evaluation the combination between bacteria isolated from gastric juice of goat and cow rumen for sugarcane bagasse hydrolysys in vitro

MINISTRY OF EDUCATION & TRAINING CAN THO UNIVERSITY BIOTECHNOLOGY RESEARCH & DEVELOPMENT INSTITUTE SUMMARY BACHELOR OF SCIENCE THESIS THE ADVANCED PROGRAM IN BIOTECHNOLOGY EVALUATION THE COMBINATION BETWEEN BACTERIA ISOLATED FROM GASTRIC JUICE OF GOAT AND COW RUMEN FOR SUGARCANE BAGASSE HYDROLYSYS IN VITRO SUPERVISOR STUDENT MSc. VO VAN SONG TOAN TRAN HO DIEM DOAN Dr. HO QUANG DO Student code: 3082507 Ass.Prof. Dr. TRAN NHAN DUNG Session: 34 (2008- 2013) Can Tho, 2013 APPROVAL SUPERVISOR MSc. VO VAN SONG TOAN STUDENT TRAN HO DIEM DOAN Dr. HO QUANG DO Ass. Prof. Dr. TRAN NHAN DUNG Can Tho, May 2013 PRESIDENT OF EXAMINATION COMMITTEE i ABSTRACT Thesis " Evaluation The Combination Between Bacteria Isolated From Gastric Juice Of Goat And Cow Rumen For Sugarcane Bagasse Hydrolysys In Vitro” was done to increase the degradation of bagasse in in vitro conditions. Four bacteria strains of goat rumen, including DD9, DD5, DD7 and DD13, had been working together to investigate the cellulase activity. With halo zone diameter 27mm and degraded DM rate 11.13%, the combination between DD9 and DD7 was the most effective treatment that was selected to make post experiments. Sequencing results showed that the line DD9 similar to the max identity of 94% with Bacillus subtilis RC24 and the 92% max idetnity with Bacillus subtilis BA3_1A was the result of bacterial strain DD7. In vitro, the combination of three lines of bovine rumen bacteria (BM13, BM21 and BM49) and line DD9 in 1:3 ratios for the best output with DM digestibility was 21.27 %, cellulose and hemicelluloses were 8.17% and 10.22%, respectively. Keywords: Bacilus subtilis, hydrolysis, in vitro, rumen bacteria, sugarcane bagasse ii CONTENTS Page ABSTRACT ............................................................................. ii CONTENTS ............................................................................ iii 1. INTRODUCTION ................................................................ 1 2. MATERIALS AND METHODS.......................................... 3 2.1. Materials ........................................................................ 3 2.2. Methods ......................................................................... 4 2.2.1. Studying on the components of sugarcane bagasse… ...................................................................... 4 2.2.2. Screening of combination of 4 rumen bacteria strains isolated from gastric juice of goat ....................... 6 2.2.3. Identification of bacteria by PCR method ............. 7 2.2.4. Studying on a combination between ruminal bacteria isolated from gastric juice of goat and cow in vitro ............................................................................ 10 2.3. Experiment Design and Statistical Analysis .................. 12 3. RESULTS AND DISCUSSIONS ....................................... 13 3.1. Studying on the components of sugarcane bagasse ........ 13 3.2. Screening of combination of 4 rumen bacteria strains isolated from gastric juice of goat ........................................ 14 3.3. Identification of bacteria by PCR method ...................... 17 3.3.1. Strain DD9 ......................................................... 17 3.3.2. Strain DD7 ......................................................... 18 iii 3.4. Combination of ruminal bacteria isolated from goat and cow in vitro condition .......................................................... 20 3.4.1. Dry matter content ............................................. 20 3.4.2. Cellulose content................................................ 21 3.4.3. Hemicellulose content ........................................ 23 3.4.4. Lignin content .................................................... 25 4. CONCLUSIONS AND SUGGESTIONS ........................... 27 4.1. Conclusions .................................................................. 27 4.2. Suggestions .................................................................. 27 iv 1. INTRODUCTION The demands of animal protein in people diet lead to development of the animal husbandry. Based on industrial modernization, many households have invested large scale of infrastructure in rural areas. Feeds are mainly base on natural grasses and crop residues. The more the sufficient nutrients in each diet are supplied quantity and quality, the more the livestock productivity will increase. To improve production in each household, many various methods for improvement of feed utilization have been studied for several decades (Jackson, 1978). In recent years, there has been an increasing trend towards more efficient utilization of agro-industrial by products, such as sugarcane bagasse, as raw material for new industrial applications. Bagasse waste has been used in large