analysis of segregation in cross between wild soybean (glycine soja) and cultivated soybean (glycine max) based on morphology, agronomic traits and ssr marker

MINISTRY OF EDUCATION & TRAINING CAN THO UNIVERSITY BIOTECHNOLOGY RESEARCH & DEVELOPMENT INSTITUTE SUMMARY BACHELOR OF SCIENCE THESIS THE ADVANCED PROGRAM IN BIOTECHNOLOGY ANALYSIS OF SEGREGATION IN CROSS BETWEEN WILD SOYBEAN (Glycine soja) AND CULTIVATED SOYBEAN (Glycine max) BASED ON MORPHOLOGY, AGRONOMIC TRAITS AND SSR MARKER SUPERVISORS STUDENT Dr. TRUONG TRONG NGON NGUYEN QUANG DAT MSc. NGUYEN TRI YEN CHI Student code: 3082585 Session: 34 (2008-2013) Can Tho, 2013 MINISTRY OF EDUCATION & TRAINING CAN THO UNIVERSITY BIOTECHNOLOGY RESEARCH & DEVELOPMENT INSTITUTE SUMMARY BACHELOR OF SCIENCE THESIS THE ADVANCED PROGRAM IN BIOTECHNOLOGY ANALYSIS OF SEGREGATION IN CROSS BETWEEN WILD SOYBEAN (Glycine soja) AND CULTIVATED SOYBEAN (Glycine max) BASED ON MORPHOLOGY, AGRONOMIC TRAITS AND SSR MARKER SUPERVISORS STUDENT Dr. TRUONG TRONG NGON NGUYEN QUANG DAT MSc. NGUYEN TRI YEN CHI Student code: 3082585 Session: 34 (2008-2013) Can Tho, 2013 APPROVAL SUPERVISOR STUDENT Dr. TRUONG TRONG NGON Can Tho, June, NGUYEN QUANG DAT , 2013 PRESIDENT OF EXAMINATION COMMITTEE Abstract F2 population made by cross between wild soybean and cultivated soybean was analyzed for the segregation of phenotype and genotype based on morphological characters, agronomic characters and SSR marker. The cross was generated before between the female parent Xanh Ha Bac (Glycine max) and the male parent Soja 182 (Glycine soja). The results showed that the segregation of pod color fitted to (1:2:1) ratio. The hilum color segregated in (3:1) ratio. Four characters showed high heritability including days to flowering (R1), plant height at (R1), plant height at (R8), and number of nodes in main stem. The population was divided into three groups, they were determinate, indeterminate and semi-indeterminate. There was diversity among these groups for plant height and number of nodes in main stem. All of six SSR loci showed the segregation ratio of (1:2:1) in F2 population. No segregation distortion was recorded among these SSR loci. Key words: wild soybean, SSR marker, segregation. i Content Abstract ......................................................................................i Content ..................................................................................... ii 1. Introduction .........................................................................1 2. Materials and methods........................................................2 2.1. Materials.........................................................................2 2.2. Methods ..........................................................................2 2.2.1. Experiment design ....................................................2 2.2.2. Phenotypic characters score......................................2 2.2.3. Genotypic analysis....................................................3 2.2.3.1. DNA extraction......................................................3 2.2.3.2. PCR amplification..................................................3 2.2.3.3. Analysis of PCR products......................................5 2.2.4. Statistics analysis......................................................5 2.2.4.1. Analysis of morphological characters....................5 2.2.4.2. Analysis of agronomic characters..........................5 2.2.4.3. Heritability of characters........................................5 3. Results and discussion.........................................................6 3.1. Inheritance of morphological traits..............................6 3.1.1. Hypocotyl color, flower color, number of leaflets, and leaflet shape .......................................................6 3.1.2. Pod color ...................................................................8 3.1.3. Seed coat