UNDERSTANDING RESPIRATORY MECHANISMS IN MYCOBACTERIA

UNDERSTANDING THE RESPIRATORY MECHANISMS OF MYCOBACTERIA AKUA BOATEMA OFORI-ANYINAM (B.Sc. (Hons.), Kwame Nkrumah University of Science and Technology) A THESIS SUBMITTED FOR THE DEGREE OF MASTER OF SCIENCE IN INFECTIOUS DISEASES, VACCINOLOGY AND DRUG DISCOVERY YONG LOO LIN SCHOOL OF MEDICINE DEPARTMENT OF MICROBIOLOGY NATIONAL UNIVERSITY OF SINGAPORE and THE SWISS TROPICAL AND PUBLIC HEALTH INSTITUTE UNIVERSITY OF BASEL 2012 DECLARATION I hereby declare that the thesis is my own original work and has been written by me in its entirety. I have duly acknowledged all sources of information which have been used in the thesis. This thesis has not been previously submitted for any degree in any university. AKUA BOATEMA OFORI-ANYINAM 27TH DECEMBER 2012 i ACKNOWLEDGEMENTS I would like to thank my dearest friend and mentor Immanuel for the guidance throughout this candidature; I would not have made it without you. Much thanks also go to my research supervisor Dr. Srinivasa Rao (Novartis Institute for Tropical Diseases NITD) for his dedicated supervision, patience and encouragement throughout my entire research work in the Drug Discovery unit of NITD and special thanks to Prof. Gerd Pluschke (Swiss Tropical and Public Health Institute, University of Basel) for his support and for agreeing to become my co-supervisor. I would also like to thank the entire Drug Discovery unit of NITD, particularly Pamela Thayalan for coaching me and helping me take my initial baby steps till I could stand on my own two feet. My profound gratitude and appreciation also go to Pramila Ghode for the immense support and for simply being there for me no matter the circumstances. Thanks to Balbir Chaal, to all my colleagues and to the other ladies in our little corner as well; Jansy, Michelle. Last but not least, I would like to deeply thank my loving family and friends whose invaluable advice, encouragement and constant prayers kept me going. Thank you for being there for me through the hills and valleys. ii SUMMARY Mycobacterium tuberculosis (Mtb) is the causative agent of tuberculosis (TB), one of the major infectious diseases affecting one-third of the world’s population. Persistence of Mtb despite prolonged chemotherapy represents a major obstacle for the control of tuberculosis. Mtb is an obligate aerobe which has the ability to survive and persist for a long period of time even under hypoxic and nutrient starved conditions. The mechanisms employed by Mtb to persist in a quiescent state are largely unknown. Respiration is a major process through which Mtb generates ATP and the intracellular concentration of ATP is significantly times lower in both hypoxic and nutrient starved non-replicating Mtb cells compared to aerobic replicating bacteria, making them exquisitely sensitive to any further depletion. Successful studies and phase II clinical trials using TMC207, an ATP synthase inhibitor has clinically validated respiration as an important target. The respiratory mechanisms of mycobacteria are however poorly understood. The respiratory chain of mycobacteria involves many complexes namely NADH dehydrogenase, nitrate reductase (NAR), fumarate reductase (FRD), succinate dehydrogenase (SDH), cytochrome oxidase and ATP synthase. A systematic approach using bio-informatic analysis and microbiological investigation using various mutants of the respiratory pathway was carried out. Bio-informatic analysis clearly showed that NADH dehydrogenase I complex was absent in the M. leprae minimal genome, but present in other mycobacteria. Succinate dehydrogenase (SDH) complex genes were present in all the mycobacteria. Fumarate reductase (FRD) was present only in M. bovis BCG and M. tuberculosis. Furthermore, the respiratory complex mutants were subjected to growth under nutrient-rich and starved conditions. All mutants had no difficulty growing in nutrient-rich aerobic media. Under nutrient-starved conditions, Nicotinamide Adenine Dinucleotide iii (NADH) quinone oxidoreductase I mutant strain (NUO) showed no phenotype, whilst SDH,FRD, Rv0247-9c and NAR deletion strains showed significant attenuation in growth compared to wild type. These results helped reveal the importance of these genes under nutrient starved conditions. Further mutations in respiratory pathway genes (SDH and FRD) made the Mycobacteria exquisitely sensitive to bactericidal agents under both nutrient-rich and starved conditions. This could be due to increased production of reactive oxygen species (ROS) by the mutants compared to wild type. ROS generation is known to be one of the most common death mechanisms used by most of the bactericidal agents. Finally, a biochemical vesicle assay was also developed to carry out pathway based screens to identify novel respiratory chain inhibitors that could be used for the treatment of tuberculosis. The current study has furthered our understanding of the respiratory physiology of aerobic growing and nutrient starved nongrowing mycobacteria. iv TABLE OF CONTENTS 1.0 INTRODUCTION 1.1 MYCOBACTERIUM TUBERCULOSIS 1 1.2 A BRIEF HISTORY OF MYOCOBACTERIUM TUBERCULOSIS 2 1.3 GEOGRAPHICAL DISTRIBUTION AND EPIDEMIOLOGY 5 1.4 TUBERCULOSIS: ETIOLOGY, SIGNS AND SYMPTOMS 6 1.5 DISEASE TRANSMISSION AND PROGRESSION FROM LATENCY TO NON-LATENCY 8 1.6 DIAGNOSIS OF TUBERCULOSIS 9 1.7 PREVENTION AND CONTROL OF TUBERCULOSIS 11 1.8 EARLY TUBERCULOSIS DRUG DISCOVERY AND DEVELOPMENT 12 1.9 CURRENT TREATMENT OF TUBERCULOSIS 14 1.10 NEED FOR NEW DRUGS 18 1.11 NOVEL AND CLINICALLY VALIDATED TARGETS AND INHIBITORS 22 v 1.12 INTRODUCTION TO MYCOBACTERIAL RESPIRATION 26 1.13 A KNOWLEDGE GAP 29 1.14 “THE GREAT WALL OF MTB”- TUBERCULOSIS DRUG DEVELOPMENT AND SCREENING 30 1.15 OBJECTIVES OF THE PRESENT STUDY 36 2.0 MATERIALS AND METHODS 37 2.1. MATERIALS 37 2.1.1 MEDIA AND MEMBRANE VESICLE EXTRACTION 37 2.1.2 ANTIBIOTICS 37 2.2 METHODS 2.2.1 PREPARATION OF MIDDLEBROOK 7H9 COMPLETE MEDIA 38 2.2.2 PREPARATION OF MIDDLEBROOK 7H11 AGAR PLATES 38 2.2.3 PREPARATION OF ALBUMIN-DEXTROSE-SALINE 39 2.2.4 PREPARATION OF 20% TWEEN 80 39 2.2.5 PREPARATION OF 0.05% TWEEN 80 PBS 39 vi 2.2.6 PREPARATION OF 50% GLYCEROL 39 2.3 BACTERIAL STRAINS 40 2.4 GROWTH CONDITIONS AND PROCEDURES 40 2.5 MINIMUM INHIBITORY CONCENTRATION DETERMINATION 41 2.6 LOEBEL CIDAL STUDIES 42 2.7 ATP ASSAY AND MEMBRANE VESICLE BUFFER PREPARATION 43 2.8 VESICLE AND RESPIRATORY ENZYME ASSAY DEVELOPMENT 44 2.8.1 CULTURE OF M. smegmatis AND M. bovis BCG 44 2.8.2 PELLET PREPARATION 44 2.8.3 MEMBRANE VESICLE EXTRACTION FROM M. smegmatis PELLET CELLS 44 2.8.4 MEMBRANE VESICLE EXTRACTION FROM M. bovis BCG PELLET CELLS 45 2.9 PROTEIN QUANTITATION 48 vii 2.10 RESPIRATORY MEMBRANE VESICLE ASSAY 49 2.11 STATISTICAL ANALYSIS 49 3.0 RESULTS 51 3.1 IN SILICO BIOINFORMATIC ANALYSIS OF MAJOR GENES WITHIN THE RESPIRATORY CHAIN COMPLEXES OF THE MYCOBACTERIA 51 3.1.1 COMPLEX I: REDUCED NICOTINAMIDE ADENINE DINUCLEOTIDE DEHYDROGENASE I (NADH) 53 3.1.2. COMPLEX II:SUCCINATE DEHYDROGENASE (SDH) 55 3.1.3 FUMARATE REDUCTASE (FRD) 58 3.1.4 PUTATIVE ENZYME (Rv0247/BCG0285) 59 3.1.5 NITRATE REDUCTASE (NAR) 60 3.2 RESPIRATORY COMPLEXES- THEIR RELEVANCE FOR AND IMPACT ON SURVIVAL UNDER VARIED GROWTH CONDITONS 64 3.2.1 CULTURE OF M. bovis BCG AND M. tuberculosis viii WILD TYPE AND MUTANTS IN VITRO 64 3.2.1.1 M. bovis BCG WILD TYPE AND MUTANTS UNDER NUTRIENT RICH AEROBIC CONDITIONS 64 3.2.1.2 M. bovis BCG WILD TYPE AND MUTANTS UNDER NUTRIENT STARVED CONDITIONS (LOEBEL MODEL) 66 3.2.1.3 M. tuberculosis WILD TYPE AND MUTANTS UNDER NUTRIENT STARVED CONDITIONS (LOEBEL MODEL) 68 3.3 IN VITRO DRUG SENSITIVITY STUDIES FOR M. bovis BCG and M. tuberculosis WILD TYPE AND RESPIRATORY COMPLEX MUTANTS 69 3.3.1 M. bovis BCG WILD TYPE AND SDH MUTANT DRUG SENSITIVITY UNDER NUTRIENT RICH AEROBIC CONDITIONS 69 ix 3.3.2 M. bovis BCG WILD TYPE AND FRD MUTANT DRUG SENSITIVITY UNDER NUTRIENT RICH AEROBIC CONDITIONS 70 3.3.3 M. bovis BCG WILD TYPE AND NUO MUTANT DRUG SENSITIVITY UNDER NUTRIENT RICH AEROBIC CONDITIONS 72 3.3.4 M. tuberculosis WILD TYPE AND MUTANT DRUG SENSITIVITY UNDER NUTRIENT RICH AEROBIC CONDITIONS 73 3.4 LOEBEL CIDAL STUDIES 76 3.4.1 IN VITRO DRUG SENSITIVITY STUDIES FOR LOEBEL M. bovis BCG WILD TYPE AND MUTANTS 76 3.4.2 IN VITRO DRUG SENSITIVITY STUDIES FOR LOEBEL M. tuberculosis WILD TYPE AND MUTANTS 80 3.5 RESPIRATORY MEMBRANE VESICLE ASSAY DEVELOPEMENT FOR THE HIGH-THROUGHPUT SCREENING AND IDENTIFICATION OF RESPIRATORY ENZYME INHIBITORS x 84 3.5.1 M. smegmatis RESPIRATORY MEMBRANE VESICLE ASSAY 84 3.5.2 M. bovis BCG RESPIRATORY MEMBRANE VESICLE ASSAY 86 CHAPTER 4 88 4.0 DISCUSSION 88 4.1 IN SILICO BIOINFORMATIC ANALYSIS OF MAJOR GENES WITHIN THE RESPIRATORY CHAIN COMPLEX OF THE MYCOBACTERIA 88 4.2 RESPIRATORY COMPLEXES: THEIR IMPACT AND RELEVANCE FOR SURVIVAL UNDER VARIOUS GROWTH CONDITONS 94 4.2.1 GENETIC ESSENTIALITY OF RESPIRATORY COMPLEX GENES UNDER NUTRIENT-RICH AEROBIC GROWING CONDITIONS 94 4.2.2 GENETIC ESSENTIALITY OF RESPIRATORY COMPLEX GENES UNDER NUTRIENT-STARVED AEROBIC CONDITIONS 95 4.2.3 SUSCEPTIBILITY OF RESPIRATORY COMPLEX GENE DELETION xi MUTANTS TO STANDARD ANTI-TB DRUGS UNDER NUTRIENT-RICH AND -STARVED AEROBIC CONDITIONS 101 4.3 RESPIRATORY MEMBRANE VESICLE ASSAY DEVELOPEMENT FOR THE HIGH-THROUGHPUT SCREENING AND IDENTIFICATION OF RESPIRATORY ENZYME INHIBITORS 103 5.0 CONCLUSION AND RECOMMENDATIONS FOR FUTURE WORK 105 5.1 CONCLUSION 105 5.2 FUTURE WORK. 107 6.0 REFERENCES 110 APPENDIX 125 ANNEXE 1 126 xii LIST OF FIGURES Fig. 1.1 Global Distribution of Tuberculosis, Estimated New Cases, 2010 6 Fig. 1.2 Electron Transport chain showing the transfer and flow of electrons and protons resulting in the eventual production of ATP 27 Fig. 1.3 a. M. tuberculosis cell envelope b. Comparison of M. tuberculosis envelope with general gram negative and positive envelopes of bacteria 31 Fig. 1.4 Mycobacteria produce membrane vesicles during intracellular infection of macrophages in vitro and in vivo 34 Fig. 2.1 Membrane vesicle extraction procedure 47 Fig. 3.1 Subunits of NADH Dehydrogenase 1 present in selected Mycobacteria 54 Fig. 3.2 Subunits of Succinate Dehydrogenase present in selected Mycobacteria 58 Fig. 3.3 Subunits of Fumarate Reductase present in selected Mycobacteria 59 Fig. 3.4 Subunits of the Rv0247-9c present in selected Mycobacteria 60 Fig. 3.5 Subunits of Nitrate Reductase present in selected Mycobacteria 62 Fig. 3.6 Legend describing the coding sequences of the respiratory complex genes analyzed in the selected Mycobacteria 63 Fig. 3.7 Growth of M. bovis BCG under nutrient rich aerobic conditions 65 Fig. 3.8 Growth of M. bovis BCG wild type and mutant strains under nutrient starved conditions (Loebel model) 66 Fig. 3.9 Growth of M. tuberculosis H37Rv wild type and mutant strains under nutrient xiii starved conditions (Loebel model) 68 Fig. 3.10 M. bovis BCG wild type and SDH deletion mutant’s sensitivity anti-TB drugs namely, Rifampicin (RIF), Moxifloxacin (MOXI), Isoniazid (INH) and Streptomycin (STREP) 70 Fig. 3.11 M. bovis BCG wild type and FRD deletion mutant’s sensitivity anti-TB drugs namely, Rifampicin, Moxifloxacin, Isoniazid and Streptomycin 71 Fig. 3.12 M. bovis BCG wild type and NUO deletion mutant’s sensitivity anti-TB drugs namely, Rifampicin, Moxifloxacin, Isoniazid and Streptomycin 73 Fig. 3.13 M. tuberculosis wild type, SDH and FRD deletion mutant’s sensitivity to Rifampcin (RIF) 74 Fig. 3.14 M. tuberculosis wild type, SDH and FRD deletion mutant’s sensitivity to Moxifloxacin (MOX) and Streptomycin (STREP) 75 Fig. 3.15 M. tuberculosis wild type, SDH and FRD deletion mutant’s sensitivity top p-aminosalysilic acid (PAS) and Isoniazid (INH) 75 Fig. 3.16 Growth of M. bovis BCG wild type and mutant strains used for drug sensitivity experiments under nutrient starved conditions 77 Fig. 3.17 M. bovis BCG wild type and mutant drug sensitivity to Rifampicin under nutrient starved conditions 77 Fig. 3.18 M. bovis BCG wild type and mutant drug sensitivity to Moxifloxacin under nutrient starved conditions 78 Fig. 3.19 M. bovis BCG wild type and mutant drug sensitivity to Streptomycin xiv under nutrient starved conditions 79 Fig. 3.20 M. bovis BCG wild type and mutant drug sensitivity to cycloserine, p-aminosalysilic acid and Isoniazid under nutrient starved conditions 79 Fig. 3.21 Growth of M. tuberculosis H37Rv wild type and respiratory gene deletion mutant strain at the start of drug treatment 80 Fig 3.22 M. tuberculosis H37Rv wild type and mutant strains drug sensitivity to Rifampicin under nutrient starved conditions 81 Fig. 3.23 M. tuberculosis H37Rv wild type and mutant drug sensitivity to Moxifloxacin under nutrient starved conditions 82 Fig. 3.24 M. tuberculosis H37Rv wild type and mutant drug sensitivity to Streptomycin under nutrient starved conditions 82 Fig. 3.25 M. tuberculosis H37Rv wild type and mutant drug sensitivity to para-aminosalysilic acid and Isoniazid under nutrient starved conditions 83 Fig. 3.26 Electron transport chain activity of M. smegmatis respiratory membrane vesicles. Red and blue lines indicate the vesicle activity the absence and presence of known ATP synthase inhibitor TMC207 at 1M, respectively 85 Fig. 3.27 Electron transport chain activity of M. bovis BCG respiratory membrane vesicles. Red and blue lines indicate the vesicle activity the absence and presence of NADH, respectively 86 xv LIST OF TABLES TABLE 1.1 Current TB Drugs available for treatment 15 TABLE 1.2 Summary of the proposed pathway of electron flow from electron acceptors to donors (Gennis and Stewart, 1996 in Kana et al, 2009) 28 TABLE 4.1 Summary of the comparative bio-informatics analysis of respiratory complexes showing their distribution and sequence homology to Mycobacterium tuberculosis 90 xvi LIST OF ABBREVIATIONS ADP Adenosine Diphosphate ADS Albumin Dextrose Saline AG arabinogalactan AIDS Acquired Immunodeficiency Syndrome ANOVA one-way analysis of variance ATB Active Tuberculosis ATP Adenosine Triphosphate ATP SYN ATP Synthase BCG Bacille Calmette-Guerin BSA Bovine Serum Albumin CT Computed Tomography CYCL Cycloserine CYP hepatic cytochrome CYT BC 1 Cytochrome bc1 Complex CYT BD OXIDASE Cytochrome bd oxidase DCCD N,N’- dicyclohexylcarbodiimide Ddn dependent nitroreductase DMSO Dimethyl sulfoxide e Electrons EDTA Ethylenediaminetetraacetic acid ETC Electron Transport Chain FAD Flavine Adenine Dinucleotide FRD Fumarate reductase H+ Protons HEPES 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid HIV Human immunodeficiency virus xvii IFN- γ interferon-γ IGRA IFN- γ release assay INH Isoniazid KOH Potassium Hydroxide LAM lipoarabinomannan LTB Latent Tuberculosis MAPc mycolyl-AG-Peptidoglycan complex MBC Minimum Bactericidal Concentrations MDR-TB Multidrug-resistant Tuberculosis MgCl2 Magnesium Chloride MIC Minimum Inhibitory Concentration MK Menaquinone MOA mechanism of action MOPS 3-(N-morpholino)propanesulfonic acid MOXI Moxifloxacin MTB Mycobacterium tuberculosis MVs Membrane vesicles NAAT nucleic acid amplification tests NAD Nicotinamide Adenine Dinucleotide NADH Nicotinamide adenine dinucleotide, reduced NaOH Sodium Hydroxide NAR Nitrate reductase NAR Nitrate Reductase NDH NADH –quinone oxidoreductases NNRTI reverse transcriptase inhibitor NUO NADH menaquinone oxidoreductase I PAS Para-aminosalycilic acid RIF Rifampicin xviii SDH Succinate dehydrogenase STREP Streptomycin TB Tuberculosis TCA Tricarboxylic Acid Cycle TST tuberculin skin test WHO World Health Organization XDR-TB Extremely/Extensively drug resistant Tuberculosis xix CHAPTER 1 1.0 INTRODUCTION 1.1 MYCOBACTERIUM TUBERCULOSIS ‘A portrait of the fierce determination and pursuit to survive painted by the sheer mastery of wit and cleverness’ “Outwit your foe and you are good to go”- This theme seems central to life and can be seen play out in diverse ways. Foes come in different shades; one’s could be poverty, ill health or simply an age old bad habit. The question really is which side of the battle field a person is on? Amazingly, microorganisms have strategically evolved and thus successfully gained the capacity to colonize human organs over time even under the harshest conditions encountered within man during infection. Pathogens, adhering to the indelible rules of evolution, strive to stay alive and replicate; producing more copies of self while the host immune system concurrently mounts a war-like defense to find and annihilate the pathogens. The ‘Red Queen Hypothesis’ has been postulated to explain the evolutionary arms race that is present between all predators and their prey, as well as between pathogens and their hosts. This hypothesis applied to pathogens explains that hosts must improve their species fitness to defend themselves against a given pathogen, but that the pathogen must also evolve more clever functionality to successfully utilize that host species. Given the short life cycles of pathogens, eventually, the pathogen may have a greater macro evolutionary advantage, due to 1 the ability to transform or evolve their genes more rapidly hence efficiency, leaving humans as well as other organisms they invade, at a disadvantage. (http://www.eoearth.org/article/History_of_pathogenstopic=4955) Among the many evolutionary strategies of organisms, Mycobacterium tuberculosis (Mtb) has one of the most developed complex features and adaptive mechanisms to successfully infect mankind. 