quantities by the sugar and ethanol industries, mainly as fuel for sugar mills. However, the remained bagasse is still pollutant to the environment. Thus, a suitable mean for treatment of this residue is an important objective to be pursued. Using microorganisms for enzymatic treatment of sugarcane bagasse is one of prospective strategies. A large amount of cellulase enzyme can be produced by ruminal bacteria. In 2012, TH Truemilk factory applied successfully using some kind of by-products of agricultural to feed beefs. Breeding cows by sugarcane bagasse can be applied in some countries such as Japan and Korea. Goats are ruminants with cows but there have many more outstanding features than. Goats 1 have the ability to adapt to the harsh conditions of food and climate. One of the reasons for that is the activity of microorganisms in the rumen of goats (Ho Quang Do and Nguyen Thu Thuy, 2013). To help beef enhance nutrient absorption from food, the thesis was conducted to study the possibility of bagasse degradation of goat rumen bacteria combined with cow rumen bacteria in vitro conditions. Objectives: To select goat rumen bacterial strains that are capable to coordinate three ruminal bacteria isolates from gastric juice of cows in order to improve hydrolysis of bagasse in vitro conditions. 2 2. MATERIALS AND METHODS 2.1. Materials Equipments: water bath, incucell incubator (Germany), Velp Raw Fiber Extractor (Italia), Orion 420A pH meter (USA), Pbi-international autoclave (Germany), Rotary shaker GFL 3005 (Germany), Sequencer ABI 3130 (USA). Chemicals: Ethanol 95%, sulfuric acid H2SO4 98%, NaOH, acetone, sodium sulphite anhydrous (Na 2SO3), n-octanol (C8H18O), disodium ethylenediaminetetraacetate (EDTA, C10H14N2Na2O8), sodium lauryl sulfate neutral (C12H25NaO4S), cetryltrimethylammonium bromide technical grade (C19H42BrN), Tris-HCl (pH8), Isopropanol, Proteinase K … Sample Sugarcane bagasse: after collecting from Hau Giang Sugar Factory, sugarcane bagasse were desiccated at 70ºC in 30-45 minutes, then ground by Reetsch Miill with holes 0.2mm. Microorganism: Three bacteria including BM13, BM21 and BM49 were isolated from rumen of cow (Do Thi Cam Huong, 2012); and four ruminal bacteria species isolated from goat: DD9, DD5, DD7 and DD13 (Laboratory of Enzyme Technology). Ruminal fluid of cow: collected at the farm, located on Phu Thanh Town, Tra On District, Vinh Long Province. 3 2.2. Methods 2.2.1. Studying on the components of sugarcane bagasse Objective: to evaluate general of composition of sugarcane bagasse a) Dry matter content: Dried crucibles for weight balance at 70ºC. Tarred and recorded the weight of each crucible. Added 2g sample into each crucible. Put these crucibles with lids into preheated oven at 70ºC. Tarred and recorded the weight of each crucible. Calculated dry matter (DM) content: weight of residue – weight of crucible % DM = x 100 weight of sample (AOAC, 1993) b) Hemicellulose content (Neutral Detergent FiberNDF, and Acid Detergent Fiber-ADF) Acid Detergent Fiber-ADF Added 100ml of acid detergent solution with 0.5 grams of sample, and some drops of n-octanol. Heated and refluxed for 60 minutes. Filtered and washed 3 times with boiling water, then twice with acetone. Dried at 70ºC and weigh them. Calculated acid detergent fiber (ADF) 4 weight of residue % ADF = x 100 weight of sample (Van Soest and Robertson, 1979) Neutral Detergent Fiber- NDF Added 100ml of neutral detergent solution with 0.5grams of sample, 0.5 grams of sodium sulfite and some drops of n-octanol. Heated and refluxed for 60 minutes. Filtered and washed 3 times with boiling water, then twice with acetone. Dried at 70ºC and weigh them. Calculated neutral detergent fiber (NDF): weight of residue % NDF = x 100 weight of sample (Van Soest and Wine, 1967) Hemicellulose content % Hemicellulose = %NDF- %ADF (Van Soest and Robertson, 1979) c) Cellulose and Lignin content Acid Detergent Lignin-ADL Used the residue of acid detergent fiber determination. Added 25ml of 72% sulfuric acid at room temperature during 3 hours, stirring every hour. 5 Filtered and washed 3 times with boiling water Dried at 70ºC and weigh them. Calculated acid detergent lignin: weight of residue % ADF = x 100 weight of sample (Van Soest and Robertson, 1979) Cellulose content % Cellulose = %ADF - %ADL (Van Soest and Robertson, 1979) 2.2.2. Screening of combination of 4 goat rumen bacteria strains Objective: evaluate the sugarcane bagasse degradation ability of mixing of 4 goat rumen bacteria Procedure: a) Studying the sugarcane bagasse degradation productivity - Injection of 5% (w/w) bacteria suspension with 7 10 CFU/ml concentration based on experiment setting. - Bacteria were incubated in 3 days at 38ºC. - Dried the bagasse and weigh the mass. - Formula to definite the degradation output 6 Degradation output (%) = % DMmaterial - %DMtreatment b) Studying the creating of halo zones in M1 medium - 15µl bacteria solution of each treatment was spotted in the well with 5mm diameter on M1 medium. - The plates were incubated at 38ºC for 24 hours. - Cellulase activity was detected by staining the plates with Congo Red dye (0.1g/l) for 30 minutes, then washing with NaCl 1M solution (Teather và Wood, 1981; Wood và Bhat, 1988). - Measure the halo zone diameter (mm). 