color..........................................................9 3.1.4. Hilum color .............................................................10 3.2. Stem types..................................................................10 3.3. Heritability of agronomic characters .........................10 3.4. Inheritance of growing characters..............................11 3.5. Genotypic inheritance ................................................14 ii 4. Conclusions and suggestions..............................................21 4.1. Conclusions ..................................................................21 4.2. Suggestions...................................................................21 References ..............................................................................22 iii 1. Introduction The soybean (Glycine max) is one of important crops around the world. This species of legume provides many products for many uses such as foods for human and breeding, materials in industries, improving soil. In Vietnam, soybean has been cultivating for thousands years. Because of the importance of soybean in country agricultural economy, the improvement of soybean varieties is a necessary requirement. Wild soybean, Glycine soja, has several useful traits such as pest resistance and drought tolerant. Conversely, cultivated soybean rarely contain these abilities. Therefore, transferring these traits of wild soybeans into cultivated soybeans will open possibility to make new varieties that meet the cultivation need. The introduction of wild soybean germplasm into cultivated soybean seems to be a promising method to create a new subject of soybean breeding. To serve breeding better, scientists need to know more clearly the segregation mode of F2 population. However, there are few complete researches on this area up to now. Objective: the aim of this study is to analyze the inheritance mode of the several agronomic characters and six loci SSR in the early segregating generation from the cross between wild soybean and cultivated soybean. 1 2. Materials and methods 2.1. Materials + Xanh Ha Bac cultivar (Glycine max, landrace) + Accession Soja 182 (Glycine soja, Korea origin) + F2 population of the cross between Xanh Ha Bac (as female parent) and Soja 182 (as male parent) + Chemicals and equipments for planting, DNA extraction, PCR, and electrophoresis. 2.2. Methods The experiments were carried out in the Molecular Biology Laboratory and the greenhouse of Biotechnology Research & Development Institute from September of 2012 to March of 2013. 2.2.1. Experiment design The experiments were designed following a completely randomized design with three replications. Each replication consisted of one plot of Xanh Ha Bac, one plot of Soja 182 and four plot of F2 generation. 2.2.2. Phenotypic characters score Morphological characters including hypocotyls color, leaflet number, leaflet shape, stem type, flower color, pod color, seed color, and hilum color were scored. Agronomic characters such as days to first flowering (R1), plant height at (R1), plant height at (R8), node number in main stem, pod number, branch number, etc. were also scored. Standard for scoring was based on Characterization Record Sheet of Asian Vegetable Research and Development Center. 2 2.2.3. Genotypic analysis 2.2.3.1. DNA extraction DNA was extracted from young leaves of parents, F1, and 13 F2 plants according to CTAB protocol (Rogers and Bendich, 1988). DNA quality were tested by electrophoresis on agarose 0,8% gel. Good DNA samples were used for PCR analysis. 