1.2 A BRIEF HISTORY OF MYOCOBACTERIUM TUBERCULOSIS Tuberculosis (TB) is a disease of antiquity which dates back to ages before medieval times. Other names synonymous with this hoary disease included the consumption, phthisis, the white plague, wasting disease and the King’s Evil. J. L. Schonlein, Professor of Medicine in Zurich, in his work, Systematik de speziellen Pathologie und Therapie suggested the word tuberculosis to describe this disease as a result of the pathological effect of tubercles (Pachar, 2011) Skeletal remains from the Stone Age and mummified bodies from ancient Egypt have shown evidence of TB confirming that this disease plagued prehistoric man about 6,000 years ago. Ancient and biblical writings refer to a pulmonary disease that consumed people from the inside while works of art from ancient Egypt around 3000 Before the Common Era (B.C.E) revealed the existence of TB even at that age. Acid-fast bacteria found in smears obtained from an extremely well preserved mummified body of a child dated as far back as 700 B.C.E showed evidence of the presence of Mycobacterium tuberculosis. With the migration of man 2 to different parts of the world, overpopulation and trade, came, the spread of tuberculosis to geographical areas within the Americas, Nile Valley, China, India and Western Europe. Archaeology, language, art and literature of ancient origin also produced details pointing to the existence of this ravaging disease (Dyer, 2010). Notably, Hippocrates (460 BC – 377 BC), an ancient Greek physician of Classical Athens, in his penning describes the deleterious effects and eventual fatality of tuberculosis; then called phthisis or consumption when he writes, “Consumption was the most considerable of the diseases which then prevailed, and the only one which proved fatal to many persons. Most of them were affected by these diseases in the following manner: fevers accompanied with rigors,......, they were soon wasted and became worse, having no appetite for any kind of food throughout; no thirst; most persons delirious when near death. So much concerning the phthisical affections” (Of The Epidemics by Hippocrates). Aretaeus, a Cappadocian monk and Greek physician, described tuberculosis as a disease with a poor prognosis in which sufferers had a chronic discharge of opaque, whitish-yellow fluid from their lungs while Galen (131-202 C.E), another prominent Greek physician in Rome, contributed to the history of tuberculosis as he continued the documentation of this disease. He did not agree with Hippocrates on his assertion that the disease was hereditary, but believed that it was actually contagious and advised people to avoid close contact with the infected (Dyer, 2010). In the Middle Ages and specifically around the 16th century, more knowledge about the anatomy, pathology and progression of tuberculosis was discovered. Fransiscus de la Boe (alias sylvius) (1614-1672), professor of clinical and anatomical medicine in Holland, in his 3 Opera Medica associated the nodules formed in the lungs and other parts of the body with consumption, referring to them as tubercles. He also described how these nodules later progressed to form cavities and ulcers. Thomas Willis and Richard Morton, two students of his, also made some interesting findings. Willis associated the localized lesions in the lungs of patients to the wasting away of the body. Notably, he described different forms of the disease with their characteristics such as ‘Chronic Tuberculosis’, which had a period of worsening and remission, as well as ‘Galloping Tuberculosis’, due to the sudden occurrence and extremely fast progression of the disease within a few months leading to the destruction of the lung tissue. Morton on the other hand, documented what he believed to be the three stages of Phthisis. These were the initial ‘inflammation after infection’, progression to the ‘formation of tubercles’ and finally to the ‘formation of ulcers and full-blown consumption’ (Dyer, 2010). In 1865, Jean Antoine Villemin showed that tuberculosis was a disease transmissible from man to cattle and subsequently to rabbits while Robert Koch, in 1882, developed a staining technique that made it possible to view M. tuberculosis microscopically (Murray, 2004). Significant, in the history of tuberculosis was the development of sanatoria all over Europe and America in the mid 1800s where the sick were quarantined; to limit the source of infection in the community, while being put on a strict regimen of rest, proper nutrition and continuous fresh air. 4 1.3 GEOGRAPHICAL DISTRIBUTION AND BRIEF EPIDEMIOLOGYA third of the world’s population is estimated to be latently harbouring M. tuberculosis (Chatterjee et al, 2011). From recent statistics, it was estimated that 8.8 million people fell ill with tuberculosis in 2010 and 1.4 million died. In 2011, the expected number of new cases alone was estimated to be about 9.8 million (Dye and Williams, 2010). These are data from reported cases; there could be many unreported cases. Tuberculosis has been implicated as the leading cause of death in Human immunodeficiency virus (HIV) infected individuals, causing 25% of all deaths. More than 95% of deaths as a result of tuberculosis are found in the poverty stricken, under developed and developing regions of the world. On the emergence and rise are Multidrug-resistant (MDR-TB) and Extremely/Extensively drug resistant Tuberculosis (XDR-TB). It was estimated that a total of about 650,000 cases of MDR-TB were present on the globe in 2010 and about 9% of these cases were found infected with XDR-TB strains. An estimated total of about 440,000 individuals with MDR-TB became ill while about 150,000 have been reported to have died in 2012 alone (WHO, Tuberculosis, Fact Sheet, 2012). The incidence of tuberculosis cases are highest in the African continent followed by Asia which has the highest number of cases reported every year. Asia, Russia, India, South East Asian nations and China have the highest number of TB cases (Fig. 1.1). 5 Fig 1.1 Global Distribution of Tuberculosis showing the estimated new cases of disease in 2010. (Adopted from WHO, 2012) 1.4 TUBERCULOSIS: ETIOLOGY, SIGNS AND SYMPTOMS The mycobacteria are genera of bacteria found within the family Mycobacteriacae and comprise a variety of species, both virulent and avirulent with varied levels of economic importance. Mycobacterium tuberculosis is one of the major species in the group of virulent strains with a long standing reputation as one of the greatest causes of morbidity and mortality in man. It is one of the causative agents for tuberculosis (TB) among other strains such as 6 Mycobacterium bovis (M. bovis) (de Kantor et al, 2010) and Mycobacterium africanum (M. africanum) (de Jong et al, 2010). Only about 10% of individuals infected with M. tuberculosis progress to Tuberculosis disease development. Upon first encounter with the pathogen, the bacilli are usually contained by the immune system and cleared, however, in 50-60% of cases, the disease makes a come back. Tuberculosis pleuritis may develop in about 10% of individuals with pulmonary tuberculosis when nodules containing bacteria rapture into the pleural space located between the lung and lining of the abdominal cavity (http://www.emedicinehealth.com). Tuberculosis can develop in the lungs (pulmonary) or in other organs including the nervous system, skeletal system, gastrointestinal and genito-urinary tracts (extrapulmonary). (Golden et al, 2005). Pulmonary tuberculosis is highly contagious and is spread via droplet infection when infected individuals cough, sneeze, spit or sing (Toth et al, 2004). Extrapulmonary tuberculosis, however, is not spread this way. In individuals with weak immune systems, tuberculosis may spread systemically to other body organs, referred to as miliary tuberculosis (http://www.emedicinehealth.com). Indeed it is not unusual to find an individual infected with both forms of the disease (Sharma et al, 2004), especially due to high bacterial load and in advanced cases of disease. About 15% of individuals may develop extrapulmonary tuberculosis and about 25% of these individuals usually had tuberculosis without adequate treatment (http://www.emedicinehealth.com). Pulmonary tuberculosis is therefore most dangerous and is currently the second most notorious infectious disease next to The Human Immunodeficiency Virus/Acquired Immunodeficiency Syndrome (HIV/AIDS) with over 50% of cases occurring in individuals 7 infected with the later (Sharma et al, 2004). Symptoms of Pulmonary tuberculosis include weight and energy loss, fever, loss of appetite, night sweats and a productive cough (http://www.emedicinehealth.com). 1.5 DISEASE TRANSMISSION AND PROGRESSION FROM LATENCY TO NONLATENCY Transmission of tuberculosis is airborne. Infectious droplet nuclei go down the buccal and nasal tracts, down the upper respiratory tract and into the alveoli of the lungs. Among the factors that control infection are the level of infectiousness of infected individuals (i.e. with respect to the number of bacilli expelled into the air) and the exposure to and frequency of interaction with infected individuals. After 2-8 weeks post infection, the bacilli are taken up by alveolar macrophages which annihilate majority of the bacilli. A hand full however evades the host immune defence and begins to exploit the macrophages by forming a niche within them and multiplying. Upon the death of the macrophages, bacteria progeny are released and subsequently move to other body organs and tissues on the ticket of systemic blood circulation. This prepares the immune system to mount a systemic immune response. As macrophages surround the bacilli, a walled off region known as the granuloma is formed to contain the bacteria. If the immune system is unable to control the bacteria, bacilli multiply rapidly Humoral immunity offers little or no protection. Adaptive responses however are elicited and are effective at least in individuals with uncompromised immunity. Persons infected with tuberculosis are either diagnosed as being latently infected (LTB) or actively infected (ATB). 8 Latent tuberculosis patients are classified so when they test positive in the tuberculin skin test however do not have active disease and cannot spread the infection. What happens in latently infected individuals is that the immune system successfully contains the bacilli leading to the formation of a granuloma. During latent infection bacilli are generally dormant and individuals show no symptoms of infection. Immediately successful bacilli control becomes compromised, a person progresses to active disease development; as found during immunosupression in individuals with Human Immunodeficiency virus (HIV) or diabetes, and becomes infectious with the capacity to transmit the disease. Bacilli multiply rapidly during the non-latent phase and individuals begin to show the signs and symptoms of TB infection. Most infected individuals may also show culture or smear positivity at this phase of infection. 1.6 DIAGNOSIS OF TUBERCULOSIS In the clinic, the immediate detection of tuberculosis presents a challenge. Only about 44% of all new cases are found out by the presence of acid fast bacilli on sputum smears (WHO, 2009). The detection of M. tuberculosis confirms tuberculosis infection and is thus the gold standard for diagnosis. This method of detection, although useful and widely used, is imperfect due to many reasons including the long culture growth period which is usually anything between 2-4 weeks and within which time the disease would have progressed or been spread to others. Other classical methods of detection therefore include; the tuberculin skin test (TST), the Xray chest radiography or the more sensitive Computed Tomography (CT) such as the high 9 resolution CT. The amplification of M. tuberculosis nucleic acids and examination of biological specimen for pathological changes are also carried out (Lee et al, 1995; Im et al, 1993; McGuinness et al, 1992).The tuberculin skin test also known as the Mantoux test, involves intradermally injecting an individual with the tuberculin purified protein derivative (PPD) in the inner surface of the forearm. Within 48-72 hours after administration, results of the diagnosis are determined by a pale swelling of the skin known as a wheal. This test is considered positive for a wheal of more than 5 millimeters in diameter (CDC, 2011). Persons are either diagnosed as having latent tuberculosis (LTB) or active tuberculosis (ATB). Recent improvements in diagnosis procedures although not widely used due to cost include the incorporation of florescence to enhance sensitivity. A point of tension though has been the fear of a compromise in specificity especially considering the conditions usually encountered in developing countries. To improve the balance between sensitivity and specificity, the use of a stronger light source has been included (Trusov et al, 2009; Steingart et al, 2006; Gilpin, 2007) Liquid culture and drug susceptibility testing have also been approved by the WHO as a method in low resource areas (WHO, 2009). Molecular methods of diagnosis include the specific nucleic acid amplification tests (NAAT). In individuals showing sputum positivity of acid fast bacilli, the ability for NAAT to detect M. tuberculosis nucleic acids has been reported as greater than 95%. A negative acid fast bacilli test result however, indicates that an individual is most likely infected with a non-tuberculous Mycobacteria species. In spite of its robustness, there have been some issues concerning the heterogeneity and accuracy of this tool (Flores et al, 2005; Sarmiento, 2003) 10 The interferon-γ (IFN- γ release assay (IGRA)) is one addition to available diagnostics for tuberculosis case detection that created much excitement. IGRA is a rapid test based on the M. tuberculosis specific antigens ESAT6, CFP-10 and the ability to measure IFN- γ release. QuantiFERON-Gold by Cellestis Ltd, Carnegie, Australia (Cellestis. Quantiferon-TB gold. 2009) measures IFN- γ using ELISA while T-SPOT-TB (Oxford Immunotec Ltd, Abington, UK) counts cells giving off IFN- γ using ELISPOT (Oxford Immunotec. T.Spot-TB. 2009). 1.7 PREVENTION AND CONTROL OF TUBERCULOSIS The control and prevention of tuberculosis takes many forms. Generally, infected individuals are required to be considerate to others and to make every effort not to spread the infection. Cautions to be taken include covering the mouth with a tissue or handkerchief when coughing, sneezing and laughing and properly disposing off these items after use. Infected individuals are also advised to put on masks especially when around others and to properly ventilate their homes (http://www.mayoclinic.com/health/tuberculosis). Another major control measure of tuberculosis is the use of vaccines and chemotherapy. Since the 1920’s, the M. bovis Bacillus Calmette-Guerin (BCG) vaccine is that which has been incorporated into prevention and immunization campaigns. It is a live attenuated vaccine which was obtained through 230 successive serial passages in vitro between 1908 and 1921 from the pathogenic M. bovis strain (Martin, 2006) which causes tuberculosis in cattle and is the product of hundreds of genes being lost from the genome of M. bovis (Behr et al, 1999). Due to worldwide sub-culturing of BCG since its inception, many variants such as BCG Pasteur and BCG Brazil exist (Martin, 2006). There are therefore variations in the protective 11 efficacy offered by the vaccine depending on the strain used (Behr, 2002). BCG is highly protective in children and is used in the treatment of bladder cancer quite routinely (Aronson et al, 2004).In spite of the high protection this vaccine provides in children, its protective efficacy in adults has been a challenge. Protective efficacy of the BCG vaccine against Pulmonary tuberculosis was found between 0 to 70% in India and the UK, respectively (Fine, 1995). Many reasons for the variation in efficacy have been proposed including the possibility of prior exposure to environmental mycobacteria (Brandt et al, 2002) especially in developing countries as well as in the tropics which might be compromising factors stimulating the human immune system to produce antibodies against BCG and limiting the multiplication of the bacteria and thus the protection offered by the vaccine. There are currently a number of new vaccines in clinical trials. A successful candidate however, would ideally have to be safe for use in children, the elderly and in immunocompromized individuals. A new vaccine would also have to offer better protection than current BCG vaccines. 1.8 EARLY TUBERCULOSIS DRUG DISCOVERY AND DEVELOPMENT Almost all tuberculosis drugs in clinical use today were developed between the 1940’s and 60’s, a period referred to as ‘the golden era of antibiotic drug discovery’. Streptomycin the first anti-tuberculosis drug was developed through the work of the late Selman A. Waksman who began his search as far back as 1914. Only in 1939 did he find a notable inhibitory effect of specific fungi, the actinomycetes, on the growth of bacteria. With these encouraging 12 results, he, along with his team attempted and successfully isolated actinomycin, a potent antibiotic against tuberculosis. Unfortunately however, actinomycin had high toxicity . Not long after this disappointing finding, the team found streptomycin from the fungi, Streptomyces griseus, in 1943. This agent was an excellent inhibitor of M. tuberculosis and amazingly had much lower toxicity. Phenomenal results were seen when for the first time the antibiotic was administered to a tuberculosis patient. The patient quickly recovered from the severe illness and showed sputum conversion (Noor et al, 2011). The joy following the discovery and remarkable results of Streptomycin was all the same short-lived due to the emergence of drug resistance by the bacteria. Para-aminosalycilic acid (PAS) which was in clinical studies at the time was brought into development and administered along side Streptomycin in the late 1940’s following the resistance of the bacteria to Streptomycin alone. Drug resistance was therefore curtailed; but as later events in the timeline of TB drug discovery and chemotherapy would reveal, only for a while. Isoniazid, highly potent in the destruction of actively dividing cells was also developed in the 1950’s and used in combination with Streptomycin and PAS. Pyrazinamide, Ethambutol, Ethionamide and Cycloserine were developed in the years following development of the first three drugs previously discussed. Cycloserine for example was used in cases where individuals had developed resistance to the prioritized drugs (Goble et al, 1993). Another notable event in the time line of TB drug discovery and development in the 1960’s was the formulation of Rifampicin, a drug with a supposedly unique ability to kill the slow 13 growing bacteria, a feature that was lost in other drugs available at the time. 1.9 CURRENT TREATMENT OF TUBERCULOSIS For the treatment of tuberculosis (Mtb) the WHO recommended the DOTS (Directly Observed Treatment, Short-course) as a major component of the Stop TB Strategy. This was the treatment program presented to policy makers and has been integrated into country wide public health tuberculosis control programs for quite a number of years now. DOTS is a five component program combining the commitment from governments, sputum smear microscopy for case detection, standardized TB therapy regimen under direct supervision and observation of a health care worker, uninterrupted supply of the required drugs and the efficient system of reporting and recording to aid in the monitoring of patients. The intricacies of the strategy were developed by Dr. Karel Styblo in the 1980s. The most part of the formulation was done in Tanzania, one of the countries which had and to some extent still has a great part of the burden of TB as seen in the 2010 WHO Global TB Control Report (WHO, 2010). This strategy was applied by Dr. Styblo in the TB control programs of other countries such as Malawi, Benin, Mozambique, Nicaragua and China (Obermeyer et al, 2008). Dr Styblo’s strategy was acknowledged and adopted by the World Health Assembly in 1991 (Raviglione et al, 2006) by about 187 of the 193 member states of the WHO with extraordinarily notable results of this strategy being recorded worldwide (WHO, 2007). The WHO later modified the strategy slightly accentuating the directly observed therapy (DOT) portion of the program specifying certain drug combinations for therapy. 