV Viability(%) 120 80 60 40 20 0 0.1 0.5 1 GCV,μm 5 10 Figure 3.7. Neural stem cells transduced with baculovirus expressing the eGFP gene at MOI of 100 (a) and the in vitro cytotoxicity of suicide genes expressing NSCs against U87 cells under different concentration of prodrug 5FC (b) and GCV (c). 50 To further test the bystander effect of transduced NSCs, we prepared cell mixtures by mixing suicide gene expressing NSCs and the wild-type U87 at ratios ranging from 2:98 to 50:50(Figure 3.8a). These cells mixtures were cultured in NSC culture medium containing 10 μM GCV or 200 μg/ml 5-FC for 5 days and then subjected to MTS assay. As shown in Figure 3.8a, when the ratio of NSCs to U87 was 50:50, the cell viability was 25.7 ± 5.5% in the presence of HSVtk-expressing NSCs; while the viability of Fcy was significantly higher (CodA was higher but not significantly). When the NSCs: U87 cells ratio decreased to 20:80 or less, the killing effects of HSVtk-expressing NSCs decreased significantly. Only an ~40% killing effect was observed when the ratio of NSC:U87 was 20:80, and almost no killing effects were observed at ratios of 5:95 and 2:98 in which the inhibition of cell growth was approximately 8 and 2%, respectively. The anti-tumor effects of Coda and Fcy also decreased with the decrease in the NSCs: U87 cells ratio. However, both CodA and Fcy groups maintained ~40-50% killing effects, which were significantly higher than the killing effects of HSVtk; approximately 40% of the killing effects could still be achieved, even at a ratio as low as 2:98. The CD/5-FC system has a stronger bystander effect than the HSVtk/GCV system, which enables the CD/5-FC system 51 to produce more powerful anti-tumor effects. Thus, even a small amount of cells encoding the suicidal proteins were enough to generate a promising killing effect. Because the close contact of cells plays key role in bystander effect of HSVtk/GCV system but the certain proximity is not required in that of CD/5-FC system, we designed an indirect co-culture experiment to further compare the anti-tumor effects between these two suicide gene/prodrug systems(Figure 3.8b). We prepared NSCs expressing HSVtk or CD, seeded them in the upper chamber of a transwell, and seeded the U87 cells in the bottom well to completely avoid cell-to-cell contact. The number of NSCs of upper chamber and U87 cells of bottom well is equal. Compared to direct culture, the killing effect of HSVtk-expressing NSCs decreased the most, by 48.1%, while the effects of CodA- and Fcy-expressing cells decreased by only 20.5 and 13.6%, respectively (Figure 3.8b). Only ~30% of U87 cells were killed in the indirect co-culture with HSVtk-expressing NSCs, whereas over half of the U87 cells were killed by CD-expressing NSCs (Figure 3.8b). 52 a) NSCtk/U8 87+GCV 120 100 Viability(%) ** ** 80 ** NSCfcy/U U87+5FC NSCcoda//U87+5F C ** 60 * 40 20 0 50:50 20:80 10:90 5:95 2:98 Ratio of tran nsduced NSCs to U87 cells b) * ** 90 trransduced NSC C and  U87 cells indireect  oculture co 80 Viability(%) 70 60 trransduced NSC Cs and  U87 cells directt  oculture co 50 40 30 20 10 0 HSV V Fcy CodA ene suicide ge Figure 3.8 8. In vitro cell bystander effec ct test. NSCs were ttransduced d with BV-H HSV, BV-Fcy or BV-CodA B at a MOI of o 100 an nd directly y co-cultured d (a) or ind directly co-cultured (b b) with U87 7 cells. ** P < 0.001, * P < 0.05 by ANOVA A Analysiss. Each ba ar represe ents the avverage cell s d deviation off eight wells. viability ± standard 53 3 3.5 In vivo Comparisons of Three Suicide Gene/Prodrug Systems Having tested and compared the in vitro efficiency of the HSVtk/GCV and CD/5-FC systems in killing U87 cells, we next examined and compared the anti-tumor efficiency of both systems in vivo. The fold change in tumor volume is shown in Figure 3.7a, and the tumor volume detected by the IVIS imaging system at day 14 is shown in Figure 3.7b. Our previous study revealed that mesenchymal stem cells expressing HSVtk are able to slow down tumor growth (Bak et al., 2010). CD expressing-Neural stem cells also produced strong inhibitory effects on various tumors (Aboody et al., 2006; Joo et al., 2009; Kim et al., 2006; Shimato et al., 2007). Two mice subcutaneously injected with U87-luciferase cells into the root of the right and left thigh were sacrificed at 10 days after tumor inoculation-the exact day we start prodrug treatment. The tumors were removed and trypsinized in order to count the number of U87-luc cells. The number of inoculated U87-luc cells was approximately 1-2 x 107 (data not shown) at day 1. The ratio of transduced NSCs to U87-luc cells in vivo was approximately 0.5-1 to 100. After 1 week of 5-FC administration, tumor volumes decreased to 54 approximately 20% in both CD groups, whereas the tumor volume increased 18% (which is significantly higher than that in the NSC-CD group) in the NSCtk group after GCV treatment. Tumor recurrence observed at day 14 is likely resulted from the transient expression of the transgene mediated by the baculovirus, which may limit the application of baculoviruses in cancer gene therapy. At 14 days of treatment, up to 6.3-fold increases were observed in the HSVtk group, whereas the tumor volume in the groups of Fcy and Coda genes increased 3.6 and 5.3-fold, respectively. The in vivo inhibitory effect of the CD/5-FC system on tumor growth was more pronounced than the HSVtk/GCV system (though the differences were not significant at days 14 between Coda/5FC and HSVtk/GCV), indicating that the CD/5-FC system is able to induce a stronger bystander effect, even when the number of transduced cells is only 1% of that of tumor cells. 