2.2.3.2. PCR amplification PCR was conducted with six SSR primers (Table 1). Table 1. List of SSR primers Locus Satt 173 Satt 243 Satt 231 Satt 197 Satt 495 Satt 373 LG Core motif O (ATT)18 O (ATT)17 E (ATT)32 B1 (ATT)20 L (ATT)11 L (ATT)21 5’ to 3’ TGCGCCATTTATTCTTCA AAGCGAAATCACCTCCTCT GCGCATTGCACATTAGGTTTTCTGTT GCGGTAAGATCACGCCATTATTTAAGA GCGTGTGCAAAATGTTCATCATCT GGCACGAATCAACATCAAAACTTC CACTGCTTTTTCCCCTCTCT AAGATACCCCCAACATTATTTGTAA TGCCGCGAGATTAATATAATTTGT GTGCGGCAAGAAGTTGAAATAAAG TCCGCGAGATAAATTCGTAAAAT GGCCAGATACCCAAGTTGTACTTGT LG: linkage group Source: http://www.soybase.org/ 3 The components of each reaction and the PCR cycle was shown in Table 2 and Figure 1. Table 2. The reaction components of PCR Components Buffer (including MgCl2 10mM) dNTP Forward primer Revert primer Taq polymerase DNA BiH2O o 95 C 2’ A reaction volume (25 µl) Concentration 1X 2.5 µl 100 µM 1 pmol 1 pmol 2.5U/µl 50 – 100 ng/µl 0.25 µl 0.25 µl 0,25 µl 0.25 µl 1 µl 20 µl o 92 C o 1’ 68 C Ta 1’ o 72 C 5’ 1’ o 4C ∞ 35 cycles Figure 1. PCR program (Soybase; Wang et al., 2010) Annealing temperature (Ta) was specifically set for each primer (from 47oC to 60oC). 4 2.2.3.3. Analysis of PCR products 10µl of each PCR product was mixed with 4µl of loading buffer and subjected to electrophoresis on 3% agarose. Electrophoresis was conducted at 40V in the 23cm tank that contents TBE 1X. SSR bands were detected by Bio-Rad XRS. 2.2.4. Statistics analysis 2.2.4.1. Analysis of morphological characters Chi-square test was used to compute the fitness of segregation of morphological characters to the Mendel ratio (3:1 or 1:2:1). The characters including pod color, seed coat color, and hilum color. 2.2.4.2. Analysis of agronomic characters Frequency distribution of three characters (days to flowering (R1), plant height at (R1), and plan height at (R8)) was made. ANOVA were used to analyze parameters for almost characters. 2.2.4.3. Heritability of characters The heritability values in broad sense were estimated by the following formula: Genetic variance (VG) = VF2 – ½(VP1 + VP2) Heritability (h2) = VG / VF2 Where VF2 is phenotypic variance in F2 population, VP1 and VP2 are phenotypic variance in P1 (male parent) and P2 (female parent) populations, respectively. 5 3. Results and discussion 3.1. Inheritance of morphological traits 3.1.1. Hypocotyl color, flower color, number of leaflets, and leaflet shape There was no variation in hypocotyl color, flower color, number of leaflets and leaflet shape of F2 population. These results were due to no difference between male and female parents in above traits. The hypocotyl color and flower color of all populations were purple (Figure 2 and 3). Number of leaflets in all populations were three. The leaflet shape of all populations was ovate (Figure 4). Figure 2. Hypocotyl color of parents, F1, and F2 plants (January, 12th, 2013) 6 Figure 3. Flower color of parents, F1, and F2 plants (February, 10th, 2013) Figure 4. Leaflet shape of parents, F1, and F2 plants (February, 8th, 2013) 7 3.1.2. Pod color The character of pod color segregated in Mendel ratio (1:2:1). There were three types of pod color in F2 population, the tan color contributes 25.9%, brown contributes 51.3%, and black contributes 22.8% (Figure 6). F2 F2 F2 Figure 5. Pod colors of parents, F1, and F2 plants (April, 1st, 2013) 22.8% 25.9% black brow tan 51.3% Figure 6. Distribution of pod color in F2 population 8 3.1.3. Seed coat color The character of seed coat color did not segregate in Mendel ratio. F2 population generated three types of seed coat color, 61.3% of pale, 19.8% of black, and 18.9% of brown (Figure 8). F2 F2 F2 Figure 7. Seed coat colors of parents, F1, and F2 plants (April, 5th, 2013) 19.8% black brow 18.9% 61.3% pale Figure 8. Distribution of seed coat colors in F2 population 9 3.1.4. Hilum color There were two colors of hilum in F2 population, black and brown (Figure 9). The segregation of hilum color was fitted to 3:1 ratio. 25.3% black brown 74.7% Figure 9. Distribution of hilum color in F2 population There was no linkage between seed coat color and pod color. 3.2. Stem types Xanh Ha Bac is a determinate variety, while Soja 182 is a indeterminate variety. There were three stem types in F2 population. They were determinate, indeterminate and semideterminate (account for 16.67%). 