14 In the treatment of drug susceptible TB, there is given within the first two months, Isoniazid, a Rifamycin such as Rifampicin, Rifabutin, Rifapentine, as well as Ethambutol and Pyrazinamide. This is then followed by doses of Isoniazid and a Rifamycin for another 4 months. If the regimen and timing are followed perfectly, individuals could be cured within 6 months. TABLE 1.1 Current TB drugs available for treatment DRUGS DESCRIPTION AND KNOWN TARGET A semisynthetic antibiotic from Streptomyces mediterranei, It is a RIFAMPICIN broad spectrum antibacterial agent which shows good activity against many forms of mycobacteria. It inhibits DNA-dependent RNA polymerase activity by binding to the enzyme and inhibiting RNA synthesis. It is a bactericidal antibiotic. (Gilman et al, 1996). It is bactericidal to actively growing mycobacteria and bacteristatic to ISONIAZID slow growers. It inhibits the formation of mycolic acids, a necessary component of the cell wall and the enoyl reductase, InhA by forming a bond with the cofactor NAD and competing with InhA. (http://www.drugbank.ca/drugs/DB00951). It is classified as a first line drug for TB treatment. An aminoglycoside from Streptomyces griseus, it binds to the 30S STREPTOMYCIN ribosomal subunit and interferes with the initiation and elongation steps in protein synthesis. Specifically, it binds to the 16S rRNA and an amino acid of the protein S12 leading to misreading of mRNA, insertion of incorrect amino acids and the formation of nonsense, toxic 15 peptides. (http://www.drugbank.ca/drugs/DB01082) It is a flouroquinolone and is bactericidal. It prevents DNA replication by binding to DNA gyrase (topoisomearse II), an enzyme that causes the unwinding of the DNA double helix, an action necessarily required for the reading and coping of the parent DNA strand during replication. MOXIFLOXACIN It also acts against topoisomearse IV, an enzyme necessary for the splitting of chromosomal DNA during cell division (http://www.drugbank.ca/drugs/DB00218). It is bactericidal and inhibits the import of mycolic acids into the cell ETHAMBUTOL wall of the bacteria as well as RNA synthesis and arabinosyl transferases necessary for cell wall biosynthesis leading to a weakened and more permeable cell wall (http://www.drugbank.ca/drugs/DB00330). It may also interfere with the synthesis of spermidine. (Smith and Reynard, 1992). It is bacteriostatic and inhibits folic acid synthesis by binding to p-AMINO SALYCYLIC ACID pteridine synthetase, an enzyme which binds to para-aminobenzoic acid towards the formation of folic acid. By binding to pteridine synthatase and cutting off the supply of folic acid, the growth and division of the bacteria slows down since bacteria cannot utilize external sources of folic acid. This agent also prevents the synthesis of mycobactin, leading to the low uptake of iron. It has been found to limit the development of bacterial resistance to Isoniazid (http://www.drugbank.ca/drugs/DB00233). 16 and Streptomycin It may act bacteriostatically or bacteriocidally based on its CYCLOSERINE concentration at the infected site and how susceptible the bacteria are. It is a product of Streptomyces garyphalus. http://pubchem.ncbi.nlm.nih.gov. This agent is an analog of D-alanine and acts by impeding the initial stages in cell wall synthesis through the competitive inhibition of L-analine racemase which forms D-alanine from L-alanine and D-alanylalanine sythetase adding D-alanine to the pentapeptide required for peptidoglycan formation and cell wall synthesis. This thus leads to a weakened bacterial cell wall and most likely the eventual cidal effect (http://www.drugbank.ca/drugs/DB00260). It is either bactericidal or bacteristatic depending on the concentration of drug available at the infected site. It is active only against M. tuberculosis and only at slightly acidic pH, which is a desirable feature as it represents the environment present in the macrophage PYRAZINAMIDE phagolysosome, where bacteria tend to shield themselves and have a field day. The drug becomes active by conversion to Pyrazinoic acid, and acts against the formation of fatty acids necessary for growth and replication by interfering with the fatty acid synthase FAS I (http://www.drugbank.ca/drugs/DB00339). It is bacteristatic against M. tuberculosis and inhibits the formation of cell wall mycolic acids (Smith and Reynard, 1992). It is thought to act in a similar way as Isoniazid. ETHIONAMIDE 17 (http://www.drugbank.ca/drugs/DB00609) It is a cyclic peptide produced by Streptomyces capreolus (http://pubchem.ncbi.nlm.nih.gov) and an aminoglycoside antibiotic believed to inhibit protein synthesis. CAPREOMYCIN (http://www.drugbank.ca/drugs/DB00314). It is also reported to act as an inhibitory agent against translation in the synthesis of phenylalanine (Shaila et al, 1973; Trnka & smith, 1970) Most of the antibacterial drugs developed within the ‘golden era’ including TB drugs, mainly targeted protein synthesis, DNA and RNA synthesis, folic acid synthesis including peptidoclycan synthesis necessary for cell wall formation which are all processes occurring in actively growing cells. As effective as these classical drugs may have been and to an extent still are, they lack the potency against slow growing and dormant bacteria- a current Achilles’ heel in TB treatment programs- and thus are unable to successfully clear persistent infections (Hurdle et al, 2011). 1.10 NEED FOR NEW DRUGS The need for new drugs has been driven by several factors, namely; The emergence of MDR/XDR-TB: MDR-TB is the form of TB infection with (a) strain(s) resistant to at least Isoniazid and Rifampicin; considered and used so far as the two most potent first-line drugs in TB therapy, most likely as a result of a primary infection with a drug 18 resistant strain or mutation of a drug-susceptible strain due to improper treatment time and/or incomplete treatment regimen. XDR-TB on the other hand occurs when individuals are found infected with (a) strain (s) of bacteria resistant to Isoniazid and Rifampicin, the Fluroquinolones and the second-line antiTB injectable drugs (Kanamycin, Amikacin, Capreomycin) (Koul et al, 2011) The numbers of MDR and XDR TB cases have increased in many parts of the world. XDR TB is very hard to cure and clinicians often struggle to find novel combination of regimen to treat such patients. The likely chances of treatment success in such patients are very poor ranging from 30-50%. Hence, the urgent need for novel TB drugs which have a different mode of action from those currently available on the market. The widespread cases of TB- HIV co-infection: HIV has been a major risk factor for tuberculosis disease development. It is believed that a third of the world’s population is asymptomatically infected with the bacteria in its dormant/latent form and thus carriers. These individuals are however, non infectious. Latent Infection with TB occurs when active immune systems are usually able to suppress and restrict the growth of the bacteria. Reactivation of latent tuberculosis and progression to active infection with disease development however, can occur when individuals become immunosupressed or compromised as a result of HIV (Corbett et al, 2003). Other health conditions: Some conditions that leave individuals immuno-compromised and prey to active infection include diabetes and anti-tumor necrosis factor therapy (Barry et al, 2009). Diabetes is said to result in a threefold increase in the possibility of developing active TB (Dye and Williams, 2010). 19 Long treatment duration: In spite of the success rate that had been recorded in the DOTS programme over the years, the effectiveness of this programme has been compromised by the increase in the robustness and fitness of the bacteria due to its great metabolic plasticity. The ability of the bacteria to shift into a metabolic state of non-replicating persistence as a result of stress has led to the tolerance of drugs such as Isoniazid; a first-line drug, rendering the drugs less potent and sometimes ineffective. It is said that “what cannot and does not kill you, only makes you stronger” and these bacteria attempt to prove this saying right. This ability may be the reason for the current long treatment of TB as well as the relapse and treatment failure seen in many cases. Over-bearing treatment regimen and negative drug-drug interactions: The current treatment regimen that patients need to follow i.e. the cocktail of pills administered daily and the frequency of administration required is one big challenge in the effective treatment of TB and a hurdle that needs to be crossed if this disease will successfully be controlled globally. This regimen creates an even more unfortunate situation for individuals co infected with HIV and can be considered a nightmare considering that these individuals are already burdened with anti-retroviral therapy. Diabetic TB patients, who take oral insulin daily, also have to deal with the daily burden of following both drug regimens. Another serious problem faced by these immuno-compromised individuals co-infected with tuberculosis is the unfavourable drug-drug interactions that occur between the drugs being 20 taken alongside TB drugs. It has been reported in the review by Koul et al, 2011, that drug-drug interactions lead to levels of antiretrovirals below the concentrations required for therapeutic effect and also that there are potentially overlapping toxic side effects which cannot be overlooked. (Koul et al, 2011).Their review points out that the common interaction between the anti-TB and an antiretroviral drug is the increased expression of the hepatic cytochrome (CYP) p450 oxidase system induced by Rifampicin (Niemi et al, 2003). This is quite alarming since Rifampicin is a first line drug. Not looking down on the immense contribution of this drug to the treatment of the disease, it is worthy to note that, of the averaged 8 million cases of TB reported, quite a large number were HIV infected. The WHO in 2010 reported that, of the 9.4 million cases reported in 2009, 11-13% were HIV positive (WHO, 2010). The activation of CYP leads to raised metabolism and decreased therapeutic levels of components like the HIV protease inhibitors (L'homme et al, 2009). Protease Inhibitors are mediators that disrupt the process of viral replication by preventing the activity of proteases. HIV proteases cleave the nascent polyproteins at specific points to form the final protein components used in the eventual assembly of an infectious virion. Disruption of the HIV proteases therefore prevents the ability of the virus to replicate and infect other cells (Seelmeier et al, 1988, Kräusslich et al, 1989, Kohl et al, 1988). Therefore, in the absence of these protease inhibitors or at very low levels as a result of TB therapy, viral load would surely increase. Further studies show that even in the presence of CYP 450 inhibitors, like Ritonavir, reduced levels of different protease inhibitors are still not forestalled; in fact required levels could not be recovered and thus co treatment of protease 21 inhibitor therapies along side Rifampicin has been ruled out. The only antiretroviral treatment available for HIV infected TB patients on the TB drug regimen which has been found to have reduced drug-drug interaction is the non-nucleoside reverse transcriptase inhibitor (NNRTI). Patients with NNRTI- mutations are thus limited. Rifabutin is prescribed for these individuals, however, with some level of Ritonavir and this is accompanied by an increase in the toxicity of Rifabutin (L'homme et al, 2009). There is undoubtedly an urgent need for the discovery and development of new antibiotics, potent enough to clear these forms of bacteria .What we look forward to and envisage is the discovery of new targets that would further sensitize these bacteria to the current scaffold of drugs as well as compounds that would be active enough to potentially shorten the treatment time of TB to about 2 months or less; be able to kill persisting bacteria which may lead to relapse and reactivation of disease and show strong potency against Multi-drug resistant bacilli. 1.11 NOVEL AND CLINICALLY VALIDATED TARGETS AND INHIBITORS In more recent years, a couple of novel inhibitors have been found for M. tuberculosis which moved on to clinical trials with some exciting results. Work from Andries et al, 2005, revealed a compound which was found to be active against drug-susceptible and drug resistant strains of M. tuberculosis as well as for actively and nonactively replicating bacilli. This compound, a member of the class of compounds known as the Darylquinolones, was found to act on a new target, one which none of the current (classical) TB drugs targeted. This target was identified as the F0-F1 ATP synthase. 22 The compound, TMC 207 (R207910) has been clinically validated and is in Phase IIb clinical trials. Through a series of experiments with mutants of M. tuberculosis and M. smegmatis toward the identification of the target and mechanism of action (MOA) of the drug, point mutations conferring resistance to R207910 were seen by comparing the genome sequences of the susceptible and resistant M. tuberculosis and M. smegmatis strains. It was found that the gene encoding atpE (a part of the F0 subunit of ATP synthase) was the only gene consistently affected in all mutants studied, confirming that R207910 targeted the gene product of atpE. Their discovery revealed that this drug inhibited the proton pump of M. tuberculosis ATP synthase, a component of the membrane required to produce the proton motive force necessary for energizing the membrane during respiration and eventually resulting in the formation of ATP to drive cellular activity. Rao et al, (2008), showed in a comparison of the cidal activity of the major first and secondline antitubercular drugs in exponentially growing bacteria against quiescent bacilli that, all drugs tested were significantly less active against hypoxic non-replicating Mtb cells compared to replicating cells. It was found that Isoniazid and Ethionamide for example were completely inactive against the non-replicating cells. This led the team to conclude that the school of thought that the biosynthesis mechanisms targeted by the classical TB drugs were not necessary requirements in the survival of non-growing bacilli as reported in by Wayne and Hayes (1996) was valid. Again, through a series of systematic experiments, to validate the requirement of the proton motive force, the F0-F1 ATP synthase, and NADH dehydrogenase I and II for survival of bacilli under hypoxia, it was found that the quiescent bacteria were many more times sensitive 23 to drugs revealing that respiration and mechanisms involved in ATP generation were very critical in non growing bacilli. There was a 5 fold drop in the ATP content of hypoxic bacilli compared to aerobic growing bacteria. To investigate the necessity of the F0-F1 ATP synthase in the maintenance of the reduced level of ATP, the quiescent cells were exposed to R207910 and N,N’dicyclohexylcarbodiimide (DCCD) both ATP synthase inhibitors in separate experiments. The team found that R207910 reduced the ATP levels in a dose dependent way resulting in a corresponding increase in cidal activity and revealing the extreme sensitivity of bacilli to further depletion of ATP and to a large extent validating the importance of ATP synthase and ATP synthesis in the survival of quiescent bacteria. Similar results were obtained when hypoxic cells were exposed to DCCD. It was thus reported that the low levels of ATP seen in the bacilli treated with drugs were unique because none of the first and second line TB drugs tested had any significant effect on the amount of ATP produced. Another compound worth commenting on is the Nitroimidazole, PA-824, an experimental drug also in Phase IIb clinical trials and once again, with a target found in the respiratory chain of M. tuberculosis. This compound has shown bactericidal and sterilizing effect on active, drug-resistant, non-drug resistant and latent TB infections. It is a pro-drug which requires activation to function. It is activated only by a proposed bactericidal enzyme, a deazaflavin (cofactor F420) dependent nitroreductase (Ddn) and thus cannot destroy human cells because this enzyme required for its activation is non-existent in man. PA 824 was found to upregulate a number of respiratory genes including cyd operon 24 encoding the non proton pumping cytochrome bd oxidase, the nitrate reductase narGHJI involved in respiration and to change the redox status of the cell as well with a significant drop in the production of intracellular ATP. This led researchers to suggest strongly that the compound was an energy metabolism inhibitor. PA-824 was shown to carry out its massacre on latent bacteria by releasing Nitric oxide which poisons the bacteria and disrupts electron flow as well as ATP cycling under hypoxic non-replicating conditions. (Manjunatha et al, 2009). In vivo and in vitro studies have also validated the potential of this compound (Lenaerts et al, 2005). Recent phase II clinical studies have shown that both TMC207 and PA824 have been very effective in bringing down the mycobacterial burden in TB patients (Diacon et al., 2009; Andries et al, 2005, Ginsberg et al, 2009). These studies clinically validated respiration as a valid target for treatment of tuberculosis. The respiratory chain of M. tuberculosis comprises various complexes, including NADH dehydrogenase, Succinate reductase, Cytochrome Oxidase, Fumarate reductase, etc. With the discovery of ATP synthase, one of the components of the Electron Transport Chain (ETC) as a unique target for the Diarylquinoline as well as PA-824, the respiratory pathway and processes within M. tuberculosis has been put in the limelight holding promise as a goldmine of targets. Over 50 years after the discovery of the current pipeline of antitubercular drugs, the discovery of such potent inhibitors all targeting aspects of the respiratory chain with amazing sterilizing effects and selectivity could not have merely been due to chance and indicate the need to take another look at the respiratory biology of the mycobacteria. A better understanding of the total respiratory mechanisms could extremely buttress tuberculosis drug discovery and development. 