55 (a) 14 12 10 PBS contrrol * hESNSCF Fcy + 5FC ** ** 8 hESNSCtk + GCV ** Fold change hESNSCC CodA + 5FC 6 4 * ** ** ** 2 0 Day 1 1 Day 7 7 Day 1 14 Days aafter prodrug administratio on (b) Figure 3.9 9. In vivo comparison c n of glioma a therapy efficacy e be etween the e HSVtk/GC CV and CD/5-FC systems using NSCs. M Mice were e subcutane eously ino oculated with w U87-lluc, follow wed by in ntratumora al 56 6 injection of different numbers of transduced NSCs and i.p injection of the prodrugs GCV or 5-FC. (a) Fold change of the tumor volume compared to the tumor volume at day 1. The duration of treatment was 14 days. ** p 70% killing effect was achieved in HSVtk-transduced cells, even if 5,000 cells/well were seeded at the beginning of the experiment. These results suggest that glioma cells exhibit a higher sensitivity to the prodrugs in the HSVtk/GCV system than in the CD/5-FC system. The half-life of GCV is estimated to be approximately 100 min, whereas that of 5-FC is only 40 min (Quynh et al., 1995). The longer half-life of GCV suggests the possibility that more GCV is able to be enzymatically converted to the cytotoxic chemotherapy agent GCV triphosphate, which may be the possible explanation for the difference in the antitumor effect between HSVtk- and CD-transduced U87 cells. Furthermore, 5-FU resistance is possible. Approximately 8% of CD-transduced U87 cells remained alive 5 days after 5-FU treatment, even at the high 5-FU dosage of 30 μg/ml. 5-FU has been used as an anti-tumor chemotherapy agent for over 50 years (Curreri et al., 1958), and resistance to 5-FU results from excessive expression of thymidylate synthase (TS), which is the target of 5-FU. TS gene overexpression is a signature feature of 5-FU resistance (Longley et al., 2003). Deregulated expression of TS in tumor cells increases the expression of the free enzyme, which allows it to escape from irreversibly binding 5-FU, resulting in 5-FU resistance. The direct use of 5-FU does not have much effect against brain tumors. Enhanced TS activity has been found 60 in high-grade gliomas compared to TS activity in a normal brain (Bardot et al., 1994), suggesting that glioma cells may be resistant to 5-FU treatment. In addition to the overexpression of TS, Qian et al. (2007) have reported that Smug1 DNA glycosylase can excise the DNA which was incorporated with 5-FU and therefore may reduce the drug’s cytotoxicity which is considered another mechanism of 5-FU resistance. The concentration of prodrug needed to exhibit cytotoxicity is much higher in the CD/5-FC system than in the HSVtk/GCV system, which may explain the lower antitumor effect in CD-transduced cells. As shown in Figure 3.5b and c, a satisfactory inhibitory effect in HSVtk-transduced U87 cells was achieved at concentrations as low as 1 μM GCV. A similar antitumor effect in CD-transduced U87 cells could be achieved only when the concentration of 5-FC was increased to 150 μg/ml. Under conditions in which transduced U87 cells were seeded in 96-well plates at a higher concentration, 10 μM GCV may still have been enough to produce the antitumor effect, whereas 200 μg/ml 5-FC may not have been sufficient to generate enough 5-FU above the threshold required to kill glioma cells. Following prodrug treatment, cells expressing suicide genes die themselves and more importantly are able to kill neighboring cells by 61 inducing cell death. This property is known as the bystander effect. Because current technology does not allow the delivery of the suicide gene to all tumor cells, the bystander effect is crucial in cancer suicide gene therapy and plays an important role in determining the efficiency of suicide gene/prodrug systems. Only 10% of HSVtk-expressing cells are able to produce a strong antitumor bystander effect and result in complete in vivo tumor regression (Caruso et al., 1993; Culver et al., 1992; Ram et al., 1993). Furthermore, the bystander effect of the HSVtk/GCV system relies on close cell-to-cell contact through gap junctions (Fick et al., 1995; Pitts 1998). In contrast, because 5-FU is able to diffuse through the cell membrane by non-facilitated diffusion into neighboring cells (Huber et al., 1994; Miller et al., 2002), it is able to diffuse to more distant cells, and close range cell contact is unnecessary. The bystander effect of CD/5-FC is independent of gap junctions, suggesting that CD/5-FC is stronger than the HSVtk/GCV system for tumor therapy, especially because gap junctions are downregulated in most cancer cell lines (Holder et al., 1993). As a matter of fact, CD/5-FC system is reported to have more powerful activity in the in vitro eradication of several cancer cell lines (Kuriyama et al., 1999; Rogers et 62 al., 1996; Trinh et al., 1995). Consistent with previous studies, we confirmed that the CD/5-FC system exhibited a stronger bystander effect than the HSVtk/GCV system (Figure 3.6 and Figure 3.7a). A 10% transduction of