2.2.3. Identification of bacteria by PCR method Objective: To indentify of DNA sequences of bacterial strains isolated from the rumen of goat. Procedure: A protocol for extracting genomic DNA from bacterial cells was based on the CTAB method from Maniatis et al. (1989). This protocol was followed: - Bacteria were bred in 6ml LB medium for 16 hours. - Transferred 2ml to a 2.2ml centrifuge tube and centrifuged tubes at 13,000rpm for 10 minutes. - Decanted the supernatant in the tube. - Resuspended the pellet in 250μl TE 1X buffer by repeated pipetting. 7 - Added 250μl of 1X TE buffer, 50 μl of 10% SDS and 5μl of ProteinaseK, mixed well (but gentle), and incubated 20 minutes in a water bath at 65°C. - Added 400μl of 10% CTAB, gently mix, and incubated at 65oC for 20 minutes. - Added 600μl Chloroform:Isoamyl alcohol (24:1), mixed well (but gentle), and centrifuged 13.000rpm for 10 minutes. Transferred the upper aqueous phase to new tube (avoid interface). - Added 600μl of isopropanol, mixed well (but gentle), and freezed cell suspension at -20ºC for 2 hours. - Washed DNA by 50μl of ethanol, centrifuged at 13,000rpm for 10 minutes. - Discarded the supernatant and dried the pellet either at 45ºC by a vacuum drier. Dissolved DNA in 100μl 0.1X TE buffer. Stored at -20ºC for further use. PCR reaction - The primer sequences: 8F 3’-AGAGTTTGATCCTGGCTCAG-5’ 1492R 5’-GGTACCTTGTTACGACTT-3’ (Dojka et al., 1998) The bacterial DNA was amplified by primers 8F and 1492R in the PCR reaction. The chemical composition and cycle of the PCR reaction follow to Table 1 and Figure 1. 8 Table 1. The chemical components in the PCR reaction Component Amount Bi-H2O 12.5µl Buffer 10X 2.5µl MgCl2 2µl dNTPs 4µl Primer 1 1µl Primer 2 1µl Taq polymerase 0.25µl DNA template 25µl (*Source: Maniatis et al., 1989) Figure 1. The cycle of PCR reaction (*Source: Maniatis et al., 1989) DNA sequencing - The PCR product was sequenced by the ABI3130 genetic analyzer, an automated DNA sequencing. The sequence was identified by using the BLASTN program and comparing 9 the gene sequences of other bacterial strains on GenBank, in order to show the level of similarity matrix of strains. Screening the morphology of bacteria - The bacterial colonies were ensuring by the growing pattern of bacteria on the plate and under microscopic observation. - Gram staining was tested following Cao Ngoc Điep and Nguyen Huu Hiep (2008). 2.2.4. Studying on combination ability of ruminal bacteria isolated from goat and cow in vitro Objective: To evaluate generally cellulose degradability of combination of ruminal bacteria isolated from goat and cow in in vitro. Procedure: - Preparation of ruminal fluid (cow): ruminal fluid was collected through a permanent fistula of cow before the breakfast. The cows were fed with 100% para grass (Brachiaria mutica) before 1 month. The fluid was strained through four layers of muslin cloth. The carbon dioxide was dissolved in a solution. The solution was kept in an incubator at 38oC. - Preparing buffer: added component of buffer solution (Table 5) into round flat-bottomed flask. The carbon dioxide gently bubbled into the solution until the liquid turn from opaque to almost transparent. After 15minutes of warming in an incubator 38oC, the ruminal fluid and buffer solution were mixing. 10 Table 2.The compositions of buffer in vitro Components Amount NaHCO3 9.80g KCl 0.57g CaCl2 0.04g Na2HPO4.12H2O 9.30g NaCl 0.47g MgSO4.7H2O 0.12g Cystein 0.25g (*Source: Tilley and Terry, 1963) - All experiments were arranged completely random with 1 negative control, 1 positive control and 7 treatments. With an in vitro experiment (Menke and Steingass, 1988), the components of each treatment were followed: 11 Table 3. Components of treatments Component (ml) DC- DC+ NT1 NT2 NT3 NT4 NT5 NT6 NT7 Ruminal Fluid 40 0 40 40 40 40 40 40 40 Suspension Cow bacteria fluid (v/v) 0 12 12 6 6 6 3 3 3 Suspension of DD9 (v/v) 0 0 0 6 0 3 9 0 4,5 Suspension of DD7 (v/v) 0 0 0 0 6 3 0 9 4,5 Buffer 160 186 148 148 148 148 148 148 148 - Poured buffer solution and ruminal fluid into dark bottle, then added sugarcane bagasse and bacteria. Subsequently, clays were used to seal lip and mouth bottles which were put in incubator at 38oC. After incubating 3 days, the samples (sugarcane bagasse) were collected and tested their components. Determination: content of the ingredients of the samples in experiments: DM, cellulose and hemicelluloses. 