25 1.12 INTRODUCTION TO MYCOBACTERIAL RESPIRATION Respiration in bacteria involves the conversion of a variety of substrates including NADH, succinate, malate, glycerol among others through oxidation reactions with the release and transport of electrons produced, to a terminal electron acceptor such as oxygen. Other known electron acceptors include nitrate and fumarate. Within the electron transport chain of bacteria are a host of enzyme complexes containing flavin prosthetic groups, haem molecules or copper atoms and serving as electron carriers. The quinone pool is the reservoir for electrons (Kana et al, 2009). During glycolysis and the Krebs or Tricarboxylic Acid Cycle (TCA), the oxidation of organic molecules results in the production of reduced coenzymes such as the substrates mentioned above. These reduced co enzymes such as NADH, are the site of storage of most of the energy harvested during glycolysis and the TCA cycle. The respiratory complex of mycobacteria can be broadly classified into two categories one which generates an electron gradient and another which accepts terminal electrons. Coenzymes transfer hydrogen which contains a proton and an electron to the ETC located within the cell membrane of the bacteria. The coenzymes eventually give up their high energy electrons during oxidative phosphorylation, another phase of cellular respiration where most of the Adenosine Triphosphate (ATP) required for cellular activity and survival is produced. The electron carrier proteins shuttle the electrons from the coenzymes to the terminal electron acceptor which could be oxygen, nitrate or fumarate. The NADH dehydrogenase, succinate dehydrogenase/fumarate reductase, cytochrome BD and cytochrome C complexes generate the electron gradient while ATP synthase complex uses this electron gradient, generating ATP. 26 Under aerobic conditions molecular oxygen acts as an electron acceptor, whilst under hypoxic or anaerobic conditions fumarate and nitrate act as electron acceptors. Electrons first enter this chain once NADH transfers both its protons and electrons to the first membrane embedded carrier protein (Fig.1.2). This is often referred to as complex I and is known as NADH Dehydrogenase. The electrons are then transferred along the ETC while protons are moved outside of the membrane. Fig 1.2 Electron Transport chain showing the transfer and flow of electrons and protons resulting in the eventual production of ATP. Components of the pathway are represented as Nicotinamide Adenine Dinucleotide (NAD), Flavine Adenine Dinucleotide (FAD), NADH Dehydrogenase (NDH), Menaquinone (MK), Succinate dehydrogenase (SDH), Cytochrome bc1 Complex (CYT BC 1), ATP Synthase (ATP SYN), Cytochrome bd oxidase (CYT BD OXIDASE), Nitrate reductase (NAR), Fumarate reductase (FRD), Adenosine Diphosphate (ADP), Adenosine Triphosphate (ATP), electrons (e), protons (H+) 27 In the mycobacteria, the specific electron carrier menaquinone (Coenzyme Q or ubiquinone in mitochondria), accepts protons as well as electrons and shuttles the electrons to Cytochrome bc1 complex. The protons are then moved out through the membrane. Cytochrome bc1 complex subsequently oxidizes quinol and passes the electrons to a terminal oxidase such as cytochrome oxidase. Electrons are finally delivered to the terminal electron acceptor in the next step. TABLE 1.2 Summary of the proposed pathway of electron flow from electron acceptors to donors (Gennis and Stewart, 1996). ELECTRON DONORS NADH: ndh, ndh A nuo A-N Succinate: sdhABCD, RV0247cRV0249c Lactate: lldD1, lldD2 Glycerol-3-phosphate: glpD1, glpD2 Malate: mqo Proline: RV1188 ELECTRON ACCEPTORS Oxygen: ctaB-F, cydAB Nitrate: narGHJI, narX Nitrite: nirA, nirBD, nrfD Fumarate: frdABCD Movement of electrons occurs simultaneously with the movement of protons across the cytoplasmic membrane into the periplasmic space (Fig 1.2). This results in an increase of the proton gradient across the membrane and eventually an enhanced proton motive force. The enzyme ATP synthase exploits the energy of the proton motive force to generate ATP. ATP synthase allows protons to move back into the cytoplasm as it rotates and uses the energy released in the process to drive the phosphorylation of Adenosine Diphosphate (ADP) to generate ATP. 28 In most anaerobic bacterial species, ATP synthase serves as a proton pump to generate the proton motive force at the expense of ATP hydrolysis when the respiratory chain cannot generate the level of proton motive force required (Dimroth et al, 2004). Interestingly, an alternate route to ATP production in hypoxic cells without ATP synthase is currently in discussion with strong evidence. It has been suggested that the mechanism involves the activity of phosphoenol pyruvate carboxykinase (PckA) and Fumarate reductase (FRD) where PckA is believed to use the Phosphoenol Pyruvate to malate, fumarate and subsequently succinate pathways respectively. It is reported that engaging FRD and fumarate as the final electron acceptor keeps redox balancing constant by the conversion of NADH to NAD+ through the activity of NADH dehydrogenase II and transports fumarate to succinate resulting in the production of ATP via the reversible reaction of acetate and succinyl-CoA which ultimately leads reversibly to the succinate cycle (Kana et al, 2009). This proposal however has not been confirmed and is still under debate/ deliberation. 1.13 A KNOWLEDGE GAP A significant hurdle in the discovery and formulation of antitubercular drugs against the quiescent non-replicating state of M. tuberculosis has been the lack of understanding of the processes and mechanisms used by the bacteria to persist in the absence of significant growth. These processes have been linked to the respiratory chain. Limited information exists about the overall biology of respiration in M. tuberculosis. A critical discovery would be to uncover details which would lead to a clearer understanding 29 of the entire biology and kinetics of respiration in M. tuberculosis. Of necessity, is work shedding light on the mechanisms used for persistence and the physiological state assumed by these non replicating persisting bacteria. Could there be other targets within the respiratory chain that would further sensitize M. tuberculosis to the current scaffold of drugs or serve as targets for novel compounds altogether? Generally, attempts have been made to characterize some of the respiratory chain complexes, however, the extent to which these complexes modulate survival and direct evidence to validate their essentiality and potential as drug targets has been underexplored in M. tuberculosis or other pathogenic mycobacteria. It would be appropriate to extensively characterize these complexes and therefore determine their role and importance within the respiratory chain and in the persistence and survival of M. tuberculosis. 1.14 ‘THE GREAT WALL OF MTB’- TUBERCULOSIS DRUG DEVELOPMENT AND SCREENING Beyond the limited information available on the overall respiratory processes of M. tuberculosis is the challenge encountered in drug screening projects. Intriguingly, through out history, there has been a great fascination with and priority for walls. Ancient races built walls and so did medieval men. The arduous task of wall building is one activity that has proven essential and stood the test of time, for they have been a focus and requirement for border control and boundary demarcation. They have been a symbol of division and disparity, opposition and defence shutting out intruders; the unwanted and uninvited. 30 It is believed that among other armoury used by Mtb to survive within the harsh environment of the macrophage, the resistance offered by the cell wall is undoubtedly one of the most striking (Lars, 1974). The cell wall is rich in peptides, sugars and particularly lipid content, specifically long fatty acids referred to as mycolic acids. This wall is extremely hydrophobic, forming a very strong permeability barrier and making the cell impervious to gram staining and to many antimicrobial agents. It is also highly resistant to desiccation. The core of the wall consists of peptidoglycan linked to arabinogalactan (AG) which is cross linked to the mycolic acids, forming the mycolyl-AG-peptidoglycan complex (MAPc) (Lars , 1974). These mycolic acids are linked to cell surface glycolipids to the outside of the cell. Another important component of the cell wall is lipoarabinomannan (LAM) (Fig. 1.3) The cell wall of mycobacteria has been the most challenging barrier for most drug discovery and development efforts. One major question largely asked in recent antimycobacterial drug discovery projects has been exactly how to turn potent bacterial inhibitors into compounds that can penetrate the extremely impermeable cell wall (Koul et al, 2011). a b Fig 1.8 Fig 1.9 31 Fig 1.3 a. M. tuberculosis cell envelope; b. Comparison of M. tuberculosis cell wall with gram negative and positive envelopes of bacteria. Adopted from (http://people.oregonstate.edu/~mahmudt/pictures/Mycobacterium cell envelope.jpg; Ehlers, 1993; McNeil and Brennan, 1991; Minnikin, 1991; Nikaido , 1994) If the resistance posed by the cell wall of M. tuberculosis were overcome in drug development and screening projects, as seen in the use of whole cell assays, possibly essential parts of the cell shielded by this wall which could be potentiated as novel targets and/or sites of action for novel compounds or existing compounds could be reached. Small molecules that could specifically act on these targets could then be designed and later optimized into forms much easily taken up by the bacteria. Current suggestions to help solve this problem of cell wall impermeability in antibacterial drug discovery and screening projects include the development of multi-target pathway screens to search for compounds blocking validated metabolic or signalling pathways (Koul et al, 2011). Fortunately for man and unfortunately for M. tuberculosis, within its cell membrane, are enzymes absolutely necessary for the survival of M. tuberculosis. The respiratory chain enzymes whose activities eventually lead to the production of energy to drive the various cellular processes and without which cells eventually die are found in the bacterial membrane. Considering how thick the cell wall of M. tuberculosis is, how do we succeed in penetrating it enough to reach these respiratory enzymes and thus be given the opportunity to study them with the hope of identifying and validating targets? In an attempt to try and overcome this obstacle, the answer has been to grow cells in 32 conditions mimicking the host microenvironment and to develop a respiratory membrane vesicle assay with these cells. Membrane vesicles (MVs) are formed when minute portions of the membrane bulge away from the cell, pinch off and are shed. They are characteristically soluble material surrounded by insoluble material. A feature peculiar to MV secretion is that it makes it possible for the release of bacterial lipids, membrane proteins and many other insoluble components. Again, the proteins or enzymes associated with them are postulated as having biological activity. Through MVs, bacteria are able to increase the sphere of their metabolic influence because these secretions have the ability to perform specific functions including packaging small molecules for signalling (Mashburn and Whiteley, 2005) as well as proteins associated with virulence (Mashburn et al, 2008; Schooling and Beveridge, 2006; Kuehn and Kesty, 2005). The nail is hit right on the head when MVs are put in right context and likened to ‘a Swiss army knife’ (Shetty et al, 2011), with its vast array of multitask abilities due to the amazing versatility these vesicles show in carrying out various activities. Membrane vesicle release has been found conserved in M. tuberculosis H37Ra, H37Rv, M. bovis BCG, M. kansasii, M. avium, M.smegmatis and M. phlei (Fig 1.4). 33 Fig 1.10 Fig 1.11 Fig. 1.4 Mycobacteria produce membrane vesicles during intracellular infection of macrophages in vitro and in vivo. TEM showed the release of MVs in BCG(A/C) and in Mtb (B/D) in vitro.A similar release of MVs was seen within infected mice macrophages (E/F). (Adapted from Prados-Rosales et al, 2011) In vitro, MVs are generally extracted and separated from cell-free culture supernatants by ultra-centrifugation, usually 40,000x g or more, separating them from all other debris within the supernatant (Kulp and Kuehn, 2010). One interesting discovery reported about MVs from experimental work is that they are not merely products of cell lysis. SDS-PAGE profiles revealed that they were made up largely of outer membrane proteins (Hoekstra et al 1976; Kato et al, 2002; Loeb and Kilner, 1979), among others such as periplasmic proteins. Because they lack the cell wall but carry components of the cell membrane showing 34 biological activity, this makes them particularly promising candidates for studying membrane proteins using a pathway based approach in target discovery and drug screening. In light of promising new developments in antitubercular drug discovery shining the spotlight on the respiratory pathway as an underexplored source of targets, and based on the discovery of two potent drugs in clinical trials for M. tuberculosis both respiratory chain inhibitors as previously discussed, it would be exciting and promising, if membrane vesicles could be shown to posses major components of the respiratory chain and used to screen compound libraries for respiratory chain inhibitors (Koul et al, 2011, ). 35 1.15 OBJECTIVES OF THE PRESENT STUDY In order to understand the potential and scope of using mycobacterial respiratory complex genes/proteins for drug discovery purposes, it is very important to understand the respiratory biology of mycobacteria. Hence, in the current study an in-depth functional analysis of mycobacterial respiratory complex genes will be undertaken using various bioinformatics, microbiological and molecular biology tools. The specific objectives of the present study include: 1) Performing a bio-informatics analysis of respiratory gene complexes within major species of mycobacteria. 2) Determining the importance of various respiratory complex genes under nutrient-rich and nutrient starved aerobic conditions, since M. tuberculosis is known to be resistant to most drugs during Non-Replicating Persistence phase (NRP) caused by nutrient limiting-conditions. 3) Developing an assay for the screening of respiratory membrane vesicles and identification of membrane inhibitors. 36 CHAPTER 2 2.0 MATERIALS AND METHODS 2.1 MATERIALS 2.1.1 MEDIA AND MEMBRANE VESICLE EXTRACTION Middlebrook 7H9, Albumin Dextrose Saline (ADS), Glycerol (Sigma), Middlebrook OADC Enrichment (Roche), Middlebrook 7H11 Agar, Phosphate Buffered Saline (PBS) (Gibco), Bovine Serum Albumin Fraction V (Roche), Teen 80 (Sigma-Aldrich), Sodium Chloride (Sigma-Aldrich), Lysozyme (Sigma-Aldrich), Dextrose (Merck), Adenosine diphosphate (ADP) (Merck), Potassium dihyrogen phosphate (Pi) (Merck), reduced Nicotinamide Adenine Dinucleotide (NADH) (Roche Applied Science), Complete-EDTA free Protease Inhibitor Cocktail (Roche Applied Science), Dnase 1 (Invitrogen), 3-(N-morpholino)propanesulfonic acid (MOPS) (Sigma), 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES) (Sigma), Magnesium Chloride (Sigma), Sodium Hydroxide (Sigma), Potassium Hydroxide (Sigma), Cell Titer-Glo Luminescent Cell Viability Assay (Promega), BCA Protein Assay Kit (Thermo Scientific), milli-Q water (neutral) , 96-well round and flat bottom plates (Nunc), Spectrophotometer, 500 ml Roller bottles (Corning Costar), conical flasks, Duran bottles, Corning Costar white ½- 96 well plates (SciMed (Asia) Pte. Ltd., Autoclave, French pressure cell (Thermo Electron). 2.1.2 ANTIBIOTICS Antibiotics used in M. bovis BCG MIC50 experiments were Rifampicin (RIF)(Sigma), Streptomycin (STREP)(Sigma), Moxifloxacin (MOXI)(Sigma) and Isoniazid (INH) (Sigma). 37 Antibiotics used in M. bovis BCG and M. tuberculosis H37Rv wild type and mutant MBC experiments were afore mentioned drugs including Para-Aminosalicylic Acid (PAS) (Aldrich) in M. bovis BCG and M. tuberculosis H37Rv and Cycloserine (Sequoia Research Products) in M. bovis BCG. 2.2 METHODS 2.2.1 PREPARATION OF MIDDLEBROOK 7H9 COMPLETE MEDIA One litre of growth media was made by weighing out 4.7g of 7H9 Middlebrook powder into a conical flask and dissolving in 900 ml of milli-Q water. A 100 ml of ADS, 4 mL of 50% glycerol and 2.5 mL of 20% Tween 80 was added to the Middlebrook solution and mixed. The solution was then sterile filtered using a 0.22µm pore filter within the Biosafety hood into a sterile bottle. To check for sterility, the solution was incubated at 37⁰C overnight. 2.2.2 PREPARATION OF MIDDLEBROOK 7H11 AGAR PLATES Agar plates were made by weighing into and dissolving 10.5g of 7H11 Middlebrook in 500ml Duran bottles containing 475 mL of milli-Q water. A 5 mL volume of 50% glycerol was then added after which the solution was autoclaved at 121⁰C for 10 minutes. After autoclaving, the solution was cooled to about 55⁰C and 50 mL of OADC enrichment media at room temperature (25⁰C) was added. Twenty-five millilitres of agar was poured quickly into each full plate while 6 mL of agar was poured into each quadrant of a quadrant plate. The plates were incubated at 37⁰C overnight to check for sterility and were later stored at 4⁰C if found sterile. 38 2.2.3 PREPARATION OF ALBUMIN-DEXTROSE-SALINE (ADS) A litre of ADS was made by weighing out 50g of BSA Fraction V, 8.1g of Sodium Chloride and 20g of Dextrose. The components were sequentially dissolved in milli-Q water within a 1 Litre (L) conical flask. Each component was allowed to dissolve completely before adding the next ingredient. The solution was then brought up to a final volume of 1 L, sterile filtered within the Biosafety hood and incubated at 37⁰C overnight for contamination check. 2.2.4 PREPARATION OF 20% TWEEN 80 For a litre of 20% Tween 80 solution, 216g of Tween 80 was weighed into a glass beaker and dissolved in 800 ml of milli-Q water on a stirrer with gentle heating. The solution was sterile filtered and stored at room temperature away from light. 