U87 cells with CD was able to elicit a > 50% antitumor effect, whereas a 10% transduction with HSVtk resulted in only 10% cell death (Figure 3.6). An inhibitory effect towards cell growth was minimally recorded when HSVtk-transduced NSCs were mixed with U87 cells at a low ratio of 2:98. However, CD-transduced NSCs mix with U87 at the same ratio exhibited an ~40% antitumor effect (Figure 3.8a). A transwell system was employed to test whether close range cell contact is necessary for the bystander effect of both systems. Not surprisingly, physical contact was not essential in the bystander effect induced by CD/5-FC. However, a significant reduction in the bystander effect caused by HSVtk/GCV was observed in the absence of close cellular proximity (Figure 3.8b). Although the major protein comprising the gap junction, connexin-43, is down-regulated or even completely lost in different tumors (Laird et al., 1999; Mehta et al., 1999; Mesnil et al., 2005; Tsai et al., 1996), gap-junctional intercellular communication (GJIC) is preserved in human glioblastoma cells. Cottin et al. (2008) reported that glioblastoma 63 cell surface expresses only few gap junctions, whereas most of the connexin-43 is presented in lysosomes and late endosomes. Their results suggested that gap junctions are highly functional in glioblastoma cells, demonstrating the value of HSVtk/GCV therapy. Although gap junctions are highly functional in U87 compared to other tumor types, the bystander effect caused by HSVtk/GCV is inferior to that caused by CD/5-FC, clearly suggesting the superiority of the CD/5-FC system. We used the transwell system to fully avoid physical contact between HSVtk-transduced NSCs (that were seeded in the upper chamber) and U87 cells (that were seeded in the bottom chamber). An ~30% antitumor effect remained in the absence of close range of cell contact, indicating that the gap junction may not be the sole means for HSVtk/GCV to exhibit its bystander effect. Transfer of apoptotic vesicles and exocytosis of cytotoxic factors (Barba et al., 1994; Freeman et al., 1993) may be another mechanism underlying the transmission of cytotoxic chemotherapeutic agents from HSVtk-expressing cells to other cells after GCV treatment. Several approaches have been used to enhance the antitumor effect of 64 suicide gene/prodrug systems. Because gap junctions play key role in bystander effect of HSVtk/GCV, restoring these junctions may upgrade this system and enhance its ability to eradicate tumor cells. Huang et al. (2010) demonstrated that the HSVtk/GCV bystander effect is amplified in bone marrow-derived stem cells expressing HSVtk associated with the over-expression of connexin-43 when connexin-43 is introduced into glioma cells. Yeast-derived CD (yCD or Fcy in this study) and bacterial CD (bCD or CodA in this study) are two distinct forms of CD. yCD is less thermostable than bCD, and the product released from CD is rate limiting (Katsuragi et al., 1987; Yao et al., 2005). However, yCD displays superior kinetic properties toward 5-FC and a slightly improved antitumor effect than bCD in vivo (Kievit et al., 1999). In our study, no significant difference between the anti-glioma effect of yCD and bCD was observed either in vitro or in vivo, indicating that the application of both CD genes is feasible in glioma gene therapy. Increasing the intracellular concentration of the prodrug is one strategy for increasing the efficacy of CD/5-FC. The combination of E. coli CD and uracil phosphoribosyl transferase (UPRT) significantly improves the 65 therapeutic effect of CD/5-FC by direct conversion of 5-FU into 5-fluorouridine monophosphate (5-FUMP) (Koyama et al., 2000). Extracellular expression of CD is another approach to increase the antitumor effect of CD/5-FC. A high intracellular concentration of 5-FU may result in the premature killing of CD-expressing cells and a shut down of the ‘5-FU factory’, even before the cytotoxic extracellular concentration of 5-FU is achieved (Lawrence et al., 1998). Rehemtulla et al. (2004) constructed a soluble, secreted form of CD and achieved gradual inhibition of TS, which prolongs the survival time of CD-expressing cells and improves the bystander effect. Genetic modification of the CD gene also improves the therapeutic effect of CD/5-FC. A mutated E. coli CD has a higher affinity for cytosine, which results in a superior in vitro antitumor effect towards glioma cells than wild type CD. In vivo analysis has also revealed a large inhibition of tumor growth by the combination of mutated CD/5-FC plus ionizing radiation compared to wild type CD/5-FC with radiation (Kaliberov et al., 2007). Both in vitro and in vivo results demonstrate that the CD/5-FC system induces stronger bystander effect compared with HSVtk/GCV system. Quynh et al. (1995) reported that as little as 4% expression of CD in the 66 WiDr human colorectal carcinoma cell line can produce a remarkable bystander effect, with 60% of the mice remaining tumor-free up to day 70, whereas 50% expression of HSVtk in WiDr cells is needed to achieve the same effect (Quynh et al., 1995). In our experiments, during the first week of treatment when baculoviral-mediated transgene expression was significantly strong, the tumor volume decreased after NSC-CD intratumoral injection and 5-FC administration (Figure 3.9a). In contrast, in another group of mice injected with NSC-tk, the tumor volume increased. Compared to the number of tumor cells injected at day 1, the injected NSCs were very limited. However, the strong bystander effect induced by NSCs expressing CD was still able to exert a promising inhibitory effect on tumor development when the ratio of injected NSCs to tumor cells was < 1:100. Because only a limited percentage of injected NSCs can migrate from a distant injection site to the tumor mass or satellite sites, a strong bystander effect elicited by therapeutic cells is crucial to the inhibition of tumor growth. 