3.3. Heritability of agronomic characters Days to first flowering, plant height at (R8), and number of nodes in main stem were three characters that gave high heritability (h2>70%) (Table 3). 10 The heritability of plant height at flowering (R1) and number of pods per plant were moderate (70%>h2>30%). Number of branches had low heritability (16%). Table 3. Total F2 variance, error variance and heritability in F2 population Characters Days to first flowering (R1) Plant height at flowering R1) Plant height at (R8) Node number in main stem Branch number Pod number per plant F2 (Xanh Ha Bac x Soja 182) σ2e h2 σ2F2 2.343 0.514 78.1 314.662 124.028 60.6 2620.832 7.832 2.662 1546.507 527.306 1.556 2.236 691.792 79.9 80.1 16.0 55.3 σ2F2 : phenotypic variance; σ2e : error variance, h2 : heritability 3.4. Inheritance of growing characters Days to first flowering showed a normal distribution (Figure 10). Days to fisrt flowering had high heritability (h2 = 78.1%, Table 3). However this trait also affected by environmental factors. 11 160 148 140 Number of trees 120 100 80 66 65 60 40 20 11 5 0 22-23 24-25 26-27 28-29 30-31 Days Figure 10. Distribution of days to flowering in F2 population Plant height at flowering (R1) gave a positive skewed distribution with one peak at 26.5 cm (Figure 11). 160 140 Num ber of plants 140 120 100 80 78 60 49 40 21 20 5 1 1 56.5 66.5 76.5 0 26.5 36.5 46.5 Plant height (cm) Figure 11. Distribution of plant height at flowering (R1) in F2 population 12 The distribution of plant height at flowering (R1) in F2 population spread twice more than the distribution in populations of parents. Analysis of variance showed that there was no significant difference between three groups of stem types for plant height at flowering (R1). Plant height at (R8) also gave a positive skewed distribution but with two peak at 38 cm and 76 cm (Figure 12). Analysis of variance showed that there was a significant difference at 1% between three groups of stem types for plant height at flowering (R1). 90 80 80 Number of plants 70 60 47 50 42 41 40 40 30 22 16 20 10 4 2 0 0 1 171 190 209 228 247 0 38 57 76 95 114 133 152 Plant height (cm) Figure 12. Distribution of plant height at (R8) in F2 population 13 3.5. Genotypic inheritance All of six loci had ability to separate two species of soybean (Xanh Ha Bac and Soja 182) on 3% agarose gel. Almost markers could successfully amplify DNA and generated clear bands, except Satt173 and Satt243. Bands sizes had slight difference to sizes that were known in William cultivar. 210bp 197bp Figure 13. Band type at locus Satt173 M: ladder P1: female parent Xanh Ha Bac P2: male parent Soja 182 F1: F1 of cross Xanh Ha Bac x Soja 182 1 – 13: F2 individuals of cross Xanh Ha Bac x Soja 182 Satt173 gave two band sizes, about 197bp for Soja 182 and about 210bp for Xanh Ha Bac. Bands sizes for Soja 182 was similar to the size that was known in William cultivar. Distance between two bands was 13bp. 14 210bp 190bp Figure 14. Band type at locus Satt197 M: ladder P1: female parent Xanh Ha Bac P2: male parent Soja 182 F1: F1 of cross Xanh Ha Bac x Soja 182 1 – 13: F2 individuals of cross Xanh Ha Bac x Soja 182 Satt197 gave two band sizes, about 210bp for Soja 182 and about 190bp for Xanh Ha Bac. Both sizes was slightly longer than the sizes that was known in William cultivar. Distance between two bands was 30bp. 15 210bp 237bp Figure 15. Band type at locus Satt231 M: ladder P1: female parent Xanh Ha Bac P2: male parent Soja 182 F1: F1 of cross Xanh Ha Bac x Soja 182 1 – 13: F2 individuals of cross Xanh Ha Bac x Soja 182 Satt231 gave two band sizes, about 237bp for Soja 182 and about 210bp for Xanh Ha Bac. Bands sizes for Soja 182 was similar to the size that was known in William cultivar. Distance between two bands was 27bp. 16 210bp 220bp Figure 16. Band type at locus Satt243 M: ladder P1: female parent Xanh Ha Bac P2: male parent Soja 182 F1: F1 of cross