2.2.5 PREPARATION OF 0.05% TWEEN 80 PBS Five hundred millilitres of 0.05% Tween 80 PBS was made by adding 1.25 mL of 20% Tween 80. The solution was sterile filtered and stored at 4⁰C. 2.2.6 PREPARATION OF 50% GLYCEROL For the preparation of a litre of 50% Glycerol, 500ml of glycerol was poured into a glass beaker of appropriate volume and dissolved in 500ml of milli-Q water. The solution was sterile filtered and stored at room temperature. 39 2.3 BACTERIAL STRAINS Strains used were M. bovis BCG Pasteur 1173P2 Wild type (WT), M. tuberculosis H37Rv Wild type, M. bovis BCG Pasteur 1173P2 mutants generated prior to the study by knocking out genes within the respiratory chain responsible for the production of reduced Nicotinamide Adenine Dinucleotide (NADH) quinone oxidoreductase I (NDH-1 or NUO-A-N), Fumarate reductase (FRD), Succinate dehydrogenase (SDH), Nitrate reductase (NAR) and the putative gene Rv247c/BCG0285c as well as corresponding M. tuberculosis H37Rv mutants NDH-1, FRD and SDH (ANNEXE 1). Wild type M. bovis BCG and M. tuberculosis strains were referred to at WT while succinate dehydrogenase, fumarate reductase, nitrate reductase, NADH quinone oxidoreductase I and the putative gene Rv247c/BCG0285c were represented by SDH, FRD, NAR, NUO and BCG 0285c respectively. 2.4 GROWTH CONDITIONS AND PROCEDURES Growth and survival studies were performed under nutrient rich aerobic conditions in Middlebrook 7H9 media. A milliliter (1mL) of M. bovis BCG wild type and mutant cells were grown in 490cm2 roller bottles (Corning) containing 50 mL of nutrient medium (Middlebrook 7H9) at 37⁰ C and slow rolling. Optical density readings of the bacterial cultures were taken at a wavelength of 600 nm (OD 600) with a Spectrophotometer. Readings were taken over a period of 14 days for M. bovis BCG wild type and mutants and were indicative of the level of bacterial growth, cell division and the increase or decrease in bacterial cell numbers and were taken. 40 In order to determine the Coliform Forming Units (CFU’s) per time point read, a ten-fold serial dilution of 200µL of the sample was done. 50 µl of the dilutions were plated on each agar-containing quadrant of a 25mL quadrant plate. Further growth studies were conducted with wild type and mutant strains of M. bovis BCG as well as M. tuberculosis H37Rv wild type and mutants under nutrient starved conditions (Loebel Model). Cells were grown in 50 mL of Phosphate Buffered Saline (PBS) containing 0.05% Tween 80 at 37⁰ C. Optical density readings were taken for these cells over 28 days. Ten-fold serial dilutions of samples at each time point were made with 50µL of dilutions at each time point plated on 7H11 Middlebrook Agar to determine the number of Coliform Forming Units (CFU’s). 2.5 MINIMUM INHIBITORY CONCENTRATION DETERMINATION Drug master plates were made by the preparation of 100 times concentrations of the known minimum inhibitory concentrations of each drug used in drug sensitivity test experiments after which 2 fold serial dilutions were made in a 96 well plate till the least concentration of each drug was attained. Drug plates were stored at 4°C. For Minimum Inhibitory Concentration Experiments (MIC50), a millilitre each of frozen working stocks of each strain at OD600 of approximately 1.0 was inoculated into roller bottles containing 50mL of 7H9 Mibblebrook media. Each culture was incubated at 37°C till a growing OD600 of 0.2-0.3 was attained. A 96 well plate was spotted with 2µL of drugs per well at the pre-determined concentrations. 41 Each culture was resuspended in fresh 7H9 Mibblebrook media and brought to an OD600 of 0.02. Approximately 20mL of each culture of strains at 0.02 OD600 was then added to the 96 well plates containing drugs and incubated under humidified conditions at 37°C for 5 days in Lock-n-Lock boxes. After 5 days the OD600 readings were taken for each culture using a spectrophotometer. 2.6 LOEBEL CIDAL STUDIES Drug master plates were made by the preparation of 100 times concentration of each drug at experimental values assumed for non-replicating persistent cells. Drug plates were stored at 4°C. A millilitre (1mL) each of frozen working stocks of each strain at OD600 of approximately 1.0 was inoculated into roller bottles containing 50ml of 7H9 Mibblebrook media till an OD of 0.1-0.2 was attained. The culture was then centrifuged to recover pellets, washed twice with 0.05% Tween 80 PBS and resuspended in another 50mL volume of 0.05% Tween 80 PBS at an OD of approximately 0.1. This suspension was incubated at 37°C for 14 days in M. bovis BCG and 15 days in M. tuberculosis. Ninety-six (96) well plates were spotted with 4µL of drugs at the pre-determined concentrations. Two hundred microlitres (200µl) of each culture of strains at day 14 for M. bovis BCG and day 15 for M. tuberculosis was then added to the 96 well plates containing drugs and incubated under humidified conditions at 37°C for 5 days in Lock-n-Lock boxes. After 5 days, Minimum Bactericidal Concentrations (MBC) were determined by plating culture on 42 Middlebrook 7H11 agar for Coliform Forming Unit determination. 2.7 ATP ASSAY AND MEMBRANE VESICLE BUFFER PREPARATION Five hundred millilitres each of Membrane Vesicle and ATP assay buffer were made. In the preparation of both the membrane vesicle and ATP assay buffers, 5.25g of MOPS was weighed out into a 500 mL conical flask and dissolved in 350 ml of milli-Q water. Specifically in the preparation of the membrane vesicle buffer (50mM MOPS- NaOH, pH 7.5+ 2mM MgCl2), 1mL of 2 mM MgCl2 was added to the 5.25g of MOPS dissolved in 350 ml of milli-Q water with the pH adjusted to 7.5 by adding NaOH (drop by drop) while 5mL of 2mM MgCl2 was added to the other 5.25g of MOPS dissolved in 350 mL with pH adjusted to 7.5 as well by adding NaOH drop by drop to make the ATP assay buffer (50mM MOPSNaOH , pH 7.5 + 10mM MgCl2 ). After adjusting the pH of the solutions, each buffer solution was poured into a measuring cylinder and topped up with milli-Q water to a final volume of 500mL. For the preparation of buffer for the extraction of M. bovis BCG membrane vesicles, 100mL of 1M HEPES was made by weighing out 23.83g of HEPES and dissolving this in 50mL of milli-Q water. The pH of the 50mL HEPES solution was then balanced with KOH until a pH of 7.5 was attained. The resulting HEPES-KOH solution was then topped up to 100mL with milli-Q water. Of the 1M HEPES-KOH made, 10mM of solution was made by the addition of 10mL of the 1M HEPES-KOH solution to 990ml of milli-Q water. To make 200mL of 5mM MgCl2 required for extraction, 1mL of 1 M MgCl2 was added to 190mL of milli-Q water while 43 2.4mL of the 1 M MgCl2 solution was added to 197.6mL of milli-Q water to make the other 12mM solution required. The 10% v/v of glycerol required for extraction and storage of the vesicles was made by the dissolution of 10mL of 100% glycerol in 90mL of milli-Q water (neutral). 2.8 VESICLE AND RESPIRATORY ENZYME ASSAY DEVELOPMENT 2.8.1 CULTURE OF M. smegmatis AND M. bovis BCG A 2mL volume of M. smegmatis seed stock (Strain MC2 155) was inoculated into 600 mL of Difco TM Middlebrook 7H9 broth supplemented with 0.2% v/v glycerol, 0.05% Tween 80 and 10%v/v ADS in a 1L shaker conical flask and incubated overnight at 37°C with shaking at 200 rpm. Culture of M. bovis BCG was similar to M. smegmatis; however cells were grown in roller bottles at 37°C. 2.8.2 PELLET PREPARATION At an optical density absorbance of approximately 0.4 read at 600nm, the bacterial culture was centrifuged at 1500 rcf for 10 min at 4°C. The supernatant was discarded and the pellet cells stored at -80°C. 2.8.3 MEMBRANE VESICLE EXTRACTION FROM M. smegmatis PELLET CELLS 10g (wet weight) of M. smegmatis pellet cells was resuspended in 20mL of MOPS membrane 44 preparation buffer. Complete EDTA-free protease inhibitor cocktail (1 tablet per 20 ml) and 2.4 mg/mL of lysozyme were then added. The suspension was stirred at room temperature for approximately 45 minutes after which 300µL of 1 M MgCl2 and 50µL of Dnase 1 were added. The suspension was stirred for a further 15 min at room temperature. All subsequent procedures were performed on ice. Cells were broken by 3 passages through a pre-cooled French pressure cell at 25000psi. The suspension collected was centrifuged at 4200 rcf for 20 min at 4°C. The supernatant was then centrifuged further at 45000 rcf for an hour at 4°C. After this centrifugation step, the supernatant was discarded and the pellet resuspened in 1.5mL of membrane preparation buffer supplemented with 15% v/v glycerol, snap-frozen in 50µL aliquots and stored at -80°C. 2.8.4 MEMBRANE VESICLE EXTRACTION FROM M. bovis BCG PELLET CELLS 10g (wet weight) of M. bovis BCG pellet cells was resuspended in 20mL of the 10mM HEPES-KOH membrane preparation buffer (pH 7.5). Complete EDTA-free protease inhibitor cocktail (1 tablet per 20 ml) and 20 mg/mL of lysozyme were then added. Volumes of 300µL of 5 mM MgCl2, 400µL of 10% glycerol and 80µL of 100 units Dnase 1, Amplification grade were added. Another 300µL of 12mM MgCl2 was then added. The suspension was stirred for 1 hour at 37°C in a shaker incubator. All subsequent procedures were performed on ice. Cells were broken by 3 passages through a pre-cooled French pressure cell at 25000psi. The suspension collected was centrifuged at 6000g for 20 min at 4°C. Pellets were subsequently resuspended and centrifuged twice successively at 6000g for 20 min at 4°C. After the final centrifugation at 6000g for 20 minutes, the supernatant was centrifuged further at 70000g for 45 2 hours at 4°C. After this centrifugation step, the supernatant was discarded and the pellet resuspened in 1 mL of the 10mM membrane buffer supplemented with 10% v/v glycerol and 200µL of 5mM MgCl2, snap-frozen in 50µl aliquots and stored at -80°C. 46 47 Fig 2.1 Membrane vesicle extraction procedure 2.9 PROTEIN QUANTITATION The Pierce bicinchoninic acid protein assay kit was used to verify the presence and quantity of protein present per aliquot. A series of dilutions of known concentration referred to as the standards were prepared from BSA protein solutions and assayed alongside the protein of interest, in this case, the membrane vesicle suspension referred to as the unknown. The microplate procedure using a Corning Costar 96-well plate was used and the working range for protein concentrations was from 20-2000µg/mL. The total volume of working reagent required was determined based on the formulae: (# of standards + # of unknowns)*(# of replicates)*(volume of working reagent per sample) Fifty parts of BCA Reagent A was mixed with 1 part of BCA reagent B. In this quantitation process, 9 standards and 3 unknowns were used and the experiment was duplicated. Varying concentrations of BSA were made per well through a series of serial dilutions in membrane preparation buffer to attain standards. To all the standard dilutions and to the unknowns, 100µL of working reagent was then added. The plate was mixed on a plate shaker for 30 seconds and incubated at 37°C for 30 minutes. After incubation, the plate was cooled at room temperature and the absorbance subsequently measured at 562nm. Protein concentrations were determined by plotting colour response curves for BSA and M. smegmatis as well as M. bovis BCG extracts. 48 Known standard (BSA) concentrations were extrapolated to determine the unknowns (M. smegmatis and M. bovis BCG). 2.10 RESPIRATORY MEMBRANE VESICLE ASSAY After the quantitation of proteins, an ATP synthase assay was run. The enzyme assay was performed in a final volume of 100µL per well of a Corning Costar white ½- 96 well plate. The final membrane concentration was 5µg/mL while substrate concentrations for NADH, ADP, and Pi were 1 mM, 10µM, and 250µM respectively. The experiment was performed in replicates and repeated on other occasions. Background was determined by the addition of 500nL of the known ATP synthase inhibitor TMC 207 (R207910) at 1µM in 90% (v/v) DMSO/Water to the last 48 wells as control. A 25µL volume of M. smegmatis membranes diluted to 5µg/mL was then added to each well. 25µL of the substrate solution of NADH, ADP and Pi was added to the wells at time intervals of 30, 20, 10, 5 and 0/1.5 minutes. The plate was incubated at room temperature for 30 minutes after which 50µL of Cell TiterGlo was added to each well. Plate counting was subsequently done via a Beckman Coulter DTX at luminescence mode with a read time of 0.01ms. 2.11 STATISTICAL ANALYSIS Statistical analyses were performed via GraphPad Prism5. 49 The one-way analysis of variance (ANOVA) test was done to assess the levels of significance in differences of growth between wild type and mutant M. bovis BCG and M. tuberculosis strains. This statistical test was used to determine whether the mean growth rate was equal for wild type and all mutants studied in growth experiments. This test statistic was also used in order to limit error (Type I error- claiming what is not and Type II error- rejecting what is) since wild type and five other mutants representing independent samples were studied resulting in a comparison of more than two mean growth rates. The Bonferroni’s Multiple Comparison tests was also performed to further assess and control for the family wise error rate in the multiple comparison of wild type and the mutants studied. For MIC experiments, the unpaired t-test was used to determine the levels of significance in differences of growth rate of wild type and mutants (independent samples) when exposed to drugs at different concentrations. The unpaired t-test was used because samples compared at a time were independent and only two in number; with wild type and one mutant at a time, being observed to determine the difference in growth means in the presence of drug. 50 CHAPTER 3 3.0 RESULTS “No other bacterial group has received quite the same flattering attention or yielded in return so rich a harvest of chemical knowledge; yet no other group has more stubbornly resisted all efforts to expose the intimate secrets of its metabolism” (Edson, 1951) 3.1: IN SILICO BIOINFORMATIC ANALYSIS OF MAJOR GENES WITHIN THE RESPIRATORY CHAIN COMPLEXES OF THE MYCOBACTERIA Mycobacterium tuberculosis although an obligate aerobe, has the ability to survive under hypoxic conditions. This flexibility has been implicated as a major reason for bacterial survival within the human host under many different environmental conditions and stresses such as oxygen tension and varying electron acceptors to mention a few (Boshoff and Barry, 2005). In a bit to answer the question about the exact genes that might be the most essential for the survival of the Mycobacteria, one can look at M. leprae which seems over the many years of its existence after diverging from its most recent common ancestor M. marinum, to have evolved a reduced genome made up of numerous pseudogenes. A close look at this unique genome in comparison with other economically important Mycobacteria such as M. tuberculosis, causative organism of tuberculosis and M. ulcerans which causes Buruli ulcer, another extremely painful and debilitating disease reveals a set of genes which seem to have been conserved across these Mycobacterial species, even among other non-pathogenic Mycobacteria like M. smegmatis. 51 Mycobacterium leprae possesses a terminally un-branched respiratory chain which solely uses NADH and a proposed succinate as its electron donors while using O2 as its only electron acceptor. It has been suggested that these complexes seen in M. leprae represent the minimal set of genes therefore required by the mycobacteria for their survival. (Kana et al, 2009). Even though this should not be considered as conclusive, it gives some insight into the set of genes that might be extremely essential for survival across all or most species. The sequencing of the complete genomes of pathogens has made it possible to acquire detailed information on genes required for the survival of various organisms. This chapter attempts to shed some light on respiratory complexes from a more detailed perspective by a systematic in silico comparative genomic analysis encompassing an assessment of the presence or absence of specific complexes within the genome of major mycobacterial species, their levels of genetic identity and conservation as well as some proposed or known functions so far, despite the extremely limited characterization of these individual complexes within M. tuberculosis. The current analysis mainly focuses on the NADH dehydrogenases, succinate dehydrogenases, fumarate reductases and nitrate reductases in various mycobacteria. The hope is that the results of this analysis would serve as a prelude to the rational behind further experiments performed during this project in an attempt to make a contribution to the characterization of respiratory enzyme complexes within M. tuberculosis and in the long run, most excitingly, to the discovery of novel drug targets. 52 3.1.1: COMPLEX I: REDUCED NICOTINAMIDE ADENINE DINUCLEOTIDE (NADH) DEHYDROGENASE I NADH dehydrogenases, NDH (NADH: menaquinone oxidoreductases): This is the first complex within the electron transport chain and is the point of entrance of electrons into the chain from the products of the Krebs or TCA cycle. This complex reduces NADH to NAD+ which is then recycled. The enzyme drives homeostasis by regulating the levels of NADH and NAD+ and ensuring that there is a balance in their proportions at any given point in time. NADH dehydrogenases in M. tuberculosis are three in number and are the types I NDH and II NDH (ndh and ndhA). The type I NDH has 14 subunits and is rotenone sensitive. It consists of 14 genes that are represented as nuoABCDEFGHIJKLMN and its reduction and oxidation is driven by a transfer of protons. The types II NDH’s however, are single subunits and do not operate by proton transfer. There seems to be diversity within the number of copies of type II NDH possessed by different mycobacteria. M. smegmatis and M. leprae have been reported to have a single ndh while M. marinum has three (Kana et al, 2009). It has also been reported that ndh, one of the type II NDHs is the most important for survival of the mycobacteria due to studies that showed their extreme relevance (Rao et al, 2008, Sasseti et al, 2003, Miesel et al, 1998) and also due to the fact that within the genome of M. leprae, which has been severely reduced, this type II NDH is the only conserved NDH with functions. (Velmurugan et al, 2007). The current study focused on the type I NDH thus further analysis and experimental work was based on this operon. Comparative analysis of Type I NDH using various genomes namely M. tuberculosis, M. bovis BCG, M. leprae, M. ulcerans M. smegmatis and M. marinum was carried out (Fig 3.1). 