67 CHAPTER V CONCLUSION 68 In summary, we demonstrated that the CD/5-FC system is superior to the HSVtk/GCV system both in vitro and in vivo. Our in vitro data reveals that although the sensitivity of CD to 5-FC is inferior to that of HSVtk to GCV; the CD/5-FC system displays stronger inhibitory effects on tumor growth than the HSVtk/GCV system by inducing a stronger bystander effect. We also prove that the bystander effect caused by CD/5-FC does not require close proximity cell contact, which is the key factor in the bystander effect induced by HSVtk/GCV. The in vivo results also support the superiority of the CD/5-FC system over the HSVtk/GCV system. Our data suggests that the strong bystander effect induced by the CD/5-FC system enables limited CD-expressing NSCs to inhibit tumor growth in vivo. In addition, no difference was observed between the yCD/5-FC system and the bCD/5-FC system, indicating the feasibility of using both CD/5-FC systems in glioma gene therapy. In conclusion, our findings demonstrate the superiority of the CD/5-FC system over the HSVtk/GCV system and provide a more effective suicide gene/prodrug system for future glioma gene therapy using neural stem cells as the vector. 69 CHAPTER VI REFERENCES 70 Aboody K.S., Brown A., Rainov N.G., Bower K.A., Liu S., Yang W., Small J.E., Herrlinger U., Ourednik A. and Black , P.M. (2000). Neural stem cells display extensive tropism for pathology in adult brain: evidence from intracranial gliomas PNAS, 97:12846-12851 Aboody KS, Najbauer J, Schmidt NO, Yang W, Wu JK and Zhuge Y(2006)Targeting of melanoma brain metastases using engineered neural stem/progenitor cells. Neuro Oncol, 8:119–126. AdvHSV-tk gene therapy with intravenous ganciclovir improves survival in human malignant glioma: a randomised, controlled study. Mol. Ther. 10(5):967-972. Alvarez-Buylla A and Doetsch F. (2002) Identification of neural stem cells in the adult vertebrate brain. Brain Research Bulletin, 57: 751-78. Alnawaz rehemtulla, Daniel A. Hamstra, Els Kievit, Mary A Davis, Emily Y NG, Kenneth Dornfeld and Theodore S. Lawrence (2004) Extracellular Expression of Cytosine Deaminase Results in Increased 5-FU Production for Enhanced Enzyme/Prodrug Therapy Anticancer Research 24:393-1400 Ammerpohl,Thormeyer D,Khan Z,Appelskog IB,Gojkovic Z ,Almqvist PM, Ekström TJ (2004) HDACi phenylbutyrate increases bystander killing of HSV-tk transfected glioma cells. Biochem Biophys Res Commun 324: 8-14. Anders I. Persson, QiWen Fan, Joanna J. Phillips and William A. Weiss (2007), Neurobiology of Disease, 433-444 Austin, E.A., Huber, B.E., (1993). A first step in the development of gene therapy for colorectal carcinoma: cloning, sequencing, and expression of Escherichia coli cytosine deaminase. Mol. Pharmacol, 43(3):380–387. Bak X Y; Yang J and Wang S (2010) Baculovirus-transduced bone marrow mesenchymal stem cells for systemic cancer therapy. Cancer gene therapy, 17(10):721-9. Barba D., Hardin J., Sadelain M. and Gage, F.H. (1994) Development of anti-tumor immunity following thymidine kinase-mediated killing of 71 experimental brain tumors, Proc. Natl. Acad. Sci. U. S. A. 91:4348–4352. Bardot V.,. Dutrillaux A.M, Delattre J.Y., Vega, F. M. Poisson, B. Dutrillaux and Curreri AR, Ansfield FJ, McIver FA, Waisman and HA,Heidelberger C. (1958) Clinical studies with 5-fluorouracil.Cancer Res,18:478-84 Barresi V, Belluardo N, Sipione S, Mudo G, Cattaneo E and Condorelli DF. (2003)Transplantation of prodrug-converting neural progenitor cells for brain tumor therapy. Cancer Gene Ther, 10: 396-402. Beltinger C, Fulda S, Kammertoens T, Meyer E, Uckert W and Debatin KM. (1999) Herpes simplex virus thymidine kinase/ganciclovir induced apoptosis involves ligand-independent death receptor aggregation and activation of caspases. Proc Natl Acad Sci USA, 96: 8699-704. Boucher PD, Im MM, Freytag SO and Shewach DS (2006) A novel mechanism of synergistic cytotoxicity with 5-fluorocytosine and ganciclovir in double suicide gene therapy. Cancer Res, 66: 3230-7. Caruso M, Panis Y, Gagandeep S, Houssin D, Salzmann JL, and Klatzmann D. (1993)Regression of established macroscopic liver metastases after in situ transduction of a suicide gene. Proc Natl Acad Sci USA, 90:7024-7028 Condreay, J.P., Witherspoon, S. M., Clay, W. C. and Kost, T. A. (1999) Transient and stable gene expression in mammalian cells transduced with a recombinant baculovirus vector. Proc Natl Acad Sci U S A, 96(1):127-32 Corban‐Wilhelm H.G et al. (2003) Cytosine deaminase versus thymidine kinase:a comparison of the antitumor activity, Clin Exp Med, 3:150–156 Cottin, K Ghani and M Caruso (2008) Bystander effect in