2.3. Experiment Design and Statistical Analysis Raw data were analysed by Microsoft Excel 2007 and Statgraphic XV Software. DNA sequencing was supported by BLASTN software. All experiments were performed in triplicates. 12 3. RESULTS AND DISCUSSIONS 3.1. Studying on the components of sugarcane bagasse According to the Table 4, dry matter of bagasse was 98.41% after drying. The result was similar to both the dry matter given in the research of Shakweer (2003) with 94.57% and the value of studying on bagasse of Do Thi Cam Huong (2012) with 93.69%. The cellulose content achieved 50.61%. This result was likely to the result of Lu Vu Thao Vi (2012) with 56.32% cellulose. However, the result was different with the research of Hamissa et al. (1985) with 48,1%. Sallam et al. (2007) had the result of cellulose content about 36.5%. Hemicelluloses content was calculated from NDF and ADF value. With Van Soest method, hemicellulose content contained 29.81% in bagasse. According to researches of Lee and Koo. (2003) and Akinfemi (2012), the hemicellulose contents were 24% and 15.98%, respectively. 0.5grams of sugarcane bagasse were analysed by acid detergent solution. Lignin content was 14.63%. The results of Feng Peng et al. (2009) with 20-30% of lignin percent in sugarcane. According to Ilindra and Dhake (2008) with 21.1% lignin content, it was different with this lignin content of the bagasse. 13 Table 4. The components of sugarcane bagasse % DM % % % (m/m) Cellulose Hemicelluloses Lignin (m/m) (m/m) (m/m) 50.61 29.86 14.63 98.41 Due to analysis of fiber components in bagasse and comparison with other materials, the result was determined high cellulose and hemicelluloses, low lignin. Therefore, sugarcane bagasse was an appropriate material to culture bacteria synthesized cellulose and by-products in breeding. 3.2. Screening of combination of 4 goat rumen bacteria strains Objective: To evaluate generally cellulase activities of bacteria combination. The linear equation between optimal density at 600nm length wave and bacterial concentration of 4 goat rumen bacteria. Strain DD9: y = 0,823x + 5,505 R2 = 0,987 Strain DD5: y = 1,008x + 5,247 R2 = 0,987 Strain DD7: y = 3,362x + 4,714 R2 = 0,996 Strain DD13: y = 0,238x + 6,374 R2 = 0,995 Due to above equations, bacteria were isolated at 7 10 CFU/ml content. a) The results of sugarcane bagasse degradation of 15 treatments by halo diameter method were shown in Figure 2. 14 Treatments 1, 2, 3 and 4, contained only one bacteria strain, had smaller diameter than in combination of ruminal bacteria. Treament 6 was the most efficient treatment of cellulase activities with 27mm of diameter value, had a statistically significant difference of 5 % value with the others, except treatment 10 and treatment 15. According to Li-Jung et al. (2010), exoglucanase activity was determined by incubation of bacterial solution in cellulose material. Therefore, NT6 being contented strain DD9 and DD7 had strong exoglucanase activity. 15 Figure 2. Halo diameter values of combination treatments *NT1: 1; NT2: 2; NT3: 3; NT4: 4; NT5: 1 + 2; NT6: 1 + 3; NT7: 1 + 4; NT8: 2 + 3; NT9: 2 + 4; NT10: 3 + 4; NT11: 1 + 2 + 3; NT12: 1 + 2 + 4; NT13: 1 + 3 + 4; NT14: 2 + 3 + 4; NT15: 1 + 2 + 3 + 4. *1: DD9, 2: DD5, 3: DD7 and 4: DD13 *Values are the average of three replicates, and means within columns with different superscript letters are statistically significant difference at a 5% level, and vice versa, %CV = 12.03% b) Results on the dry matter content of bagasse were shown in Figure 3. It showed that treatment 6 (NT6) had high digestibility of sugarcane bagasse. As a result, DD9 and DD7 strains were identified by PCR method and DNA Sequencing of 16S rRNA gene. 16 Figure 3: Dry matter content of bagasse *NT1: 1; NT2: 2; NT3: 3; NT4: 4; NT5: 1 + 2; NT6: 1 + 3; NT7: 1 + 4; NT8: 2 + 3; NT9: 2 + 4; NT10: 3 + 4; NT11: 1 + 2 + 3; NT12: 1 + 2 + 4; NT13: 1 + 3 + 4; NT14: 2 + 3 + 4; NT15: 1 + 2 + 3 + 4. *1: DD9, 2: DD5, 3: DD7 và 4: DD13 *Values are the average of three replicates, and means within columns with different superscript letters are statistically significant difference at a 5% level, and vice versa, %CV = 9.08% 3.3. Identification of bacteria by PCR method 3.3.1. Strain DD9 Molecular analysis based on 16S rRNA gene sequencing reveals that strain DD9 was maximum identity of 94% with FJ263368.1 Bacillus subtilis strain RC24. DNA sequencing of DD9 5’GCTTGAAAGGGGACGAAAAAGGCGGAGGGG TGTGTGGGCGTGGGTAACCTGCCTGTAAGAGAGGAAA AAGGAGCGGGAAACCGGGGCTAATACCGGATGGTTGT TTGAACCGCATGGTTCAAACAAAACGGCGGCTTAGGC 17 TACCACTTACAGATGGACCCGCGGCGCATTAGCTAGTT GGTGAGGTAACGGCTCACCAAGGCAACGATGCGTAGC CGACCTGAGAGGGTGATCGGCCACACTGGGACTGAGA CACGGCCCAAACTCCTACGGGAGGCAGCAGTAGGGAA TCTTCCGCAATGGACGAAAGTCTGACGGAGCAACGCC GCGGGGAGTGATGTTGGTTTTCGGATCGTAAAGCTCTG TTGTTAGGGAAGAACAAGTACCGTTCAAATAGGGCGG TATCTTGAAGGTACCTAACCAAAAAAGCCACGGCTAA CTACGTGCCAACAGCCGGGGGTAATACGTA3’ Figure 4. The result of 16S rRNA sequencing strain DD9 According to Nakano and Zuber (1998), Bacillus subtilis had rod-shape and Gram positive. Bacillus subtilis were isolated from rumen of cows (Microbial, 1999). They can produce cellulase enzyme at 40ºC with highest amount. In the morphology, DD9 is a Gram-positive bacteria, rod-shape, irregular, raised, erode and milky white colony. The result was similar to research of Perez et al. (2000). 