53 All the mycobacteria analyzed except for M. leprae contained all the nuoA-N operon genes. M. leprae only had nuoN and this, as a pseudo-gene. MYCOBACTERIUM TUBERCULOSIS MYCOBACTERIUM BOVIS BCG PASTEUR 1173P2 MYCOBACTERIUM LEPRAE MYCOBACTERIUM ULCERANS MYCOBACTERIUM MARINUM MYCOBACTERIUM SMEGMATIS 2140000 nuoN nuoM 2143000 nuoL nuoK nuoJ nuoI nuoH nuoG Fig 3.1 Subunits of NADH dehydrogenase 1 present in selected mycobacteria 54 nuoF nuoE nuoD nuoC nuoB nuoA 3.1.2 COMPLEX II: SUCCINATE DEHYDROGENASE (SDH) Succinate dehydrogenase is the second complex (complex II) of the electron transport chain. The complex is also referred to us Succinate-coenzyme Q reductase (SQR) (Rutter et al, 2010) and is classified as succinate menaquinone oxidoreductases in M. tuberculosis. It contributes immensely to the survival of organisms within which it is found and plays active roles in the Krebs cycle (Tricarboxylic Acid Cycle/ Citric Acid Cycle) and in aerobic respiration. SDH performs the task of catalyzing the oxidation of succinate to fumarate within the matrix of the plasma membrane in prokaryotes. It is covalently and thus tightly bound to Flavine adenine dinucleotide (FAD), a prosthetic group (Rutter et al, 2010). In the oxidation of succinate to fumarate, two electrons are removed by FAD from succinate resulting in a reduced SDH-FADH2 complex. This reaction occurs during the Krebs cycle and under aerobic conditions. The electrons are then transferred to menaquinone in mycobacteria, eventually reducing menaquinone to menaquinol. The reduction is independent of proton transfer and the electrons carried by menaquinol are eventually transferred to the terminal electron acceptor via cytochrome bc1-aa3-type cytochrome c oxidase super complex (Kana et al, 2009) Succinate dehydrogenase (SDH) and fumarate reductase (FRD) share close similarities in terms of their activity and structure. They catalyse their reactions in opposite directions. SDH catalyzes the oxidation of succinate to fumarate and passes on electrons to quinone (Cecchini, et al, 2003; Lancaster and Kroger, 2000). Conceptually, SDH is uniquely arranged as a trimer and can be visualized as a mushroom. It has been proposed that this unique trimer “build-up” 55 in eukaryotes and some prokaryotes serves a functional purpose because of the observed compactness of the monomers together across various species (contact surface- 1242 Å2) (Yankovskaya et al, 2003). The trimers are same and are composed of three protomers (composed of three or four subunits). The subunits within a protomer are A, B, C and/or D. Structural studies in E. coli and some other bacteria give insight into the architecture of the respiratory complexes and show that mitochondrial and most bacterial SDH comprise two hydrophilic and hydrophobic subunits each. The hydrophilic subunits identified are a flavoprotein and iron- sulphur protein subunits; sdhA and sdhB respectively. The hydrophobic subunits, sdhC and sdhD which possess one heme b on the other hand, serve as membrane anchors and generously provide the site for ubiquinone (Yankovskaya et al, 2003), or menaquinone (in Mycobacteria) binding. In more detail, sdhA contains the FAD cofactor and the substrate-binding site. The FAD cofactor serves as the initial electron acceptor. The sdhB subunit possesses three iron-sulphur clusters designated [2Fe-2S], [4Fe-4S] and [3Fe-4S] and is found between subunit A and the cell membrane. The iron sulphur clusters are reportedly less than 14 Å from each other and the 2Fe-4S cluster is closest to the membrane. These clusters are responsible for transferring electrons to the membrane (Kana et al, 2009). Among species, SDH subunits differ and could have none to a few cytochrome b-types including a single or couple of quinone binding sites. Comparative analysis of SDH using various genomes namely M. tuberculosis, M. bovis BCG, M. leprae, M. ulcerans M. smegmatis and M. marinum was carried out (Fig 3.2). All the mycobacteria analyzed contained all the sdhCDAB operon genes; although in M. smegmatis sdhD was not clearly annotated/found. 56 MYCOBACTERIUM TUBERCULOSIS H37V MYCOBACTERIUM BOVIS BCG PASTEUR 1173P2 MYCOBACTERIUM LEPRAE MYCOBACTERIUM ULCERANS MYCOBACTERIUM MARINUM 57 MYCOBACETERIUM SMEGMATIS Fig 3.2 Subunits of Succinate Dehydrogenase present in selected mycobacteria 3.1.3 FUMARATE REDUCTASE (FRD) At the end of the Krebs cycle, fumarate is oxidized to malate and oxaloacetate with the latter beginning another cycle by forming citrate after coming together with acetyl-CoA. Succinate is eventually regenerated with a few other by-products being released such as isocitrate (Kana et al, 2009). Fumarate reductase catalyzes the reduction of fumarate to succinate while removing electrons from quinol in the process. It is known to have the ability to serve as a terminal electron acceptor usually under anaerobic conditions and during hypoxia (Cecchini et al, 2003; Van Hellemond et al, 1994). FRD and SDH enzyme as stated earlier are very similar in their activity and architecture. They are hypothesized to have diverged from the same common ancestor (Kana et al, 2009). While the protomers of the subunits of SDH form trimers, FRD subunits form dimers consisting of two identical protomers. 58 Comparative bio-informatic analysis of FRD operon showed that they were present in M. tuberculosis and M. bovis BCG, but were conspicuously absent and or not annotated in other Mycobacteria (Fig. 3.3). MYCOBACTERIUM TUBERCULOSIS H37V MYCOBACTERIUM BOVIS BCG PASTEUR 1173P2 Fig. 3.3 Subunits of Fumarate Reductase present in selected mycobacteria 3.1.4 PUTATIVE ENZYME (Rv0247c/BCG0285c) In M. tuberculosis, two diverse SDH enzymes have been proposed. One has four subunits and is formed by sdhCDAB as previously discussed. The other is believed to be a putative enzyme formed by RV0247c- RV0249c operon and its complements in other mycobacteria as shown below (Fig 3.4). This operon can be found in M. tuberculosis as well as other mycobacteria including M. bovis BCG, M. smegmatis and M. leprae, although it is annotated as a pseudogene in M. leprae. A query of interest is why M. tuberculosis seems to have two putative SDH enzymes found at different regions of the membrane. It has therefore been proposed that this enzyme encoded by Rv0247c-Rv0249c might be essential. (Kana et al, 2009). 59 Rv0247c-Rv0248c- Rv0249c MYCOBACTERIUM TUBERCULOSIS ML2560-ML2559-ML2558 BCG0285c- BCG0286c-BCG0287c MYCOBACTERIUM BOVIS BCG PASTEUR 1173P2 MSMEG0417c-MSMEG0418c-MSMEG0419c MYCOBACTERIUM LEPRAE MYCOBACTERIUM SMEGMATIS 496745 492595 MSMEG 0416 MSMEG 0420 MSMEG 0417 MSMEG 0418 MSMEG 0419 Fig. 3.4 Subunits of the Rv0247-9c present in selected mycobacteria 3.1.5 NITRATE REDUCTASE (NAR) NarGHJI is a nitroreductase bound to the membrane of the bacteria. This enzyme is a molybdoprotein. narG together with narH are attached to narI, the membrane anchor while NarJ has been found to be necessary for inserting the molybdenum cofactor into the nitroreductase (Bott et al, 2003). This nitroreductase catalysis the reduction of nitrate to nitrite, and in the process takes up two protons from the cytoplasm, while releasing two. NarGHJI has been shown to confer anaerobic nitroreductase ability on E. coli, M. smegmatis and M. bovis BCG and the nitrate reductase activity seen in M. tuberculosis has been strongly suggested to be due to narGHJI. 60 This enzyme has further been suggested to be responsible for redox balancing and energy metabolism during non replicating persistence. (Sohaskey et al, 2003, Weber et al, 2000). Lenaerts, et al (2007) proposed that M. tuberculosis exploits the ability to reduce nitrate to persist under low oxygen conditions and/or nitrate abundance and this proposal is supported by the phenomenon that apparently, NO produced by the host cell in defence to this pathogen ends up becoming a source of nutrients for the bacteria upon decomposition (MacMicking et al, 2000). M. ulcerans and M. leprae have, however, barely retained their genes for nitrate reduction (Cole et al, 2001) (Fig. 3.5). Bio-informatic analysis of nitrate reductase genes across various mycobacterial strains clearly showed that this complex was conserved in both fast growing (M. smegmatis) and slow growing (M. tuberculosis and M. bovis BCG) mycobacteria. These genes are pseudogenes and non-functional in M. leprae (Fig. 3.5). MYCOBACTERIUM TUBERCULOSIS MYCOBACTERIUM BOVIS BCG PASTEUR 1173P2 61 MYCOBACTERIUM LEPRAE MYCOBACTERIUM SMEGMATIS 5238965 5252403 MSMEG 5004 MSMEG 5012 narH narK2 MSMEG 5011 narX narG narJ MSMEG 5010 Fig. 3.5 Subunits of Nitrate Reductase present in selected mycobacteria 62 Fig. 3.6 Legend describing the coding sequences of the respiratory complex genes analysed in the selected Mycobacteria 63 3.2 RESPIRATORY COMPLEXES- THEIR IMPACT AND RELEVANCE FOR SURVIVAL UNDER VARIED GROWTH CONDITONS "Research is like fishing. One has to be persistent and have good luck to catch the 'fish.' 'Chance is always powerful.' Let your hook always be cast. In the pool where one least expects it... will be a fish." Ying Zhang (Guroff, 2007) Bioinformatic analysis revealed certain respiratory genes that had been conserved and lost within the various mycobacteria giving a hint on their relative levels of essentiality. The true picture of their functions and importance could, however, only be concluded on based on experimental evidence. Mutants generated within the respiratory chain of M. bovis BCG and M. tuberculosis alongside their wild type strains were studied under various conditions believed to be among the most encountered by the bacteria during infection, with the aim of making a contribution to their characterization and to potentially discovering vulnerable druggable targets. In this section, microbiological and physiological characterization of some of the respiratory complex genes under aerobic growing and nutrient starved non-growing conditions are presented. 3.2.1 CULTURE OF M. bovis BCG AND M. tuberculosis WILD TYPE AND MUTANTS IN VITRO 3.2.1.1 M. bovis BCG WILD TYPE AND MUTANTS UNDER NUTRIENT RICH AEROBIC CONDITIONS 64 Growth of M. bovis BCG wild type and mutant strains under nutrient rich conditions were observed over an average of 14 days (2weeks). Interestingly, there was no striking difference in growth between wild type and mutants (Fig. 3.6). The Wild type and mutants grew quite at par. Subsequently the one-way ANOVA and Bonferroni’s Multiple Comparison tests were performed via Graphpad Prism to substantiate these results. An assessment of the differences in growth between wild type and mutants were supportive of what was seen and produced a P value of 0.633 (significant if P < 0.05). CFU/TIME 9 WT NUO Log10 CFU/mL 8 NAR 7 6 5 4 3 0 5 10 15 TIME/DAYS CFU/TIME 9 Log10 CFU/mL WT 8 BCG 0285c 7 SDH 6 FRD 5 4 3 0 5 10 15 TIME/DAYS Fig. 3.7 Growth of M. bovis BCG under nutrient rich aerobic conditions 65 3.2.1.2 M. bovis BCG WILD TYPE AND MUTANTS UNDER NUTRIENT STARVED CONDITIONS (LOEBEL MODEL) After growing M. bovis BCG wild type and mutant strains under nutrient rich conditions and recovering data on their growth phenotype under these conditions, further work was done to determine how these mutant strains would fare under nutrient limiting conditions in comparison to wild type bacteria. Nutrient stress is one of the many conditions encountered by the bacteria within the host during infection especially within the granuloma and resulting CFU/TIME in non-replicating persistence of the bacteria. Log10 CFU/mL 8 WT NUO NAR 7 6 5 4 3 2 0 10 20 30 CFU/TIME TIME/DAYS 8 WT BCG 0285c SDH FRD Log10 CFU/mL 7 6 5 4 3 2 0 10 20 30 TIME/DAYS Fig. 3.8 Growth of M. bovis BCG wild type and mutant strains under nutrient starved conditions (Loebel model). 66 Generally, the comparison of growth patterns between wild type and mutant strains showed immense differences. Growth was observed over an average time period of 28 days under nutrient starved conditions. All mutants apart from nuoA-N showed a drastic attenuation in growth. The most severe was seen in mutants NAR and SDH followed by FRD and the putative enzyme (BCG 0285c equivalent of Rv0247c) (Fig. 3.7). SDH mutant showed consistent and significant reduction in colony forming units compared to wild type M. bovis BCG. By day 28 SDH showed a 3-4 logs reduction in CFU’s compared to wild type. A similar phenotype was also observed for NAR mutant strain, wherein at day 14, the mutant showed >4 log reduction in CFU compared to the wild type strain. Other two mutants namely FRD and BCG 0285c showed moderate attenuation of more than 1 log CFU reduction. To assess if the differences observed were statistically significant the one-way Analysis of Variance (ANOVA) and Bonferroni’s Multiple Comparison tests were performed via Graphpad Prism to consolidate the results obtained. Coherent with the findings, statistical tests performed showed that differences observed in growth were significant (p0.05). The degree of significance in differences seen in growth between wild type and mutants was further assessed by independently comparing wild type to the three mutants which showed much attenuation in growth (i.e. SDH, FRD, and BCG 0285c). The tests showed extremely highly significant differences in growth between WT and mutants SDH, FRD and NAR (p< 0.0001) while the analysis for the level of significance in growth between WT and NUO remained insignificant (p>0.05). 67 3.2.1.3 M. tuberculosis WILD TYPE AND MUTANTS UNDER NUTRIENT STARVED CONDITIONS (LOEBEL MODEL) Based on results from the M. bovis BCG wild type and mutant nutrient starvation studies, experiments were carried out in selected M. tuberculosis H37Rv mutants to assess growth in this organism as well. Growth was observed over an average time period of 28 days under the same culture conditions M. bovis BCG was exposed to. Results are shown below (Fig. 3.8). Log10 CFU/mL 9 8 WT NUO SDH FRD 7 6 5 0 5 10 15 20 25 30 TIME (DAYS) Fig. 3.9 Growth of M. tuberculosis H37Rv wild type and mutant strains under nutrient starved conditions (Loebel model). Consistent with data obtained from studies assessing growth attenuation within M. bovis BCG under nutrient starvation, growth of M. tuberculosis mutants were also attenuated in comparison to wild type. The growth of mutants SDH and FRD were most severely attenuated in comparison to the wild type strain while NUO retained a survival potential at par with wild type. Statistical tests (one-way ANOVA and Bonferroni’s Multiple Comparison tests) used to assess this data supported the findings (WT/SDH, p = 0.0091; WT/FRD, p = 0.0102; WT/NUO, p = 0.0643). 68 3.3 IN VITRO DRUG SENSITIVITY STUDIES USING M. bovis BCG AND M. tuberculosis WILD TYPE AND RESPIRATORY COMPLEX MUTANTS Since mutations in respiratory genes did not show any significant growth phenotype under nutrient-rich conditions, we further investigated the impact of bactericidal and static drugs on the growth of these mutants. Any perturbations to respiratory genes affect the redox balance within the bacteria, and most bactericidal drugs exert their action by interfering with redox balancing. Hence it was a query of interest whether the respiratory gene mutants would show sensitivity to any of the known anti-TB drugs. Wild type and mutant strains were thus exposed to different anti-TB drugs. 3.3.1 M. bovis BCG WILD TYPE AND SDH MUTANT DRUG SENSITIVITY UNDER NUTRIENT RICH AEROBIC CONDITIONS When wild type and the SDH mutant strains were exposed to Rifampicin at different concentrations, SDH showed high sensitivity with an IC50 about ten times lower than that observed in the wild type (Fig. 3.9). This was statistically significant with a p value of 0.02 (statistical analysis was performed using unpaired t test, Graphpad Prism). SDH mutants showed lower IC50 for all the anti-TB drugs tested (Moxifloxacin, Isoniazid and Streptomycin) compared to the wild type strain indicating that the SDH mutant had become sensitive to growth inhibition by mycobactericidal agents (Fig. 3.9). The shift in IC 50 was not statistically significant, for statistical tests conducted did not judge the difference between the group means as significant (Moxifloxacin; p=0.5186, Izoniazid; p= 0.7105 and Streptomycin; p= 0.188). 69 Fig. 3.10 M. bovis BCG wild type and SDH deletion mutant’s sensitivity anti-TB drugs namely, Rifampicin (RIF), Moxifloxacin (MOXI), Isoniazid (INH) and Streptomycin (STREP). 3.3.2 M. bovis BCG WILD TYPE AND FRD MUTANT DRUG SENSITIVITY UNDER NUTRIENT RICH AEROBIC CONDITIONS When wild type and FRD mutants were exposed to Isoniazid, mutant FRD showed significant sensitivity with an IC50 reduced to half that observed in the wild type strain (Fig. 3.13). 70 Statistical analysis performed showed significance for the difference between the group means with a p value of 0.0463. In the presence of Rifampicin, Moxifloxacin, and Streptomycin, IC50 values slightly shifted in comparison to wild type with the mutant (FRD) becoming further sensitive under drug pressure (Fig. 3.15, 3.15, 3.16). Statistical tests conducted however, did not show significant differences (Rifampicin, p= 0.297; Moxifloxacin, p= 0.5711; Streptomycin, p= 0.5438). 71 Fig. 3.11 M. bovis BCG wild type and FRD deletion mutant’s sensitivity anti-TB drugs namely, Rifampicin, Moxifloxacin, Isoniazid and Streptomycin. 3.3.3 M. bovis BCG WILD TYPE AND NUO MUTANT DRUG SENSITIVITY UNDER NUTRIENT RICH AEROBIC CONDITIONS To test if NUO mutant would show any sensitivity under drug pressure in comparison to wild type sensitivity, the drug susceptibility tests previously conducted in mutants FRD and SDH were repeated in this mutant. Mutants showed little or no sensitivity to the drugs they were exposed to and simply grew at par with wild type (Fig. 3.17). Statistical tests for the differences between the means of both groups for all drugs were insignificant (Rifampicin, p= 0.5124; Moxifloxacin, p= 0.5413; Streptomycin, p= 0.1113; Isoniazid, p= 0.3387). 72 Fig. 3.12 M. bovis BCG wild type and NUO deletion mutant’s sensitivity anti-TB drugs namely, Rifampicin, Moxifloxacin, Isoniazid and Streptomycin. 3.3.4 M. tuberculosis WILD TYPE AND MUTANT DRUG SENSITIVITY UNDER NUTRIENT RICH AEROBIC CONDITIONS In light of the results obtained for drug sensitivity tests performed on M. bovis BCG wild type and mutants which showed varied levels of sensitivity to the drugs they were exposed to, drug sensitivity tests were performed for M. tuberculosis as well to determine if a bigger and 73 clearer picture on sensitivity could be obtained. Based on previous knowledge on the sensitivity of M. bovis BCG under nutrient rich anaerobic conditions, M. tuberculosis wild type and mutant strains were exposed to drugs and RIF plated to investigate bactericidal activity by determining the colony forming units (CFU). Log10 CFU/mL 8 WT SDH 7 FRD 6 5 4 3 D0 D7 RIF 0.008 RIF 0.004 CONC/uM Fig. 3.13 M. tuberculosis wild type, SDH and FRD deletion mutant’s sensitivity to Rifampcin (RIF). By day 7 (D7), wild type and mutant growth were cognate under aerobic growth and nutrient availability. Compared to wild type growth on D0 and D7 without drug exposure (controls), as well as wild type exposed to Rifampicin, there was a reduction in CFU/mL of up to two logs in SDH and FRD deletion mutant strains (Fig. 3.12). 