glioblastoma cells with a predominant cytoplasmic localization of connexin43. Cancer Gene Therapy, 15:823–831S Culver KW, Ram Z, Wallbridge S, Ishii H and Oldfield EH,Blaese RM. (1992)In vivo gene transfer with retroviral vectorproducer cells for 72 treatment of experimental brain tumors. Science, 256:1550-1552. Danks MK, Yoon KJ and Bush RA (2007) Tumor-targeted enzyme/prodrug therapy mediates long-term disease-free survival of mice bearing disseminated neuroblastoma. Cancer Res, 67:22-25. Danthinne, X.,and Imperiale, M. J. (2000) Production of first generation adenovirus vectors: a review. Gene Ther, 7: 1707 – 1714. Dietz GP, Bahr M. (2004) Delivery of bioactive molecules into the cell: the Trojan horse approach. Mol Cell Neurosci, 27: 85–131. Dilber, M. S. et al (1997) Gap Junctions Promote the Bystander Effect of Herpes Simplex Virus Thymidine Kinase in Vivo Cancer Res, 57:1523–1528. Drake RR, Pitlyk K, McMasters RA, Mercer KE, Young H, Moyer MP (2000) Connexin-independent ganciclovir-mediated killing conferred on bystander effect-resistant cell lines by a herpes simplex virusthymidine kinase-expressing colon cell line. Mol Ther, 2: 515-23. Edelstein ML, Abedi MR and Wixon J (2007) Gene therapy clinical trials worldwide to 2007--an update. J Gene Med, 9(10):833-42 Fick J, Barker FG, Dazin P, Westphale EM and Beyer EC,Israel MA. (1995)The extent of heterocellular communication mediated by gap junctions is predictive of bystander tumor cytotoxicity in vitro. Proc Natl Acad Sci USA, 92:11071-11075 Fine H.A., Dear K.B. and Loeffler J.S. (1993) Meta-analysis of radiation therapy with and without adjuvant chemotherapy for malignant gliomas in adults, Cancer, 71:2585–2597 Freeman S.M., Abboud C.N, Whartenby K.. Packman C.H, Koeplin D.S F.L. Moolten and G.N. Abraham (1993) The ‘‘bystander effect’’: tumor regression when a fraction of the tumor mass is genetically modified, Cancer Res. 53:5274–5283. Ghosh S, Parvez MK, Banerjee K, Sarin SK and Hasnain SE (2002) Baculovirus as Mammalian Cell Expression Vector for Gene Therapy: 73 An Emerging Strategy. Mol Ther, 6(1):5-11. Hassan, N.Y. Ibrahim and D.O. Darwish (2009) 8708 Glioblastoma multiforms, long term survivers, single institution experience European Journal of Cancer Supplements, 7(2):496 Herrlinger U, Woiciechowski C and Sena-Esteves M (2000) Neural precursor cells for delivery of replication-conditional HSV-1 vectors to intracerebral gliomas. Mol Ther, 1: 347-57. Ho YC, Chen HC, Wang KC and Hu YC (2004) Highly efficient baculovirus-mediated gene transfer into rat chondrocytes Biotechnol Bioeng, 88(5):643−651. Ho YC, Chung YC, Hwang SM, Wang KC and Hu YC (2005) Transgene expression and differentiation of baculovirus-transduced human mesenchymal stem cells. J Gene Med, 7(7):860-8. Holder JW, Elmore E ,and Barrett JC. (1993) Gap junction function and cancer. Cancer Res, 53:3475–85. Hotz-Wagenblatt, A.,and Shalloway (1993) D. Gap junctional communication and neoplastic transformation. Crit. Rev. Oncog., 4:541–558 Holland, E. C (2000) Glioblastoma multiforme: the terminator. Proc Natl Acad Sci U.S.A, 97: 6242-6244. Huang Q, Liu X-Z, Kang C-S, Wang G-X, Zhong Y and Pu P-Y (2010)The anti-glioma effect of suicide gene therapy using BMSC expressing HSV/TK combined with overexpression of Cx43 in glioma cells. Cancer Gene Therapy, 17:192–202 Huber BE, Austin EA, Richards CA, et al. (1994) Metabolism of 5-fluorocytosine to 5-fluorouracil in human colorectal tumor cells transduced with the cytosine deaminase gene: Significant antitumor effects when only a small percentage of tumor cells express cytosine deaminase. Proc Natl Acad Sci U S A, 91:8302-8306. Immonen, A., Vapalahti, M., Tyynela, K., Hurskainen, H., Sandmair, A., Vanninen, R., Langford, G., Murray, N., and Yla-Herttuala, S. (2004). AdvHSV-tk gene therapy with intravenous ganciclovir improves survival 74 in human malignant glioma: a randomised, controlled study. Mol Ther, 10:967-972. James Butcher (2004) Adult neural stem cells localised in SVZ. The Lancet Neurology, 3(4):198 Jennifer K Chen, Lily J Hu. Wang D.F., Kathleen R Lamborn and Dennis F. Deen (2007) Cytosine Deaminase/5-Fluorocytosine Exposure Induces Bystander and Radiosensitization Effects in Hypoxic Glioblastoma Cells in vitro. Int. J. Radiation Oncology Biol. Phys., 67(5)1538-1547 Joo KM, Park IH, Shin JY, Jin J, Kang BG and Kim MH(2009) Human neural stem cells can target and deliver therapeutic genes to breast cancer brain metastases. Mol Ther, 17:570–575 Kuriyama, S., Masui, K., Sakamoto, T., Nakatani, T., Kikukawa, M., Tsujinoue, H., Mitoro, A.,Yamazaki, M., Yoshiji, H., Fukui, H., Ikenaka, K., Mullen, C.A., Tsujii, T., (1998) Bystander effect caused by cytosine deaminase gene and 5-fluorocytosine in vitro is substantially mediated by generated 5-fluorouracil. Anticancer Res. 18(5A):3399–3406. Kalevi J. Pulkkanen, Seppo Yla-Herttuala (2005) Gene therapy for malignant glioma: current clinical status. Mol ther, 12(4):585-98. Kaliberov SA, Market JM, Gillespie GY, Krendelchtchikova V, Manna D Della, Sellers JC, Kaliberova LN, Black ME and Buchsbaum DJ (2007) Mutation of Escherichia coli cytosine deaminase significantly enhances molecular chemotherapy of human glioma. Gene Therapy, 14: 1111-1119 Katsuragi, T., Sakai, T.and Tonomura, K. (1987).Implantable enzyme