3.3.2. Strain DD7 Searching on BLAST of NCBI showed that strain DD7 was found to be closely related to Bacillus subtilis strain BA3_1A with high homology (92%). 18 DNA sequencing of DD7 5’ACCATGAAAAGGGGAAACAAAGGGGGGGAG GGGTGGGTGAGCGTGGGTAACCTGCCTGTAAGAGGGA AGGGGGGCGGGAAACCGGGGCTAATACCGGATGGTTG TTTGAACCGCATGGTTCAATTATTAACGGCGGATTAAG CTACCACTTACAGATGGACCCGCGGCGCATTAGCTATT TGGTGAGGTAACGGCTCACCAAGGCAACGATGCGTAG CCGACCTGAGAGGGTGATCGGCCACACTGGGACTGAG ACACGGCCCAAACTCCTACGGGAGGCAGCAGTAGGGA ATCTTCCGCAATGGACGAAAGTCTGACGGAGCAACGC CGCGTGAGTGATTTATGTTTTTCGGATCGTAAAGCTCT GTTGTTAGGGAAGAACAAGTACCGTTCAAATAGGGCG GTATCTTGACGGTACCTAACCAGAAAGCCACGGCTAA CTACGTGCCAACAGCCGGGGTAATACGTAAGTGGCAA TCGTTGTCCGGAAATATTGCGCGAAAAGGGCTCGCAC GCGGATTCTTAATTCTGAATGTGAAAAGC3’ Figure 5. The result of 16S rRNA sequencing strain DD7 Strain DD7 is rod-shape bacteria, Gram positive. It was the same with bacterial strain DD9. However, colony of DD7 was punctual, milky white and convex. 19 3.4. Combination of ruminal bacteria isolated from goat and cow in vitro condition 3.4.1. Dry matter content Result on the dry matter content of bagasse by in vitro condition was shown in Figure 6. It showed that treatment 5 (NT5) had highest digestibility of sugarcane bagasse with digestibility percentage (21.27%). The result was lower than the research of Đo Thi Cam Huong (2012) with 27.23% DM content. In the negative control, dry matter contents were highly with digestibility percentage 18.02%. It can be explanted that the activity of microbes in cow rumen solution. The positive control result, no rumen solution, was a little bit lower than ĐCresult. The result of NT1 was increasing at 18.40%. All six treatments from 2 to 7, added the bacteria from the rumen of goat, got results better than 2 controls treatment. In brief, the addition the goat bacteria had the productivity in degrading sugarcane bagasse. The strain DD9 can cooperate with BM13, BM43 and BM49 for increasing the bagasse degradation. 20 Figure 6. Dry matter hydrolysis of treatments after incubated in vitro condition *NT1: cow bacteria fluid (6%); NT2: cow bacteria fluid ( (3%) + 1 (3%); NT3: cow bacteria fluid (3%) + 2 (3%); NT4: cow bacteria fluid (3%) + 1 (1,5%) + 2 (1,5%); NT5: cow bacteria fluid (1,5%) + 1 (4,5%); NT6: cow bacteria fluid (1,5%) + 2 (4,5%); NT7: cow bacteria fluid (1,5%) + 1 (2,75%) + 2 (2,75%); DC-: ruminal fluid; DC+: cow bacteria fluid *1: DD9; 2: DD7 *Values are the average of three replicates, and means within columns with different superscript letters are statistically significant difference at a 5% level, and vice versa, %CV = 5,70% 3.4.2. Cellulose content The cellulose content was a considerable indicator assessment of fiber degradation by cellulolytic ruminal bacteria (Juliano, 1985). The results of cellulose content of sugarcane bagasse, following in vitro method were shown in Figure 7, strain DD9 coordinated with the mixture of three ruminal isolates of cow, following ratio (3:1) was an efficient treatment 21 of cellulose hydrolysis with digestibility value 8.17%. For negative and positive control samples, the cellulose content was degraded in sugarcane bagasses with value (5.33% and 5.83, respectively). Meaningly, the addition of bacteria isolated from the rumen of goat and cow needed to increase nutrient absorption of livestock. Figure 7. Cellulose hydrolysis of treatments after incubated in vitro condition *NT1: cow bacteria fluid (6%); NT2: cow bacteria fluid ( (3%) + 1 (3%); NT3: cow bacteria fluid (3%) + 2 (3%); NT4: cow bacteria fluid (3%) + 1 (1,5%) + 2 (1,5%); NT5: cow bacteria fluid (1,5%) + 1 (4,5%); NT6: cow bacteria fluid (1,5%) + 2 (4,5%); NT7: cow bacteria fluid (1,5%) + 1 (2,75%) + 2 (2,75%); DC-: ruminal fluid; DC+: cow bacteria fluid *1: DD9; 2: DD7 *Values are the average of three replicates, and means within columns with different superscript letters are statistically significant difference at a 5% level, and vice versa %CV = 8.28% 22 3.4.3. Hemicelluloses content These findings of the effect of bacteria on chemical composition and in vitro ruminal digestibility (Figure 8) showed the treatment 5 had the highest rate of hemicellulose digestion (10.22%). Other treatments had the degraded hemicelluloses content values from 8.50% – 9.50%, except NT4 (7.88%). The result of NT5 was very different with the research of Vo Thi My Nhien (2012) about the ability of bagasse degradation of combination of buffalo and cow rumen bacteria in in vitro (0.28%). 