Xanh Ha Bac x Soja 182 1 – 13: F2 individuals of cross Xanh Ha Bac x Soja 182 Satt243 gave two band sizes, about 210bp for Soja 182 and about 220bp for Xanh Ha Bac. Both sizes was closely similar to the sizes that was known in William cultivar. Distance between two bands was 10bp. 17 255bp 245bp Figure 17. Band type at locus Satt495 M: ladder P1: female parent Xanh Ha Bac P2: male parent Soja 182 F1: F1 of cross Xanh Ha Bac x Soja 182 1 – 13: F2 individuals of cross Xanh Ha Bac x Soja 182 Satt495 gave two band sizes, about 245bp for Soja 182 and about 255bp for Xanh Ha Bac. Distance between two bands was 10bp. 18 290bp 254bp Figure 18. Band type at locus Satt373 M: ladder P1: female parent Xanh Ha Bac P2: male parent Soja 182 F1: F1 of cross Xanh Ha Bac x Soja 182 1 – 13: F2 individuals of cross Xanh Ha Bac x Soja 182 Satt373 gave two band sizes, about 254bp for Soja 182 and about 290bp for Xanh Ha Bac. Distance between two bands was 36bp. This marker could clearly separated bands. 19 All of six loci SSR segregated in Mendel ratio (1:2:1). There was no segregation of loci deviated from Mendel ratio (Table 4). The segregation of these SSR markers suggested that the segregation of QTLs associated with these marker would also fitted to Mendel ratio (Table 5). Table 4. Chi square test for segregation of six makers Marker LGs Satt197 Satt231 Satt373 Satt495 Satt173 Satt243 B1 E L L O O Genotype in F2 population A/A B/B H 4 3 6 3 4 6 3 1 9 4 3 6 2 2 9 1 2 10 χ2 0,23ns 0,23 ns 2,54 ns 0,23 ns 1,92 ns 3,92 ns Table 5. Agronomic traits associate with SSR loci Traits Locus SSR Satt231 Pl ht 20-1, Pl ht 24-5, Pl ht 24-6, Pl ht 26-7, Pl ht 26-8 Pl ht 13-3, Pl ht 26-10, Pl ht 26-10 Satt243 Pl ht 23-4 Satt373 Pl ht 9-2, Pl ht 26-10, Pl ht 26-10 Satt243 Lflt shape 7-16, Lflt shape 6-21 Satt373 Lflt shape 7-14, Lflt shape 6-19 Satt197 Node num 3-5, Node num 3-6 Satt173 Pod num 25-2 Satt197 Pod num 1-5 Satt231 Pod num 1-6 Satt373 Satt173 Satt197 Pod num 1-9 Sd wt 25-4 Sd wt 25-2 Satt197 Plant height Leaflet shape Node number Pod number Seed weight QTLs Source: http://www.soybase.org/ 20 4. Conclusions and suggestions 4.1. Conclusions Pod colors were tan, black, and brown. The segregation of pod color fitted to (1 : 2 : 1) ratio. The segregation of hilum color fitted to (3 : 1) ratio. Two hilum colors were black and brown. Four characters showed high heritability including days to flowering (R1), plant height at (R1), plant height at (R8), and number of nodes in main stem. All of six SSR markers were able to distinguish Xanh Ha Bac variety from Soja 182 accession. All of six loci SSR showed the segregation ratio of 1 : 2 : 1 in F2 population. 4.2. Suggestion Studying further on the F2 population as well as other crosses to make exact conclusion. 21 REFERENCES Rogers, S.O. and A. Bendich. 1988. Extraction of DNA from plant tissues. In Plant molecular biology manual Section A6. Kluwer Academic Publisher, Dordreht, A6:1-11. Wang, M., L. Run-zhi, Y. Wan-ming, and D. Wei-jun. 2010. Assessing the genetic diversity of cultivars and wild soybeans using SSR markers. African Journal of Biotechnology, 9(31):4857-4866. Website http://soybase.org/ (October,5th, 2012) 22 [...]... Conclusions and suggestions 4.1 Conclusions Pod colors were tan, black, and brown The segregation of pod color fitted to (1 : 2 : 1) ratio The segregation of hilum color fitted to (3 : 1) ratio Two hilum colors were black and brown Four characters showed high heritability including days to flowering (R1), plant height at (R1), plant height at (R8), and number of nodes in main stem All of six SSR markers... markers were able to distinguish Xanh Ha Bac variety from Soja 182 accession All of six loci SSR showed the segregation ratio of 1 : 2 : 1 in F2 population 4.2 Suggestion Studying further on the F2 population as well as other crosses to make exact conclusion 21 REFERENCES Rogers, S.O and A Bendich 1988 Extraction of DNA from plant