capsules for cancer chemotherapy from bakers' yeast cytosine deaminase immobilized on epoxy–acrylic resin and urethane prepolymer. Appl. Biochem. Biotechnol, 16:61–69. Kaveh Asadi-Moghaddam and E. Antonio Chiocca (2009) Gene- and Viral-Based Therapies for Brain Tumors Neurotherapeutics: The Journal of the American Society for Experimental NeuroTherapeutics, 6:547–557, Kay, M. A., Glorioso, J. C., and Naldini, L. (2001). Viral vectors for gene 75 therapy: the art of turning infectious agents into vehicles of therapeutics. Nat. Med, 7:33-40 Khil MS, Kim JH, Mullen CA, et al. (1996) Radiosensitization by 5-fluorocytosine of human colorectal carcinoma cells in culture transduced with cytosine eaminase gene. Clin Cancer Res, 2:53–57. Kievit, E., Bershad, E., Ng, E., Sethna, P., Dev, I.,Lawrence, T. S. and Rehemtulla, A. (1999). Superiority of yeast over bacterial cytosine deaminase for enzyme/ prodrug gene therapy in colon cancer xenografts. Cancer Res, 59:1417–1421. Kievit Els, Nyati M K, Ng Emily, Lauren Stegman, Parsels Josh, Ross B D, Rehemtulla Alnawaz, and. Lawrence T S (2000) Yeast Cytosine Deaminase Improves Radiosensitization and Bystander Effect by5-Fluorocytosine of Human Colorectal Cancer Xenografts. Cancer research, 60:6649–6655 Kim SK, Kim SU, Park IH, Bang JH, Aboody KS and Wang KC (2006) Human neural stem cells target experimental intracranial medulloblastoma and deliver a therapeutic gene leading to tumor regression. Clin Cancer Res, 12: 5550–5556 Kleihues P, Cavenee WK (2000) World Health Organization Classification of Tumours, Pathology and Genetics of Tumors of the Nervous System IARC Press Lyon, 29-39 Kun, L. E., et al. (1995). Stereotactic injection of herpes simplex thymidine kinase vector producer cells (PA317-G1Tk1SvNa.7) and intravenous ganciclovir for the treatment of progressive or recurrent primary supratentorial pediatric malignant brain tumors. Hum. Gene Ther. 6:1231:1255. Kuriyama S, Mitoro A, Yamazaki M, Tsujinoue H, Nakatani T, Akahane T et al. (1999) Comparison of gene therapy with the herpes simplex virus thymidine kinase gene and the bacterial cytosine deaminase gene for the treatment of hepatocellular carcinoma. Scand J Gastroenterol, 34:1033-1041. Koyama F, Sawada H,Fuji H, Hirao T, Ueno M and Nakano H (2000)Adenoviral-mediated transfer of Escherichia coli uracil 76 phosphoribosyltransferase (UPRT) gene to modulate the sensitivity of the human colon cancer cells to 5-fluorouracil. Eur J cancer, 36(18):2403-10. Laird DW, Fistouris P, Batist G, Alpert L, Huynh HT, Carystinos GD et al. (1999) Deficiency of connexin43 gap junctions is an independent marker for breast tumors. Cancer Res, 59:4104-4110. Lawrence TS, Rehemtulla R, Ng EY, Wilson M, Trosko JE and Stetson PL(1998) Preferential cytotoxicity of cells transduced with cytosine deaminase compared to bystander cells after treatment with 5-flucytosine. Cancer Res, 58: 2588-2593 Li S., Tokuyama T., Yamamoto J., Koide M., Yokoya N., and MNamba H. (2005) Bystander effect-mediated gene therapy of gliomas using genetically engineered neural stem cells. Cancer Gene Therapy, 12:600-607. Longley DB, Harkin DP, Johnston PG. (2003) 5-fluorouracil: mechanisms of action and clinical strategies. Nat Rev Cancer, 3:330-8. Louis DN, Ohgaki H, Wiestler OD, Cavenee WK and Burger PC (2007) The 2007 WHO classification of tumours of the central nervous system. Acta Neuropathol, 114: 97–109. McMasters, R. A. (1998) Lack of bystander killing in herpes simplex virus thymidine kinase-transduced colon cell lines due to deficient connexin43 gap junction formation Hum. Gene Ther,,9(15):2253-2261. Mehta PP, Perez-Stable C, Nadji M, Mian M and Asotra K,Roos BA. (1999)Suppression of human prostate cancer cell growth by forced expression of connexin genes. Dev Genet, 24:91-110. Merilainen O, Hakkarainen T, Wahlfors T, Pellinen R, Wahlfors J. (2005)HIV-1 TAT protein transduction domain mediates enhancement of enzyme prodrug cancer gene therapy in vitro: a study with TAT-TK-GFP triple fusion construct. Int J Oncol, 27:203–208 Mesnil M, Crespin S, Avanzo JL and Zaidan-Dagli ML. (2005) Defective gap junctional intercellular communication in the carcinogenic process. Biochim Biophys Acta, 1719:125–145. Mesnil,M., Piccoli, C., Tiraby, G., Willecke, K. and Yamasaki, H. (1996). 77 Bystander killing of cancer cells by herpes simplex virus thymidine kinase gene is mediated by connexins. Proc. Natl. Acad. Sci. USA 93:1831–1835. Miller CR, Williams CR, Buchsbaum DJ, et al. (2002) Intratumoral 5-fluorouracil produced by cytosine deaminase/5-fluorocytosine gene therapy is effective for experimental human glioblastomas. Cancer Res, 62:773–780. Luccioni C. (1994) Purine and pyrimidine metabolism in human gliomas: relation to chromosomal aberrations. Br. J. Cancer, 70:212–218 Moolten FL. (1986) Tumor chemosensitivity conferred by inserted herpes thymidine kinase genes: paradigm for a prospective cancer control strategy. Cancer Res, 46:5276-81. Moolten FL and Wells JM. (1990) Curability of tumors bearing herpes thymidine kinase genes transferred by retroviral vectors. J Natl Cancer Inst, 82: 297-300. Ohgaki, H. and Kleihues, P. (2005). Epidemiology and etiology of gliomas. Acta. Neuropathol (Berl), 109, 93–108. Oldfield, E. H., Ram, Z., Culver, K.W., Blaese, R. M., DeVroom, H. L., and