COMPARISON OF CYTOSINE DEAMINASE 5 FLUOROCYTOSINE VERSUS HERPES SIMPLEX VIRUS THYMIDINE KINASE GANCICLOVIR ENZYME PRODRUG SYSTEMS IN GLIOBLASTOMA GENE THERAPY

Báo cáo khoa học: Viral entry mechanisms: cellular and viral mediators of herpes simplex virus entry potx

Báo cáo khoa học: Viral entry mechanisms: cellular and viral mediators of herpes simplex virus entry potx

... 2009 FEBS 7229 Cellular and viral mediators of HSV entry J Akhtar and D Shukla with a cellular membrane results in content mixing and the eventual release of the viral nucleocapsid and tegument ... FEBS 7233 Cellular and viral mediators of HSV entry J Akhtar and D Shukla additional studies are needed to determine and establish the significance of poten...

Ngày tải lên: 23/03/2014, 04:20

9 636 0
Báo cáo sinh học: " The herpes simplex virus UL20 protein functions in glycoprotein K (gK) intracellular transport and virus-induced cell fusion are independent of UL20 functions in cytoplasmic virion envelopment" docx

Báo cáo sinh học: " The herpes simplex virus UL20 protein functions in glycoprotein K (gK) intracellular transport and virus-induced cell fusion are independent of UL20 functions in cytoplasmic virion envelopment" docx

... from domains functioning in UL20p/gK intracellular transport and virus- induced cell fusion Conclusion These results show that UL20p domains required for UL20p and gK intracellular transport and TGN ... encoding glycoprotein B (gB) [13,14], and the UL53 gene coding for glycoprotein K (gK) [15-19] Of these four membrane associated proteins, only UL20 and...

Ngày tải lên: 18/06/2014, 18:20

12 526 0
Báo cáo sinh học: " Persistent expression of chemokine and chemokine receptor RNAs at primary and latent sites of herpes simplex virus 1 infection" pptx

Báo cáo sinh học: " Persistent expression of chemokine and chemokine receptor RNAs at primary and latent sites of herpes simplex virus 1 infection" pptx

... (0.3 11 ) (1. 0–5.0) 14 (1. 0–40) CCR7 24 (8.0–40) (3.0–6.5) 17 (13 – 21) 13 (9.0 17 ) 19 (17 –20) (2.0 11 ) CXCR3 10 (5.0 18 ) 15 (8.0–23) (2.8–6.5) (1. 0–4.0) 10 4 (54 16 0) 36 (14 –59) CXCR4 11 (4.8 14 ) (1. 7–4.0) ... Cornea and Trigeminal Ganglia (TG) Corneaa TGb Gene 3d 10 d 30d 3d 10 d 30d CCR1 11 (9.2 12 ) 18 (13 –23) 20 (10 –26) (2.2–7 .1) 15 (9.0 19 ) (1. 7–7.0) CCR2...

Ngày tải lên: 18/06/2014, 22:20

12 307 0
Báo cáo sinh học: " Re-evaluating the role of natural killer cells in innate resistance to herpes simplex virus type 1" pot

Báo cáo sinh học: " Re-evaluating the role of natural killer cells in innate resistance to herpes simplex virus type 1" pot

... as the basis for concluding that NK cells play no role in innate resistance to HSV-1 Likewise, we question the validity of comparisons of HSV-1 infection in mice that exhibit "high" or "low" natural ... NK cells are dispensable for the innate resistance of mice to HSV-1 infection, further investigation is necessary to determine what role, if any, NK cel...

Ngày tải lên: 19/06/2014, 08:20

15 344 0
Báo cáo sinh học: " Detection, quantification and genotyping of Herpes Simplex Virus in cervicovaginal secretions by real-time PCR: a cross sectional survey" potx

Báo cáo sinh học: " Detection, quantification and genotyping of Herpes Simplex Virus in cervicovaginal secretions by real-time PCR: a cross sectional survey" potx

... common aetiological agent of GUD [5] Studies of HSV-2 seroprevalence have found high rates in African-Americans [6] and in African populations in Uganda, Zimbabwe, Tanzania, Central African Republic, ... probe are conducted in a single PCR and therefore the chances of possible contamination are minimised The main advantage of real-time detection is the large dynamic ra...