23 Figure 8. Hemicelluloses hydrolysis of treatments after incubated in vitro condition *NT1: cow bacteria fluid (6%); NT2: cow bacteria fluid ( (3%) + 1 (3%); NT3: cow bacteria fluid (3%) + 2 (3%); NT4: cow bacteria fluid (3%) + 1 (1,5%) + 2 (1,5%); NT5: cow bacteria fluid (1,5%) + 1 (4,5%); NT6: cow bacteria fluid (1,5%) + 2 (4,5%); NT7: cow bacteria fluid (1,5%) + 1 (2,75%) + 2 (2,75%); DC-: ruminal fluid; DC+: cow bacteria fluid *1: DD9; 2: DD7 *Values are the average of three replicates, and means within columns with different superscript letters are statistically significant difference at a 5% level, and vice versa %CV = 10.63% The results of degraded dry matter, cellulose and hemicelluloses contents were shown that treatment 5 (NT5) to be an high value of degraded hemicelluloses content. DD9 had positive ability to coordinate with cow rumen bacteria groups (BM13, BM21 and BM49). 24 3.4.4. Lignin content Figure 9. Degraded lignin content of treatment after incubated in in vitro *NT1: cow bacteria fluid (6%); NT2: cow bacteria fluid ( (3%) + 1 (3%); NT3: cow bacteria fluid (3%) + 2 (3%); NT4: cow bacteria fluid (3%) + 1 (1,5%) + 2 (1,5%); NT5: cow bacteria fluid (1,5%) + 1 (4,5%); NT6: cow bacteria fluid (1,5%) + 2 (4,5%); NT7: cow bacteria fluid (1,5%) + 1 (2,75%) + 2 (2,75%); DC-: ruminal fluid; DC+: cow bacteria fluid *1: DD9; 2: DD7 *Values are the average of three replicates, and means within columns with different superscript letters are statistically significant difference at a 5% level, and vice versa, %CV = 13.79% Lignin was particularly difficult component to biodegrade in plant cells. Lignin content of treatment 1 was the lowest value. With 2.66% of percentage of content loss, NT2 had a statistically significant difference of 5% value with the others (Figure 9). It was similar to the result of Vo Thi My 25 Nhien (2012) with 2.53% degraded lignin content as combination buffalo and cow rumen bacteria in in vitro. In a study of in vitro method to improve digestibility of cattle, it showed that the influence of hydrolytic enzyme activities of lignin could be the strain of bacteria, fungi or other chemical and physical impacts (Zadrazil, 1985). Lignin degradation was an oxidative process that was necessary to provide appropriate oxygen. Therefore, supply of sufficient oxygen and suitable temperature (up to 32oC) also played an important role in improving bagasse digestibility in tropics and subtropics (Stamets, 2000). 26 4. CONCLUSIONS AND SUGGESTIONS 4.1. Conclusions Among 4 strains of isolated goat rumen bacteria, the treatment with two strains DD9 and DD7 got the most effective sugarcane bagasse combination degradation. The identification results of the strain DD9 sequences exceed 94% of 16S rRNA gene sequence similarity with Bacillus subtilis strain RC24, and the strain DD7 showed 92% of similarity score with Bacillus subtilis strain BA3_1A. In vitro experiments, treatment 5 (3ml the mixture of three strains (BM13, BM21, and BM49) + 9ml DD9) recorded the highest digestibility coefficients of sugarcane bagasse. 4.2. Suggestions - Improvement of incubation equipment can do on a large scale in vitro than necessary conditions. - Purification and research components as well as activity of the cellulase enzyme system strong strains were identified. 27 REFERENCES Vietnamese Cao Ngọc Điệp và Nguyễn Hữu Hiệp. 2008. Giáo trình thực tập môn vi sinh vật đajị cương. Viện Nghiên cứu và Phát triển Công nghệ Sinh học. Đại học Cần Thơ, trang 28-29. Đỗ Thị Cẩm Hường. 2012. Phân lập tuyển chọn và định danh vi khuẩn dạ cỏ bò để phân giải bã mía trong điều kiện in vitro. Luận văn tốt nghiệp thạc sĩ Công nghệ Sinh học. Đại học Cần Thơ. Hồ Quảng Đồ và Nguyễn Thị Thủy. 2013. Giáo trình chăn nuôi dê. Nxb. Đại học Cần Thơ, trang 24- 31. Lư Vũ Thảo Vi. 2012. Tuyển chọn vi khuẩn dạ cỏ cừu phối hợp với nhóm vi khuẩn dạ cỏ bò để phân giải bã mía trong điều kiện in vitro. Luận văn tốt nghiệp cử nhân Công nghệ sinh học. Viện NC & PT Công nghệ sinh học, trường Đại học Cần Thơ. Nguyễn Thanh Thủy. 2007. Nuôi cấy Bacillus subtilis thu nhận α-amylase và ứng dụng trong sản xuất dextrin. Luận văn tốt nghiệp cử nhân chuyên ngành Công nghệ sinh học. Đại học Nông Lâm thành phố Hồ Chí Minh. Trần Cừ. 1979. Sinh lý và hóa sinh tiêu hóa của gia súc nhai lại. Nxb. Khoa học và Kỹ thuật Hà Nội, trang 35-120. Võ Thị Mỹ Nhiên. 2012. Tuyển chọn vi khuẩn dạ cỏ trâu phối hợp với nhóm vi khuẩn dạ cỏ bò để phân giải bã mía trong điều kiện in vitro. Luận văn tốt nghiệp cử nhân 28 Công nghệ sinh học. Viện NC & PT Công nghệ sinh học, trường Đại học Cần Thơ. Võ Văn Phước Huệ, Cao Ngọc Điệp. 2011. Phân lập và nhận diện vi khẩn phân giải cellulose. Tạp chí khoa học, trường Đại học Cần Thơ, 18a:177-184. English Akinfemi, A. 2012. Upgrading of sugarcane bagasse by solid state fermentation with Pleurotus sajor-caju and Pleurotus florida and the impact on the chemical composition and in vitro digestibility. Biotechnology in Animal Husbandry. Institute for Animal Husbandry, Belgrade-Zemun, 28: 603-611. AOAC. 1993. Methods of analysis for nutrition labeling. Arlindton, USA. Carl, E.P. 1999. Principles of Rumen Digetion in the Model. Feed and Nutrition Management Cow College. Jan 6-7. Dojka, M.A., P. Hugenholtz, S.K. Haack and N.R. Pace. 1998. Microbial diversity in a hydrocarbon- and chlorinatedsolventcontaminated aquifer undergoing intrinsic bioremediation. Appl Environ Microbiol 64:3869-3877. Feng Peng, Jun-Li Peng, Feng Xu, Jing Bian, Pai Peng And Run-Cang Sun. Hemicelluloses Precipitation 2009. Obtained from Comparative Study of by Graded Ethanol Sugarcane Bagasse. Journal Agricutural Food Chemistry, 57:6305-6317. 