Anderson, W.F. (1993). Gene therapy for the treatment of brain tumors using intra-tumoral transduction with the thymidine kinase gene and intravenous ganciclovir. Hum. Gene Ther, 4:39-69. Peter Robins, Tomas Lindahl, Deborah E. Barnes and Qian An (2007)5-Fluorouracil Incorporated into DNA Is Excised by the Smug1 DNA Glycosylase to Reduce Drug Cytotoxicity, Cancer Res, 67:940-945. Pitts JD. (1998) The discovery of metabolic co-operation. Bioessays, 20: 1047-1051. Rainov N.G. and Ren H. (2003) Clinical trials with retrovirus mediated gene therapy—What have we learned? J. Neurooncol, 65: 227 – 236 Ram Z, Culver KW, Walbridge S, Blaese RM and Oldfield EH. (1993) In situ retroviral-mediated gene transfer for the treatment of brain tumors in rats. Cancer Res, 53:83–88. Raffel, C et al. (1994). Gene therapy for the treatment of recurrent 78 pediatric malignant astrocytomas with in vivo tumor transduction with the herpes simplex thymidine kinase gene/ganciclovir system. Hum. Gene Ther. 5: 863-890. Rogers RP, Ge JQ, Holley-Guthrie E, Hoganson DK, Comstock KE, Olsen JC et al. (1996) Killing Epstein-Barr viruspositive B lymphocytes by gene therapy: comparing the efficacy of cytosine deaminase and herpes simplex virus thymidine kinase. Hum Gene Ther, 7:2235-2245. Rogulski KR, Zhang K, Kolozsvary A, et al. (1997)Pronounced antitumor effects and tumor radiosensitization of double suicide gene therapy. Clin Cancer Res, 3:2081-2088. Rosenberg SA, Aebersold P and Cornetta K, (1990) Gene transfer into humans – immunotherapy of patients with advancedmelanoma using tumor-infiltrating lymphocytes modified by retroviral gene transduction. N Engl J Med, 323: 570–578. Sandmair (2000) Thymidine kinase gene therapy for human malignant glioma, using replication-deficient retroviruses or adenoviruses. Hum. Gene Ther,. 11:2197 – 2205. Sanson M, Marcaud V, Robin E, Valery C, Sturtz F and Zalc B (2002) Connexin 43-mediated bystander effect in two rat glioma cell models. Cancer Gene Ther, 9:149-55. Shimato S, Natsume A, Takeuchi H, Wakabayashi T, Fujii M and Ito M (2007) Human neural stem cells target and deliver therapeutic gene to experimental leptomeningeal medulloblastoma. Gene Ther, 14: 1132–1142. Sneed PK, Gutin PH, Larson DA, Malec MK, Phillips TL, Prados MD (1994)Patterns of recurrence of glioblastoma multiforme after external irradiation followed by implant boost. Int J Radiat Oncol Biol Phys, 29:719-27. Stackhouse MA, Pederson LC, Grizzle WE, et al. (2000) Fractionated radiation therapy in combination with adenoviral delivery of the cytosine deaminase gene and 5-fluorocytosine enhances cytotoxic and antitumor effects in human colorectal and cholangiocarcinoma models. Gene Ther, 7:1019-1026 79 Tai, C.K., Wang, W.J., Chen, T.C., and Kasahara, N., (2005). Single-shot, multicycle suicide gene therapy byreplication-competent retrovirus vectors achieves long-term survival benefit in experimental glioma. Mol. Ther, 12(5): 842–851. Thomas DM and Zalcberg JR. (1998)5-Fluorouracil: A pharmacological paradigm in the use of cytotoxics. Clin Exp Pharmacol Physiol, 25:887-895. Touraine, R. L. et al (1998) The bystander effect in the HSVtk/ganciclovir system and its relationship to gap junctional communication Gene Ther, 5:1705–1711. Trask, T. W., Trask, R. P., Aguilar-Cordova, E., Shine, H. D., Wyde, P. R.,Goodman, J. C., Hamilton, W. J., Rojas-Martinez, A., Chen, S. H., Woo, S.L., and Grossman, R. G. (2000). Phase I study of adenoviral delivery of the HSV-tk gene and ganciclovir administration in patients with current malignant brain tumors. Mol Ther, 1:195-203. Trinh QT, Austin EA, Murray DM, Knick VC and Huber BE. (1995)Enzyme/prodrug gene therapy: comparison of cytosine deaminase/5-fluorocytosine versus thymidine kinase/ganciclovir enzyme/prodrug systems in a human colorectal carcinoma cell line. Cancer Res, 55:4808-4812. Tsai H, Werber J, Davia MO, Edelman M, Tanaka KE, Melman A et al. (1996) Reduced connexin 43 expression in high grade, human prostatic adenocarcinoma cells. Biochem Biophys Res Commun. 227:64–69. Uckert W, Kammertons T, Haack K, Qin Z, Gebert J,Schendel DJ et al. (1998) Double suicide gene (cytosine deaminase and herpes simplex virus thymidine kinase) but not single gene transfer allows reliable elimination of tumor cells in vivo. Hum Gene Ther, 9:855-865. Vile R. G.,and Russell S. J. (1995) Retroviruses as vectors. Br. Med. Bull, 51: 12 – 30 Vrionis FD, Wu JK, Qi P, Waltzman M, Cherington V, Spray DC. (1997)The bystander effect exerted by tumor cells expressing the herpes simplex virus thymidine kinase (HSVtk) gene is dependent on connexin expression and cell communication via gap junctions. Gene Therapy, 4: 577-585, 80 West, T. P., Shanley, M. S., and O’Donovan, G. A. (1982) Purification and some properties of cytosine deaminase from Salmonella typhimurium. Biochim. Biophys. Acta, 719:251-258,. Whittle I.R., Denholm S.W. and Gregory A (1991) Management of patients aged over 60 years with supratentorial glioma: lessons from an audit. Surg Neurol, 36:106–111 Xia K, Liang D, Tang A, Feng Y, Zhang J, Pan Q et al. (2004) A novel fusion suicide gene yeast CDglyTK plays a role in radio-gene therapy of nasopharyngeal carcinoma. Cancer Gene Ther, 11:790-796. Yang L, Chiang Y, Lenz HJ, Danenberg KD, Spears CP, Gordon EM, Anderson WF and Parekh D. (1998) Intercellular communication mediatesthe bystander effect during herpes simplex thymidine kinase/ganciclovir-based gene therapy of human gastrointestinal tumor cells. Hum. Gene. Ther. 9:719-728. Yao, L., Li, Y.,Wu, Y., Liu, A. & Yan, H. (2005) Product release is rate-limiting in the activation of the prodrug 5-fluorocytosine by yeast cytosine deaminase. Biochemistry, 44:5940–5947 Zeng J.D, Zhao J, Palanisamy, N. and Wang, S. (2007) Baculoviral vectormediated transient and stable transgene expression in human embryonic stem cells. Stem Cells, 25(4): 1055-6. 