Ngày tải lên: 19/06/2014, 08:20

10 458 0
Báo cáo sinh học: " Functional inaccessibility of quiescent herpes simplex virus genomes" doc

Báo cáo sinh học: " Functional inaccessibility of quiescent herpes simplex virus genomes" doc

... recombination of the alphaherpesvirus bovine herpesvirus J Virol 2004, 78(8):3872-3879 Johnson RM, Spear PG: Herpes simplex virus glycoprotein D mediates interference with herpes simplex virus infection ... replication start sites of herpes simplex virus type-1 Virology 1996, 217:67-75 Everett RD, Sourvinos G, Leiper C, Clements JB, Orr A: Formation of nuclear foci of...

Ngày tải lên: 19/06/2014, 08:20

14 267 0
báo cáo hóa học: " Toll-like receptor 2 signaling is a mediator of apoptosis in herpes simplex virus-infected microglia" pdf

báo cáo hóa học: " Toll-like receptor 2 signaling is a mediator of apoptosis in herpes simplex virus-infected microglia" pdf

... used in the study: caspase-3: 5'gggcctgaaataccaagtca-3' and 5'-aaatgaccccttcatcacca-3'; Dsip1: 5'-ggtggccctagacaacaaga-3' and 5'-tcaagcagctcacgaatctg-3'; CIDE-B: 5' ctggaactcagctcctccac-3' and ... Bcl2-like 14 (apoptosis facilitator) BH3 interacting domain death agonist BCL2/adenovirus E1B-interacting protein Baculoviral IAP repeat-containing BCL2/adenovirus E1B-interacting protein Apopto...

Ngày tải lên: 19/06/2014, 22:20

7 507 0
báo cáo hóa học: " A role for DNA-dependent activator of interferon regulatory factor in the recognition of herpes simplex virus type 1 by glial cells" pot

báo cáo hóa học: " A role for DNA-dependent activator of interferon regulatory factor in the recognition of herpes simplex virus type 1 by glial cells" pot

... this article as: Furr et al.: A role for DNA-dependent activator of interferon regulatory factor in the recognition of herpes simplex virus type by glial cells Journal of Neuroinflammation 2 011 ... III-transcribed RNA intermediate Nat Immunol 2009, 10 :10 65 -10 72 55 Melchjorsen J, Rintahaka J, S by S, Horan KA, Poltajainen A, Østergaard L, Paludan...

Ngày tải lên: 19/06/2014, 22:20

12 529 0
Báo cáo hóa học: " The product of the Herpes simplex virus 1 UL7 gene interacts with a mitochondrial protein, adenine nucleotide translocator 2" pot

Báo cáo hóa học: " The product of the Herpes simplex virus 1 UL7 gene interacts with a mitochondrial protein, adenine nucleotide translocator 2" pot

... AGAAGTTCCTATTCTCTAGAAAGTATAGGAACTTCGACAGCAAGCGAACCGGAAT-3' GAAGTTCCTATACTTTCTAGAGAATAGGAACTTCCGGAAATGTTGAATACTCA TACTCTTCCTTTTTC-3' The linear PCR-generated fragments were electroporated into YEbac102, an E coli DH10B ... for UL8; and 18 S rRNA-f (5'-actcaacacgggaaacctca-3') and 18 S rRNA-r (5'-aaccagacaaatcgctccac-3') for 18 S rRNA Reactions were performed using SYBER Premix Ex Taq II (...