74 MOX/STREP Log10 CFU/mL 8 WT SDH 7 FRD 6 5 4 3 D0 D7 MOX 0.156 MOX 0.078 STREP 0.313 CONC/uM Fig. 3.14 M. tuberculosis wild type, SDH and FRD deletion mutant’s sensitivity to Moxifloxacin (MOX) and Streptomycin (STREP). Consistent with findings in Rifampicin treated mutant studies, a two to three log reduction in CFU/mL was seen when SDH and FRD deletion mutants were exposed to Moxifloxacin and Streptomycin, respectively (Fig. 3.13). PAS/INH 9 WT Log10 CFU/mL 8 SDH 7 FRD 6 5 4 3 D0 D7 PAS 0.781 PAS 0.195 INH 0.313 CONC/uM Fig. 3.15 M. tuberculosis wild type, SDH and FRD deletion mutant’s sensitivity top paminosalysilic acid (PAS) and Isoniazid (INH). When wild type and mutants were exposed to Para-aminosalysilic acid (PAS), growth of wild 75 type and mutants were comparable with non obvious differences in log CFU/mL, however, in the presence of Isoniazid, there was about a three log decrease in log CFU/mL of SDH and FRD mutants compared to wild type exposed to drug at the same concentrations (Fig. 3.14). In summary, SDH and FRD deletion mutant strains showed significant growth attenuation in the presence of anti-TB drugs such as Rifampicin, Isoniazid, Moxifloxacin and Streptomycin compared to wild type whilst, Para-aminosalysilic acid did not have a significant impact on growth of both mutants compared to wild type. 3.4 LOEBEL CIDAL STUDIES 3.4.1 IN VITRO DRUG SENSITIVITY STUDIES FOR LOEBEL M. bovis BCG WILD TYPE AND MUTANTS A current challenge in tuberculosis treatment is the presence of quiescent non-replicating persistent TB populations, which are resistant to most of the known anti-TB drugs. These bacteria have halted active replication, are metabolically inactive and entering into a nonreplicating state believed to be one of the reasons for the prolonged drug treatment of tuberculosis. Wild type and respiratory gene deletion mutants were grown under the stress of nutrient starvation (Loebel model) and subsequently exposed to anti-TB drugs in order to evaluate the sensitivity between wild type and mutant strains to drugs. 76 CELL GROWTH WITHOUT DRUG EXPOSURE ALONGSIDE CIDAL STUDIES 8 WT Log10 CFU/mL 7 SDH 6 FRD 5 NUO 4 3 2 1 0 0 9 15 TIME/DAYS Fig. 3.16 Growth of M. bovis BCG wild type and mutant strains used for drug sensitivity experiments under nutrient starved conditions. Consistent with the significant variation in growth between wild type ,FRD and SDH deletion mutants under nutrient starved conditions as previously shown, by day 15 there was about a one to two log decrease in CFU/mL of FRD and SDH mutants, respectively. Wild type bacilli were however maintained at approximately seven logs of CFU/mL (Fig. 3.15). RIF LOEBEL CIDAL Log10 CFU/mL 8 7 WT 6 SDH FRD 5 NUO 4 3 2 1 0 NO DRUG RIF 1 RIF 10 RIF 25 CONC/uM Fig. 3.17 M. bovis BCG wild type and mutant drug sensitivity to Rifampicin under nutrient starved conditions. 77 When wild type and mutants were exposed to Rifampicin at 1µM, there was about a log decrease in CFU/mL of FRD and NUO mutants compared to wild type. Mutant SDH, however, in comparison to CFU/mL under no drug pressure, showed no CFU at all on agar plates from the highest (10-1) to the lowest (10-5) dilutions plated. This implied the presence of less than a 100 CFU/ml. AT 10µM and 25µM, there was less than 100 CFU/ml of both wild type and mutant bacilli present. MOXI LOEBEL CIDAL Log10 CFU/mL 8 WT 7 SDH 6 FRD 5 NUO 4 3 NO DRUG MOXI 1 MOXI 10 MOXI 25 CONC/uM Fig. 3.18 M. bovis BCG wild type and mutant drug sensitivity to Moxifloxacin under nutrient starved conditions. Wild type and mutant cells also showed sensitivity in the presence of Moxifloxacin. There was about a log decrease in CFU/mL of SDH mutant bacilli in comparison to log CFU/mL without drug exposure while, FRD and NUO mutants were only marginally affected in comparison to wild type bacilli. In the presence of Streptomycin, however, SDH at 1µM, showed a severe attenuation in growth with a three log reduction in CFU/ml compared to wild type at the same concentration. At 10 and 25µM, SDH mutant bacilli showed no CFU at all on agar plates 78 from the highest (10-1) to the lowest (10-5) dilutions plated. This implied the presence of less than a 100 CFU/ml. FRD and NUO mutants were insensitive and grew at par with wild type under drug pressure. STREP LOEBEL CIDAL 8 WT 7 SDH Log10 CFU/mL 6 FRD 5 NUO 4 3 2 1 0 NO DRUG STREP 1 STREP 10 STREP 25 CONC/uM Fig. 3.19 M. bovis BCG wild type and mutant drug sensitivity to Streptomycin under nutrient starved conditions. INH CYCL PAS LOEBEL CIDAL Log10 CFU/mL 8 WT SDH 7 FRD 6 NUO 5 4 3 NO DRUG CYCL 100 PAS 100 CONC/uM 79 INH 50 Fig. 3.20 M. bovis BCG wild type and mutant drug sensitivity to Cycloserine, ParaAminosalisylic acid and Isoniazid under nutrient starved conditions. In the presence of Cycloserine, Para-Aminosalisylic acid and Isoniazid, SDH mutant did not show any attenuation in growth compared to its own growth without drug exposure. Growth of FRD and NUO mutants under drug pressure were also comparable to that seen in wild type and were not affected by the presence of any of the above drugs. 3.4.2 DRUG SENSITIVITY STUDIES IN LOEBEL M. tuberculosis H37Rv WILD TYPE AND VARIOUS RESPIRATOY GENE DELETION MUTANTS IN VITRO In light of the striking results obtained from drug sensitivity tests for the persistent M. bovis BCG respiratory chain mutants, the nutrient starvation experiments were conducted in M. tuberculosis wild type and respiratory chain mutants to produce persistent cells which were LOEBEL FOR LOEBEL then subjected to studies under the same conditions as forCIDAL the M .bovis BCG studies. 8 Log10 CFU/mL 7 WT SDH FRD NUO 6 5 4 3 2 1 0 WT SDH FRD NUO DAY 0 Fig. 3.21 Growth of M. tuberculosis H37Rv wild type and respiratory gene deletion mutant strain at the start of drug treatment. 80 At day 0 (start of drug treatment), all mutants and wild type were approximately seven log CFU/mL (Fig. 3.20). At 1µM of Rifampicin, SDH mutant strain showed about two logs reduction in CFU/ml compared to wild type at the same concentration while mutants NUO and FRD showed about a log reduction. At 10 and 25µM, SDH showed about three log reduction in CFU/ml compared to wild type which remained at approximately seven logs for all drug concentrations. Mutant FRD also showed sensitivity to treatment, with a two to three log reduction in CFU/ml at 10 and 25µM. NUO mutant however showed little change in sensitivity to drugs in RIF LOEBEL CIDAL(Fig. 3.21). comparison to wild type at the same concentrations Log10 CFU/mL 8 WT SDH FRD NUO 7 6 5 4 3 NO DRUG RIF 1 RIF 10 RIF 25 CONC/uM Fig 3.22 M. tuberculosis H37Rv wild type and mutant strains drug sensitivity to Rifampicin under nutrient starved conditions. When exposed to Moxifloxacin, SDH and FRD mutant strains once again showed sensitivity with a two to three log decrease in CFU/ml at 10 and 25µM in comparison to wild type which 81 maintained about seven logs of CFU/ml at all drug concentrations. However, NUO mutant strain was less sensitive at 25µM; it showed some sensitivity with a log and a half reduction in CFU/ml (Fig. 3.22). MOXI LOEBEL CIDAL Log10 CFU/mL 8 WT SDH FRD NUO 7 6 5 4 3 NO DRUG MOXI 1 MOXI 10 MOXI 25 CONC/uM Fig. 3.23 M. tuberculosis H37Rv wild type and mutant drug sensitivity to Moxifloxacin under nutrient starved conditions. In the presence of Streptomycin, mutant SDH and FRD were again sensitive with a two to three log decrease in log CFU/ml and NUO mutant was less sensitive to Streptomycin even at STREP LOEBEL CIDAL 25µM. Log10 CFU/mL 8 WT SDH FRD NUO 7 6 5 4 3 NO DRUG STREP 1 STREP 10 CONC/uM 82 STREP 25 Fig. 3.24 M. tuberculosis H37Rv wild type and mutant drug sensitivity to Streptomycin under nutrient starved conditions. The presence of Isoniazid did not have any impact on the survival of all the mutants (SDH, FRD and NUO) including wild type. Similarly, all mutants in comparison to wild type did not show survival phenotype when treated with Para-Aminosalisylic acid. CFU/mL was INHlogs. PAS LOEBEL CIDAL maintained at approximately seven Log10 CFU/mL 8 WT SDH FRD NUO 7 6 5 4 3 NO DRUG PAS 100 INH 50 CONC/uM Fig. 3.25 M. tuberculosis H37Rv wild type and mutant drug sensitivity to ParaAminosalisylic acid and Isoniazid under nutrient starved conditions. In summary, from M. bovis BCG and M. tuberculosis Loebel cidal studies, it became evident that in order of rank in comparison to wild type bacilli, the most sensitive mutant was SDH followed closely by FRD with NUO showing very little sensitivity to drugs. 83 3.5 RESPIRATORY MEMBRANE VESICLE ASSAY DEVELOPEMENT FOR THE HIGH-THROUGHPUT SCREENING AND IDENTIFICATION OF RESPIRATORY ENZYME INHIBITORS Based on knowledge that MVs were distinct bodies with biological activity, it was postulated that these MV’s would carry the Electron Transport Chain (Enzymes) (ETC) of these bacteria and could thus be used to develop an assay to screen compound libraries for potential respiratory chain inhibitors. An assay was therefore designed and developed to screen respiratory membrane vesicles extracted from M. smegmatis and M. bovis BCG grown aerobically. This chapter shows the results of the vesicle assay to test viability of the outer membrane vesicles isolated and discusses the feasibility of screening compound libraries for respiratory chain inhibitors using these membrane vesicles via a set of enzyme kinetic experiments that could later be developed for high-throughput screening. 3.5.1 M. smegmatis RESPIRATORY MEMBRANE VESICLE ASSAY M. smegmatis MC2 155 strain was grown aerobically and centrifuged to collect the cell pellet, which were washed twice with PBS. These cells were re-suspended in MOPS buffer supplemented with DNAase, RNAase, cocktail enzyme inhibitors. They were further subjected to French press in order to break the cells and get rid of the cytoplasmic contents. The supernatant was later subjected to differential centrifugation to obtain membrane vesicles, which were postulated, might harbor all the important complexes to carry out the electron transport chain (ETC) reaction. The membrane vesicles thus isolated were tested to confirm if the ETC was intact and ATP generation could be detected. Vesicles were therefore provided 84 with adenosine diphosphate (ADP), inorganic phosphate (Pi) and reduced nicotinamide adenine di-nucleotide (NADH) which could be used to generate the proton gradient by M. smegmatis membrane vesicles based on the equation of oxidative phosphorylation: ADP3- + HPO42- + NADH + 1/2 O2 + 2H+ --> ATP4- + NAD+ + 2 H2O TIME/MINUTES Fig. 3.26 The electron transport chain activity of M. smegmatis respiratory membrane vesicles. Red and blue lines indicate the vesicle activity in the absence and presence of known ATP synthase inhibitor TMC207 at 1µM, respectively. The ATP synthase assay run with the 5µg/ml concentration of M. smegmatis membrane vesicles showed presence of intact ETC machinery as determined by production of ATP in the presence of the substrates; NADH, Pi and ADP. The known ATP synthase inhibitor, TMC207 served as a control (background) to reconfirm viability of the membrane vesicles. In the presence of drug, ATP production was greatly impeded (Blue line) while ATP levels 85 increased over time in the absence of the drug (Red line) (Fig. 3.25). 3.5.2 M. bovis BCG RESPIRATORY MEMBRANE VESICLE ASSAY Based on activity found in M. smegmatis vesicles, an attempt was made to isolate M. bovis BCG respiratory membrane vesicles since this species was much more closely related to M. tuberculosis and would be of importance for TB drug screening programs. With that, membrane vesicles were obtained from M. bovis BCG pellet as per the protocol used for M. smegmatis cells with a few substitutions. The vesicles were screened for enzyme activity by assessing if the electron transport chain was intact via the detection of ATP in the presence and absence of NADH. Vesicles were therefore provided with ADP and Pi with and without NADH. Fig. 3.27 The electron transport chain activity of M. bovis BCG respiratory membrane vesicles. Red and blue lines indicate the vesicle activity in the presence and absence of NADH, respectively. 86 In the presence of NADH, ATP production was detected with higher luminescence readings compared to readings without NADH indicating that the M. bovis respiratory membrane vesicles were viable and had an intact ETC (Fig. 3.26). 87 CHAPTER 4 4.0 DISCUSSION 4.1 IN SILICO BIOINFORMATIC ANALYSIS OF MAJOR GENES WITHIN THE RESPIRATORY CHAIN COMPLEX OF THE MYCOBACTERIA Comparative genomic analysis leads to a better understanding of genes that are conserved in various species of bacteria within the same genus. This often gives researchers more confidence about the functional importance of the genes. Under the Mycobacterium genus, there are several species of bacterial strains that cause dreaded diseases; to name a few, M. tuberculosis that causes both pulmonary and extra-pulmonary tuberculosis, M. ulcerans which causes ulcerative syndrome and M. leprae which causes leprosy. In the current study we have compared multiple respiratory complex genes with at least 5-6 Mycobacterium species in order to investigate the conservation of these genes. Often, the presence of genes in the mycobacterial minimal genome of M. leprae suggests utmost functional importance of genes, with respect to essentiality for growth. NDH 1 encoded by nuoABCDEFGHIJKLMN, is part of the first complex of the electron transport chain of M. tuberculosis, the point of entrance of electrons into the chain from the products of the Krebs or TCA cycle. From in silico bioinformatic analysis it was observed that most of the major mycobacterial strains had this operon. M. leprae which has a severely reduced genome had only a homolog of nuoN, as a pseudogene. This data suggests that nuoABCDEFGHIJKLMN may be dispensable for growth in the mycobacteria. Rao and coworkers (2008) did show that NADH dehydrogenase I deficient mutants of M. tuberculosis were able to survive both under aerobic and hypoxic conditions. 88 However, with the knowledge that the essentiality of genes is largely dependent on environmental conditions available for growth, curiosity arose as to whether this gene would be truly nonessential under other known conditions most especially under/un-investigated adverse conditions. Succinate dehydrogenase (SDH), the second complex (complex II) of the electron transport chain and classified as succinate menaquinone oxidoreductases in M. tuberculosis, was present in all the mycobacterial strains. Due to the unique nature of the respiratory cycle in M. tuberculosis, the true role of SDH seems to be a mystery, however, only limited biochemical information is available on this enzyme in the mycobacteria. Much of the published work on this complex has been based on in depth studies in eukaryotic and in particular mammalian SDH (Hederstedt and Rutberg, 1981; Ackrell, 1978; Bardella et al, 2011; Raygada et al, 2011).Extensive work in the area of biochemically characterizing this enzyme has however not been done for prokaryotic SDH in comparison with eukaryotic SDH, thus little is known about this distinctly unique enzyme among these economically important organisms. Furthermore, most of the work done on prokaryotic SDH has been limited mainly to other bacteria such as Escherichia coli (Lancaster, 2002). It was envisaged that this enzyme may play an essential role in the survival of the mycobacteria considering that they had been conveniently conserved among the different species even in M. leprae, and worthy of note, not as a pseudogene. The subunit arrangements and sequence similarities were also very significant among the different mycobacteria. These findings gave a clue to the possible essentiality of this enzyme, absence or inhibition of which by hypothesis, might greatly impair the growth of these organisms. Fumarate reductase (FRD) was another interesting enzyme, very similar to SDH and 89 hypothesized to have diverged from the same common ancestor as earlier stated (Kana et al, 2009). From bioinformatic analysis it was discovered that M. tuberculosis and M. bovis BCG had retained their FRD enzyme while other mycobacteria such as M. leprae, M. smegmatis, M. ulcerans and M. marinum had lost theirs. The sequence similarity between the amino acids of M. tuberculosis and M. bovis BCG ranged between 99-100%. These results suggested that SDH could take up FRD’s function in other mycobacteria which lacked FRD but also that the loss was deliberate and mycobacteria which lacked FRD did not necessarily require the enzyme. Further work is required to understand this hypothesis. TABLE 4.1 Summary of the comparative bio-informatic analysis of respiratory complexes showing their distribution and sequence identities to M. tuberculosis. M. tuberculosis H37Rv ORTHOLOGS AND % IDENTITY TO Mtb M. bovis 1173P2 BCG Pasteur M. smegmatis MC2 155 M. leprae TN nuo A-N: Rv3145 (nuoA) BCG3168 (nuoA) 100 MSMEG 2063 69 Rv3158 (nuoN) BCG3181 (nuoN) 100 MSMEG 2050 66 ML0657 (Pseudogene) RV 3318 (A) BCG 3384 (A) 99 MSMEG1670 93 ML 0697 87 RV 3319 (B) BCG 3385 (B) 99 MSMEG 1669 87 ML 0696 89 RV 3316 (C) BCG 3382 (C) 100 MSMEG 1672 74 ML 0699 88 RV 3317 (D) BCG 3383 (D) 99 MSMEG 1671 71 ML 0698 85 BCG 1604 (A) 100 - Sdh: Frd: RV 1552 (A) 90 - RV 1553 (B) BCG 1605 (B) 99 - - RV 1554 (C) BCG 1605 (C) 99 - - RV 1555 (D) BCG 1606 (D) 100 - - Putative enzyme: RV 0247c BCG 0285c 91 MSMEG 0417 84 ML 2560 (Pseudogene) RV 0248 c BCG 0286c 100 MSMEG 0418 80 ML 2559 (Pseudogene) RV 0249 c BCG 0287c 100 MSMEG 0419 81 ML 2558 (Pseudogene) RV1161 BCG 1223 99 MSMEG 5008 80 ML 1502 (Pseudogene) RV1162 BCG1224 100 MSMEG 5139 80 ML 1501 (Pseudogene) narGH: With reference to information pointing to the ability of this enzyme to serve as a terminal electron acceptor and actually as the preferred terminal electron acceptor usually under anaerobic conditions and during hypoxia (Cecchini et al, 2003), it was hypothesized that the enzyme was functional in M. tuberculosis and M. bovis BCG and might have been conserved due to distinct conditions they encountered in their natural niches which the other mycobacteria that lacked this enzyme most likely did