81 [...]... deaminates nontoxic 5- fluorocytosine (5- FC) into the potent chemotherapeutic drug 5- fluorouracil (5- FU) 5- FU can be converted into 5- fluoro-20-deoxyuridine -50 -monophosphate (5- FdUMP), which blocks thymidylate synthase, or into 5- fluorouridine -50 -triphosphate (5- FUTP), which disrupts RNA functions by incorporation 5- FdUTP can be metabolized from the precursor’s 5- FUTP and 5- FUDP, and incorporated into... al., 2007; Herrlinger et al., 2000; Li et al., 20 05; Uhl et al., 20 05) 8 1.3 Suicide Gene /Prodrug System Used in Gene Therapy Gene therapy is one of the most promising new frontiers in medical therapeutic intervention, especially in tumor therapy Currently used applications in glioma gene therapy are primarily tumor suppressor and cell cycle modulation, genetic immune modulation, transfer of anti-angiogenic... is generally inefficient (Kalevi and Seppo, 20 05) 4 1.2 Gene Therapy for Gliomas Because the outcome of conventional approaches is unsatisfactory, novel therapeutic strategies are urgently needed As a promising new cancer therapy approach, gene therapy is a technique which involves introduction or removal of genes within cells to treat diseases Since the first clinical trial involving human gene therapy. .. remarkably prolong the survival time of mice harboring orthotopic human glioma xenografts (Tai et al., 20 05) 13 Yeast Cytosine Deaminase (yCD) and bacterial Cytosine Deaminase (bCD) are two separate forms of naturally evolved CD Both forms have been extensively used and studied in gene therapy However, the use of bCD is limited by its poor efficiency in deaminating 5- FC (West et al., 1982) Compared to... additional advantage of CD /5- FC treatment As CD /5- FC and HSVtk/GCV are widely used in cancer gene therapy, several studied have compared the efficiency of these two systems in eliminating tumors in vitro as well as in vivo Compared to HSVtk/GCV system, the use of CD /5- FC in cancer gene therapy causes a greater bystander effect The major reason for this greater effect is that the diffusion of 5- FU does not... effect in vitro, but this system is less effective in eliminating the tumor in vivo (Corban et al., 2003) In other experiments, CD /5- FC therapy produces 15 a stronger bystander effect than HSVtk/GCV both in vitro (Kuriyama et al., 1999) and in vivo (Quynh et al., 19 95) Synergistic anticancer effects of HSVtk/GCV and CD /5- FC therapies have also been studied The combination of both gene- directed enzyme/ prodrug. .. and prodrug- activating gene therapy (Kaveh and Antonio, 2009) The suicide gene /prodrug system is an approach which is commonly used in glioma gene therapy Cells which were transduced with specific suicide genes can produce enzymes which catalyze the conversion of prodrug, from its non-toxic form to toxic form, allowing it to induce a therapeutic effect on tumor cells High level of intratumoral chemotherapy... from malignant gliomas In one study, the mean survival of patients who received HSVtk/GCV treatment increased to 71 weeks, while that of the control group was only 39 weeks (Immonen et al., 2004) 12 1.3.2 Cytosine Deaminase( CD) / 5- Fluorocytosine (5- FC) Both the codBA operon from Escherichia coli and the FCY1 gene from yeast (Saccharomyces cerevisiae) are able to encode cytosine deaminase (Danielsen et... the combination of bacmid DNA and Cellfectin reagent in unsupplemented Grace’s Medium (Invitrogen, CA, USA) Cells were incubated in 27°C incubator for 5 hours and then the unsupplemented Grace’s Medium was replaced with Sf-900 II serum-free medium P1 virus can be harvested after 72 hours incubation in 27°C incubator P3 virus was propagated from P1 virus according to the manual Budded viruses in the... (Holland, 2000) Overexpression of matrix metalloproteinases (MMPs) in gliomas influences glioma migration Furthermore, invasion of tumor cells is regulated by several proteins, such as proline-rich tyrosine kinase (PYK2), Rho proteins and focal adhesion kinase (FAK) (Anders et al., 2007) Surgical resection together with radiotherapy and/or chemotherapy is current conventional glioma therapy This therapeutic ... Suicide Gene /Prodrug Systems Used in Gene Therapy .…… 1.3. 1Herpes Simplex Virus Type (HSV-1) Thymidine Kinase( HSVtk) /Ganciclovir( GCV)………………………… 10 1.3.2 Cytosine Deaminase( CD) / 5- Fluorocytosine (5- FC)…... .58 Conclusion 68 III References .70 IV Summary Cytosine deaminase (CD) /5- fluorocytosine (5- FC) and herpes simplex virus thymidine kinase (HSVtk) /ganciclovir (GCV) systems. .. Cell Sorting FBS Fetal bovine serum GBM Glioblastoma Multiforme GCV Ganciclovir HSV Herpes Simplex Virus HSVtk Herpes Simplex Virus Thymidine Kinase Luc Luciferase MOI Multiplicity of Infection