Ngày tải lên: 20/06/2014, 01:20

13 463 0
Báo cáo hóa học: " ICP0 antagonizes Stat 1-dependent repression of herpes simplex virus: implications for the regulation of viral latency" potx

Báo cáo hóa học: " ICP0 antagonizes Stat 1-dependent repression of herpes simplex virus: implications for the regulation of viral latency" potx

... the process by which host cells repress ICP0- viruses in vivo Therefore, it remains to be determined how ICP0 antagonizes Stat 1dependent repression of HSV-1 Implications for the regulation of ... Stat and lymphocytes are required for a latent HSV-1 infection to be established at the clinically relevant level of the host organism ICP0 antagonizes Stat 1...

Ngày tải lên: 20/06/2014, 01:20

23 413 0
Báo cáo khoa học: " Comparison of direct machine parameter optimization versus fluence optimization with sequential sequencing in IMRT of hypopharyngeal carcinoma" pptx

Báo cáo khoa học: " Comparison of direct machine parameter optimization versus fluence optimization with sequential sequencing in IMRT of hypopharyngeal carcinoma" pptx

... [20-29] The aim of this study is to compare the direct machine parameter optimization versus fluence optimization with subsequent leaf sequencing for IMRT of hypopharyngeal carcinoma with respect ... A, Rehbinder H, Löf J: Direct machine parameter optimization with RayMachine in Pinnacle RaySearch White Paper 2003 Ahunbay EE, Chen GP, Thatcher S, Jursin...

Ngày tải lên: 09/08/2014, 10:21

7 430 0
báo cáo khoa học: " Ultrasound-targeted microbubble destruction mediated herpes simplex virus-thymidine kinase gene treats hepatoma in mice" pps

báo cáo khoa học: " Ultrasound-targeted microbubble destruction mediated herpes simplex virus-thymidine kinase gene treats hepatoma in mice" pps

... Qi L, Chunjing Z, Hailin T, Lin G, Mingli P, Shiyu P: Ultrasoun -mediated microbubble destruction enhances VEGF gene delivery to the infarcted myocardium in rats Clin Imaging 2004, 28:395-398 13 ... electrogene transfer J Gene Med 2003, 5(3):219-31 26 Gentry BG, Boucher PD, Shewach DS: Hydroxyurea induces bystander cytotoxicity in cocultures of herpes simplex virus thymidine...

Ngày tải lên: 10/08/2014, 10:20

6 176 0
Báo cáo khoa học: " Herpes simplex virus type 1 and normal protein permeability in the lungs of critically ill patients: a case of low pathogenicity" docx

Báo cáo khoa học: " Herpes simplex virus type 1 and normal protein permeability in the lungs of critically ill patients: a case of low pathogenicity" docx

... 67Ga-transferrin from the intravascular to the extravascular spaces in the lungs, and it is therefore a measure of pulmonary capillary permeability to transferrin [19 ,20] The mean PLI from the two lungs ... pulmonary leak index can be measured as an index of capillary permeability and lung injury In patients with HSV -1 from tracheal aspirate or bronchoalveloa...

Ngày tải lên: 12/08/2014, 20:20

6 284 0
COMPARISON OF CYTOSINE DEAMINASE 5 FLUOROCYTOSINE VERSUS HERPES SIMPLEX VIRUS THYMIDINE KINASE GANCICLOVIR ENZYME PRODRUG SYSTEMS IN GLIOBLASTOMA GENE THERAPY

COMPARISON OF CYTOSINE DEAMINASE 5 FLUOROCYTOSINE VERSUS HERPES SIMPLEX VIRUS THYMIDINE KINASE GANCICLOVIR ENZYME PRODRUG SYSTEMS IN GLIOBLASTOMA GENE THERAPY

... Suicide Gene /Prodrug Systems Used in Gene Therapy .…… 1.3. 1Herpes Simplex Virus Type (HSV-1) Thymidine Kinase( HSVtk) /Ganciclovir( GCV)………………………… 10 1.3.2 Cytosine Deaminase( CD) / 5- Fluorocytosine (5- FC)… ... .58 Conclusion 68 III References .70 IV Summary Cytosine deaminase (CD) /5- fluorocytosine (5- FC) and herpes simplex virus thymidine kinase...

Ngày tải lên: 12/10/2015, 17:34

90 171 0
Từ khóa:
w