29 Hamissa, F.A., M.M. Shoukry, M. Sawsan, A.H. Ahmed, H.M. EL-Refai, H.M. Ali and Z.M. Abd El-Motgally. 1985. Nutritive improvements of some low quality roughages for ruminants 11. The effect of spraying urea vs. microbial treatment on the quality of sugarcane bagasse. Egyptian Journal of Animal production, 25(2):343-353. Ilindra, A. and J.D. Dhake. 2008. Microcrystalline cellulose from bagasse and rice straw. Indian Juornal of Chemical Technology, 15:497-499. Jackson, M.G. 1978. Review article: The alkali treatment of straw. Anim. Feed Sci. Tech, 2:105-130. Lee, S.M and Y.M. Koo. 2001. Pilot-scale production of cellulose using Trichodermareesei Rut C-30 in fed-batch mode, J.Microbiol. Biotechnol, 11:229-233. Li-Jung, Y., L. Hsin-Hung and X. Zheng-Rong. 2010. Purification and characterization of a cellulase from Bacillus subtilis YJ1. Journal of Marine Science and Technology, 18(3):466-471. López, S., J. Dijkstra and J. France. 2000. Prediction on energy supply in ruminant, it emphasis on forage. Forage Evaluation in Ruminant Nutritive, eds. D.I. Givens, E., Owen, R.F.E. Axford and H.M. Omed. CAB International, UK, pp.63-94. Maniatis, T., J. Sambook and E.F. Eritsek. 1989. Molecular laboratory manuel. Second edition. Spring habbor laboratory press, USA, 1:6-7. 30 Menke, K.H. and H. Steingass. 1988. In vitro gas production technique. Estimation of the energetic feed value obtained from chemical analysis and in vitro gas production using rumen fluid. Animal Research and Development, 28:97-143. Microbial, O. C. 1999. Formation of organic acids by strain of Bacillus mesentericus and Bacillus subtilis isolated from the rumen of cattle. Mikrobiol, 39:31-33. Mohamed, S. A. S., A. M. Y. Magdi., F. H. Francis and A. N. E. Moustafa. 2010. Production of cellulase on Low-Cosr Medium by Bacillus subtilis KO Strain. World Applied Sciences Jounal 8(1): 35-42. Nakano, M. M. and Zuber, P. 1998. Anaerobic growth of a “strict aerobe” Bacillus subtilis. Annu. Rev. Microbiol. 52:165-190. Perez, A.R., A. Abanes-De Mello, K. Pogliano. SpoIIB Localizes to Active Sites of Septal Biogenesis and Spatially Regulates Septal Thinning during Engulfment in Bacillus subtilis. Journal of Bacteriology. 2000 February, 182(4):1096-1108 Phillipson, A.T. 1977. Ruminant digestion. In Dukes Physiology of Domestic Animal, ed. M.J. Swenso. Cornell University Press, pp.250-286. Preston, T.R. and R.A. Leng. 1991. Agricultural technology transfer, perspectives and case studies. In Agricultural Technology: Current Policy Issues for the International 31 Community and the World Bank, Eds.. J. Anderson, pp.156-184. Ray, A.K., A. Bairagi, G.K. Sarkar and S.K. Sen. 2007. Optimization of fermentation conditions for cellulase production by Bacillus subtilis CY5 and Bacillus circulans TP3 isolated from fish gut. Acta Ichthyol. Piscat. 37(1):25-34. Reed, J.D. and Van Soest P.J. 1985. Estimating the nutritive value of crop residues and agro-industrial byproducts by chemical methods. In Better utilisation of crop residues and byproducts In animal feeding: Research guidelines. 1. State of knowledge, eds. T.R. Preston, V.L. Kossila, J. Goodwin and S.B. Reed. FAO Animal Production and Health, Food and Agriculture Organization of the United Nations, Rome, Italy, 50:117–128. Sallam, S.M.A., M.E.A. Naser, A.M. El-Waziry, I.C.S Bueno and A.L. Abdalla. 2007. Use of an in vitro rumen gas production technique to evaluate some ruminant feedstuffs. Journal of Applied Sciences Research, 3(1):34-41. Shakweer, I.M.E. 2003. Effect of biological treatments of rice straw and sugarcane bagasse on their digestibility, nutritive value, ruminal activity and some blood parameters in rams. Egyptian Journal Nutrition and Feeds, 6:925-940. Stamets, P. 2000. Growing Gourmet and Medicinal Mushrooms, 3rd edn. Ten Speed Press, Berkeley, CA. 32 Teather, R. and P.T. Wood. 1981. Using the Congo RedPolysaccharide interaction in enumeration and characterization of cellulolytic bacteria from Bovine rumen. Appl Environ Microbiol, 777-780. Tilley, J.M.A. and R.A. Terry. 1963. A two stage technique for in vitro digestion of farage crops. J. Brit. Grassk. S, 18:104-111. Van Kessel, J.S. and J.B. Rusell. 1997. The Endogenous Metabolic Rate of Mixed Ruminal Bacterial and the Effect of Enery Starvation on Ruminant Fermentation Rates. Van Soest P.J., and J.B. Robertson. 