tissues In Plant molecular biology manual Section A6 Kluwer Academic Publisher,... colors in F2 population 9 3.1.4 Hilum color There were two colors of hilum in F2 population, black and brown (Figure 9) The segregation of hilum color was fitted to 3:1 ratio 25.3% black brown 74.7% Figure 9 Distribution of hilum color in F2 population There was no linkage between seed coat color and pod color 3.2 Stem types Xanh Ha Bac is a determinate variety, while Soja 182 is a indeterminate variety... There were three stem types in F2 population They were determinate, indeterminate and semideterminate (account for 16.67%) 3.3 Heritability of agronomic characters Days to first flowering, plant height at (R8), and number of nodes in main stem were three characters that gave high heritability (h2>70%) (Table 3) 10 The heritability of plant height at flowering (R1) and number of pods per plant were moderate...2.2.3.3 Analysis of PCR products 10µl of each PCR product was mixed with 4µl of loading buffer and subjected to electrophoresis on 3% agarose Electrophoresis was conducted at 40V in the 23cm tank that contents TBE 1X SSR bands were detected by Bio-Rad XRS 2.2.4 Statistics analysis 2.2.4.1 Analysis of morphological characters Chi-square test was used to compute the fitness of segregation of morphological... phenotypic variance in F2 population, VP1 and VP2 are phenotypic variance in P1 (male parent) and P2 (female parent) populations, respectively 5 3 Results and discussion 3.1 Inheritance of morphological traits 3.1.1 Hypocotyl color, flower color, number of leaflets, and leaflet shape There was no variation in hypocotyl color, flower color, number of leaflets and leaflet shape of F2 population These results... flowering (R1) gave a positive skewed distribution with one peak at 26.5 cm (Figure 11) 160 140 Num ber of plants 140 120 100 80 78 60 49 40 21 20 5 1 1 56.5 66.5 76.5 0 26.5 36.5 46.5 Plant height (cm) Figure 11 Distribution of plant height at flowering (R1) in F2 population 12 The distribution of plant height at flowering (R1) in F2 population spread twice more than the distribution in populations of. .. ratio (1:2:1) There was no segregation of loci deviated from Mendel ratio (Table 4) The segregation of these SSR markers suggested that the segregation of QTLs associated with these marker would also fitted to Mendel ratio (Table 5) Table 4 Chi square test for segregation of six makers Marker LGs Satt197 Satt231 Satt373 Satt495 Satt173 Satt243 B1 E L L O O Genotype in F2 population A/A B/B H 4 3 6 3 4... were due to no difference between male and female parents in above traits The hypocotyl color and flower color of all populations were purple (Figure 2 and 3) Number of leaflets in all populations were three The leaflet shape of all populations was ovate (Figure 4) Figure 2 Hypocotyl color of parents, F1, and F2 plants (January, 12th, 2013) 6 Figure 3 Flower color of parents, F1, and F2 plants (February,... Distribution of pod color in F2 population 8 3.1.3 Seed coat color The character of seed coat color did not segregate in Mendel ratio F2 population generated three types of seed coat color, 61.3% of pale, 19.8% of black, and 18.9% of brown (Figure 8) F2 F2 F2 Figure 7 Seed coat colors of parents, F1, and F2 plants (April, 5th, 2013) 19.8% black brow 18.9% 61.3% pale Figure 8 Distribution of seed coat ... SEGREGATION IN CROSS BETWEEN WILD SOYBEAN (Glycine soja) AND CULTIVATED SOYBEAN (Glycine max) BASED ON MORPHOLOGY, AGRONOMIC TRAITS AND SSR MARKER SUPERVISORS STUDENT Dr TRUONG TRONG NGON NGUYEN... cross between wild soybean and cultivated soybean was analyzed for the segregation of phenotype and genotype based on morphological characters, agronomic characters and SSR marker The cross was... the segregation ratio of (1:2:1) in F2 population No segregation distortion was recorded among these SSR loci Key words: wild soybean, SSR marker, segregation i Content Abstract i Content