1979. Systems of analysis evaluating fibrous feeds. Comell University. Ithaca. N.Y, pp.233-251. Van Soest P.J. and R.H. Wine. 1967. Use of detergents in the analysis of fibrous feeds. IV. Determination of plant cell wall constituents. J. Assoc. Offic. Anal. Chem, 50:50-78. Wood, T.M. and K.M. Bhat. 1988. Methods for measuring cellulose activities. Methods enzymol, 160:87-112. Zadrazil, F. 1985. Screening of fungi for lignin decomposition and conversion of straw into feed. Angewandte Botanik, 59:433–452. Web http://thethaovanhoa.vn/yeuhangviet/chitiet/c424n20091023102 016143.htm (13/03/2013) http://tienphong.vn/xa-hoi/phong-su/572198/Tan-thay-noi-nuoibo-sua-bang-cong-nghe-cao-tpov.html (5/4/2013) 33 [...]... were ensuring by the growing pattern of bacteria on the plate and under microscopic observation - Gram staining was tested following Cao Ngoc Điep and Nguyen Huu Hiep (2008) 2.2.4 Studying on combination ability of ruminal bacteria isolated from goat and cow in vitro Objective: To evaluate generally cellulose degradability of combination of ruminal bacteria isolated from goat and cow in in vitro Procedure:... result of NT1 was increasing at 18.40% All six treatments from 2 to 7, added the bacteria from the rumen of goat, got results better than 2 controls treatment In brief, the addition the goat bacteria had the productivity in degrading sugarcane bagasse The strain DD9 can cooperate with BM13, BM43 and BM49 for increasing the bagasse degradation 20 Figure 6 Dry matter hydrolysis of treatments after incubated... difference of 5% value with the others (Figure 9) It was similar to the result of Vo Thi My 25 Nhien (2012) with 2.53% degraded lignin content as combination buffalo and cow rumen bacteria in in vitro In a study of in vitro method to improve digestibility of cattle, it showed that the influence of hydrolytic enzyme activities of lignin could be the strain of bacteria, fungi or other chemical and physical... comparison with other materials, the result was determined high cellulose and hemicelluloses, low lignin Therefore, sugarcane bagasse was an appropriate material to culture bacteria synthesized cellulose and by-products in breeding 3.2 Screening of combination of 4 goat rumen bacteria strains Objective: To evaluate generally cellulase activities of bacteria combination The linear equation between optimal... GCGGATTCTTAATTCTGAATGTGAAAAGC3’ Figure 5 The result of 16S rRNA sequencing strain DD7 Strain DD7 is rod-shape bacteria, Gram positive It was the same with bacterial strain DD9 However, colony of DD7 was punctual, milky white and convex 19 3.4 Combination of ruminal bacteria isolated from goat and cow in vitro condition 3.4.1 Dry matter content Result on the dry matter content of bagasse by in vitro condition was shown in Figure... shown in Figure 7, strain DD9 coordinated with the mixture of three ruminal isolates of cow, following ratio (3:1) was an efficient treatment 21 of cellulose hydrolysis with digestibility value 8.17% For negative and positive control samples, the cellulose content was degraded in sugarcane bagasses with value (5.33% and 5.83, respectively) Meaningly, the addition of bacteria isolated from the rumen of goat. .. 1 The cycle of PCR reaction (*Source: Maniatis et al., 1989) DNA sequencing - The PCR product was sequenced by the ABI3130 genetic analyzer, an automated DNA sequencing The sequence was identified by using the BLASTN program and comparing 9 the gene sequences of other bacterial strains on GenBank, in order to show the level of similarity matrix of strains Screening the morphology of bacteria - The bacterial... Filtered and washed 3 times with boiling water Dried at 70ºC and weigh them Calculated acid detergent lignin: weight of residue % ADF = x 100 weight of sample (Van Soest and Robertson, 1979) Cellulose content % Cellulose = %ADF - %ADL (Van Soest and Robertson, 1979) 2.2.2 Screening of combination of 4 goat rumen bacteria strains Objective: evaluate the sugarcane bagasse degradation ability of mixing of 4 goat. .. tubes at 13,000rpm for 10 minutes - Decanted the supernatant in the tube - Resuspended the pellet in 250μl TE 1X buffer by repeated pipetting 7 - Added 250μl of 1X TE buffer, 50 μl of 10% SDS and 5μl of ProteinaseK, mixed well (but gentle), and incubated 20 minutes in a water bath at 65°C - Added 400μl of 10% CTAB, gently mix, and incubated at 65oC for 20 minutes - Added 600μl Chloroform:Isoamyl alcohol... treatment 5 had the highest rate of hemicellulose digestion (10.22%) Other treatments had the degraded hemicelluloses content values from 8.50% – 9.50%, except NT4 (7.88%) The result of NT5 was very different with the research of Vo Thi My Nhien (2012) about the ability of bagasse degradation of combination of buffalo and cow rumen bacteria in in vitro (0.28%) 23 Figure 8 Hemicelluloses hydrolysis of treatments