not encounter or have to cope with. The putative enzyme formed by Rv0247c- Rv0249c operon and its complements in other 91 mycobacteria such as M. bovis BCG, M. smegmatis and M. leprae raises a query of interest as to why M. tuberculosis seems to have two putative SDH enzymes found at different regions of the membrane. It has been proposed that this enzyme encoded by Rv0247c-Rv0249c in M. tuberculosis might be essential (Kana et al, 2009) however, this is hard to conclude on since this gene remains a pseudogene in M. leprae. On the other hand, it could be that this gene is essential for the survival of the mycobacteria in which it is present and dispensable for the survival of the mycobacteria, like M. leprae which lack it. The essentiality therefore of this enzyme would most likely be linked to the metabolism of these bacteria and their specific requirements for survival. It is reasonable to assume that within their natural hosts or niches they are required to fight different wars to survive. Presence of multiple copies of genes with similar functions might also signify the functional importance of the operon. It is possible that SDH, FRD and Rv0247c operons complement each other when one or the other is not functional. The nitroreductase, narGHJI reported to catalyze the reduction of nitrate to nitrite has been shown to confer anaerobic nitroreductase activity in M. tuberculosis and has been implicated in redox balancing and energy metabolism during non-replicating persistence (Tan et al., 2010). Findings from Weber and co-workers (2000), showed that growth of narG mutant M. bovis BCG was attenuating in SCID mice and with studies from Lenaerts and co-workers (2007) also showing that this enzyme metabolized the decomposed NO produced by the host cell in its bit to fight TB infection providing nutrients for the bacteria, that, there was a functional role of this enzyme, was not debatable. The absence of narGHJI in other mycobacteria such as M. ulcerans and M. leprae was also 92 found to be interesting. A proposal however to explain this was that most likely, within their natural habitats or ecological niches was a limited availability or supply of nitrate (Kana et al, 2009). It is also possible that the above organisms do not experience the hypoxic conditions where oxygen is limited and where nitrate could become the terminal electron acceptor. M. tuberculosis and M. bovis BCG may often face stringent hypoxic stress, where NAR may be essential for survival. These hypotheses however can only be supported with experimental evidence. Bio-informatic analysis helped to build a better picture on the epidemiology and distribution of these genes within the mycobacteria thus providing some clues on their essentiality and giving direction for further studies. As will be evident in succeeding chapters, focus was put on these unique enzyme complexes in an attempt to understand their possible functions within the mycobacteria, particularly, M. bovis BCG and M. tuberculosis H37Rv. 93 4.2 RESPIRATORY COMPLEXES: THEIR IMPACT AND RELEVANCE FOR SURVIVAL UNDER VARIOUS GROWTH CONDITONS 4.2.1 GENETIC ESSENTIALITY OF RESPIRATORY COMPLEX GENES UNDER NUTRIENT-RICH AEROBIC GROWING CONDITIONS Essentiality of various respiratory complex genes for growth under nutrient-rich conditions was evaluated by growing M. bovis BCG wild type and respiratory complex mutants in Middlebrook 7H9 medium. No significant difference in growth was observed between wild type and respiratory complex mutants with respect to the ability of mutants to survive and replicate at levels analogous to wild type bacilli. This might suggest that, under optimum conditions of growth when stress factors- such as oxygen depletion, nutrient limitation/deprivation, non-optimal pH- are absent, the deleted complexes of the respiratory chain of M. tuberculosis are dispensable for growth. Sassetti and colleagues (2003) set to identify the group of genes required for mycobacterial growth under similar growth conditions of nutrient and oxygen availability as evidenced by the conditions of growth reported in their experimental procedures (7H10 agar supplemented with AD bovine serum albumin, glucose, NaCl). It was concluded based on growth study results that the gene clusters nuoA-N, sdhCDAB, frdABCD, Rv0247-9c and narGHJI were part of the non-essential genes of the mycobacteria. They however limited their findings to growth on the defined media conditions they employed for the study and proposed that future experiments using varied growth conditions be designed to investigate and identify genes that would be required for growth under other conditions as they believed that would yield knowledge on functional clues for the myriad of uncharacterized mycoacterial genes (Sassetti et al, 2003). Rao and co-workers (2008) also showed that the growth of NADH 94 dehydrogenase I (nuoA-N) deletion mutants were uncompromised in both aerobic and hypoxic conditions. The NAR deletion mutant did not show any difference in growth compared to wild type strain, similar to that which Weber and co-workers (2000) had reported for a narG mutant under similar growth conditions also evidenced by their growth conditions. In the current study, none of the respiratory complex mutants showed any attenuation under nutrient-rich aerobic growing conditions. This is the first study ever that has directly shown that the sdh, frd and BCG 0285c deletion mutants of M. bovis BCG are not essential for growth in nutrient-rich aerobic conditions. It was also further validated that frd and sdh deletion mutants of M. tuberculosis H37Rv could be spared for aerobic growth using nutrient rich media. Since, sdh, frd and Rv0247-9c share similar functional and structural domains, they might be functionally redundant, and effects of the deletion of individual complexes may be overcome by the presence of the other complexes. Further studies are required to generate double and triple mutations in order to evaluate the importance of these complexes under nutrient-rich aerobic conditions. 4.2.2 GENETIC ESSENTIALITY OF RESPIRATORY COMPLEX GENES UNDER NUTRIENT-STARVED AEROBIC CONDITIONS The essentiality of genes is conditional. During the course of infection within the host, many stressful conditions are encountered and every successful pathogen has to alter the expression of its genetic material depending on requirements for survival as per conditions encountered. Nutrient starvation is one of the stress conditions which M. tuberculosis may face during infection; hence an attempt was made to evaluate the importance of the respiratory complex genes under nutrient starved conditions. Commonly used in vitro and in vivo study models of 95 TB suggest that, during infection there are different sub-populations of the bacteria which exist within the human due to micro-environmental conditions such as varying concentrations of oxygen and nutrients. Most of these persistent bacilli have the ability to survive high antibiotic exposure eventually becoming resistant (Eng et al, 1991; Warner and Mizrahi, 2006; Betts et al, 2002; Gengenbacher et al, 2010). This has been proposed to explain the long treatment duration required to cure disease as seen in the clinic (Dick, 2001; Wayne and Sohasky 2001). The current Achilles’ heel is the persistent populations of bacteria in human infections. The well studied and characterized Wayne model which looks at the growth kinetics of bacilli under nutrient rich conditions and the depletion of oxygen as well as the less well studied Loebel or nutrient starvation model which looks at the growth kinetics of bacilli under oxygen rich but nutrient limiting conditions have both shown the potential of M. tuberculosis to survive for a significant amount of time in a non-replicating/static drug-tolerant state (Betts et al, 2002; Wayne and Hayes, 1996). It is known that there is a significant link between the respiratory cycle and the ability of the bacteria to survive under the most constrained conditions. Mycobacterium under hypoxic non-replicating conditions have intracellular ATP levels reduced 5 fold when compared to levels found in actively growing mycobacteria (Koul et al, 2008, Rao et al, 2008). Similarly, nutrient starved bacilli are also known to have reduced expression of energy metabolism genes (Betts et al., 2002) and lower ATP levels compared to actively replicating mycobacteria (Gengenbacher et al, 2010). Since, nutrient-starved bacilli have lower ATP levels; it was hypothesized that the respiratory 96 complex mutants would have compromised growth. In order to evaluate the above hypothesis, all the respiratory complex deletion mutants were subjected to nutrient-starved conditions. Surprisingly, excluding NUO mutant, all other mutants namely; NAR, SDH, FRD, and BCG 0285c showed significant loss of viability compared to wild type M. bovis BCG by day 28. The lack of survival phenotype seen between the WT and NUO mutant strain under both nutrient-rich and starved conditions, seemed to support reports that this enzyme was dispensable for growth of M. bovis BCG, M. tuberculosis and other mycobacteria such as M. leprae which has lost this gene cassette and maintained only nuoN (as a pseudogene). Betts and co-workers (2002) reported that the NUO operon was consistently down-regulated through-out the nutrient-starved model, further validating the lack of phenotype seen by loss of the NUO operon under nutrient starved conditions. There is the presence of another NADH dehydrogenase II (NDH II) which may be complementing the function of conversion of NADH-NAD+ under both nutrient-rich and starved conditions. Further work is required to investigate this hypothesis. NDH II is coded for by two different genes namely ndh and ndhA in M. bovis BCG and M. tuberculosis H37Rv and ndh is believed to be required for survival of the mycobacteria (Velmurugan et al, 2007; Rao et al, 2008). Significant reduction in CFUs of bacilli was noticed when M. bovis BCG deletion mutant of NAR was grown under nutrient-starved conditions indicating its essentiality. Weber and co-workers (2000) studied the ability of M. bovis BCG narG deletion mutant to survive in SCID mice. Mice infected with wild type showed clinical disease by day 50 and and eventually died at ~80 days compared to narG deletion mutant infected mice which had smaller granuloma, lower bacteria and survived for over 200 days. These results suggest that for in vivo survival NAR could be essential. 97 Tan and co-workers (2010) also reported essentiality of NAR when challenged with low acidic conditions and reactive nitrogen species (RNS). The drastic attenuation seen in the current study are similar to in vitro and in vivo studies and could suggest that the nutrient starvation/Loebel model is also one of the most likely environmental conditions (along with acidic and RNS) encountered by the bacteria in vivo holding promise for its use in further characterization studies. M. bovis BCG with deletions in sdh, frd and BCG 0285-7c operons also showed attenuation compared to the wild type strain, with SDH being highly attenuated followed by others. This was also reproducible for SDH and FRD deletion mutants of M. tuberculosis H37Rv when grown under stress conditions of nutrient limitation. This revealed their essentiality for survival under nutrient-starved conditions and gave clues about their individual functionality. Although, these three operons share similar genes having probably similar functions, it was surprising to see the attenuation phenotype. Initially, it was thought that the operons might be functionally redundant as seen under nutrient-rich conditions. An attempt was thus made to understand the reason behind the phenotype seen based on literature available. FRD has been found to serve as the preferred electron acceptor under anaerobic conditions and frdA was found to be unregulated in M. tuberculosis at early and late stages of carbon starvation (Betts et al, 2002), suggesting that fumarate reduction and fumarate mediated respiration might be employed by M. tuberculosis during stages of persistent infection (Kana et al, 2009). SDH and FRD are oxidoreductases (oxidases and dehydrogenases). SDH is an oxidase involved in aerobic respiration when oxygen acts as an acceptor of hydrogen (electrons and protons) and electrons transferred from SDH to reduce menaquinone to menaquinol are 98 eventually passed on to molecular oxygen by other complexes of the respiratory chain. FRD on the other hand is a dehydrogenase which removes hydrogen from quinol and passes the electrons downstream the electron transport chain. Both SDH and FRD have a similar architecture and contain Iron-Sulphur (Fe-S) clusters which serve to transfer electrons through the membrane during respiration. There is a major difference though between SDH and FRD in the arrangement of their redox potentials. SDH is found to have a high redox potential among its redox centres (3Fe-4S) with the heme b it possesses, acting as an electron depot or a sink, attracting electrons near the quinone binding site. SDH in its activity, quickly removes electrons from the FAD to the 3Fe4S and then to heme b leaving very few electrons at the FAD site and resulting in almost 100% oxidation of FAD. FRD on the other hand was found to have the highest redox potential at the FAD and 2Fe-2S cluster. FRD in its activity, with no heme b sink to pass electrons to, leaves much more electrons on FAD and Electrons on FAD were found to increase the reactive electron density to about 50 times more. FRD has its FAD being totally exposed to the solvent and thus to molecular oxygen. With this, reactive oxygen species could easily be formed (Yankovskaya et al, 2003). The build up of electrons around the FAD due to FRD is responsible for the generation of high-levels of ROS produced by FRD consistent with what had been shown by Messner and Imlay (2002). Hence, in E. coli, it has been found that SDH is used under aerobic conditions while FRD is used under anaerobic conditions (Cecchini et al, 2002), where generation of reactive oxygen species (ROS) levels are limited due to the anaerobic conditions. Further, in E. coli, Maklashina and co-workers (1998) have shown that SDH could functionally replace FRD for anaerobic growth, if SDH could be expressed under FRD’s promoter. It was suggested that the main reason behind the use of SDH for aerobic 99 respiration and FRD preferentially under anaerobic conditions was related to the different levels of ROS these individual enzymes produced during their activity. It is reported that all SDH complexes contain at least one heme b and mutations in human sdhBCD lead to formation of tumors and hereditary paraganglioma while mutations in sdhA cause encephalomyopathy (Baysal et al, 2000; Niemann and Müller, 2000; Rutter, 2010). In eukaryotes, it has been reported that SDH does not solely serve for energy production but also for oxygen sensing. It is thus believed to be an antioxidant enzyme playing the role as a superoxide scavenger whose absence results in the presence of excess superoxide and oxidative stress known to induce tumour formation (Dudkina et al, 2005). Clearly this points to unique requirements of this enzyme across species. Again it was found that mutations in this enzyme led to high levels of ROS and in an sdh mutant of C. elegans mev-1 where SDH could no longer transfer electrons to ubiquinone. Resulting defects were suggested to be as a result of the leakage of electrons given off by SDH’s inability to transfer electrons down the chain (Senoo-Matsuda et al, 2001). In contrast, within M. tuberculosis, it is possible that all three operons (SDH, FRD and Rv0247-9c) are functional during both aerobic and anaerobic conditions and thus functionally active at different levels when one or another of the operons is deleted. When, SDH is deleted, FRD and/or Rv0247-9c could be functioning and generating greater ROS making the bacteria more susceptible to ROS mediated killing and thus affecting the growth on the agar plates. This could be one of the reasons for attenuation of the SDH deletion mutant under the nutrient-starved state. Furthermore, under nutrient starved conditions, there are absolutely no nutrients that could probably scavenge ROS produced by mycobacteria due to continuous aeration, whereas under 100 nutrient-rich conditions media contains BSA, glucose and other nutrients which may act as ROS scavengers thereby reducing the effect of ROS on the mutants (Ermilov et al., 1999). 4.2.3 SUSCEPTIBILITY OF RESPIRATORY COMPLEX GENE DELETION MUTANTS TO STANDARD ANTI-TB DRUGS UNDER UNDER NUTRIENTRICH AND -STARVED AEROBIC CONDITIONS Recently, there have been many scientific reports suggesting that bactericidal antibiotics use a common mechanism to induce cell death through oxidative damage mechanisms that rely on ROS production (Kohanski et al., 2007, 2008; Shatalin et al., 2011; Ngyuen et al., 2011). Although many of the primary targets of these antibiotics could be different, they activate cellular respiration, which leads to superoxide radical production and the release of iron from iron-sulphur clusters (Kohanski et al., 2007, 2008; Dwyer et al., 2007). Free iron thus produced in turn helps in the generation of ROS through the Fenton reaction. These hydroxyl radicals generated lead to cell death as a result of major damage caused to DNA (Imlay 2008; Kohanski et al 2007), lipids and proteins. Since, respiratory complex gene deletion mutants in mycobacteria were available; mainly SDH, FRD and NUO deletion mutants were subjected to antibiotic stress under both nutrientrich and starved conditions. Based on the hypothesis formulated that these mutants could produce more ROS compared to wild type, it was strongly suspected that the mutants could be more sensitive to mycobactericidal agents. The NUO mutants did not show significant sensitivity to all tested antibiotics under both nutrient-rich and starved conditions compared to wild type in M. bovis BCG and M. tuberculosis H37Rv. The minimum inhibitory concentration (MIC) of SDH and FRD mutants of M. bovis BCG were, however, folds lower compared to wild type strains for most of the drugs tested namely 101 Rifampicin, Moxifloxacin, Streptomycin and Isoniazid under nutrient-rich conditions. SDH mutant was much more sensitive to Rifampicin compared to other drugs with a 10 fold lower MIC in comparison to wild type MICs. All these drugs are known to be cidal to mycobacteria, although Rifampicin in static against E.coli. Furthermore, to investigate, if M. tuberculosis SDH and FRD deletion mutants are more sensitive, cidal activity testing at various concentrations of antibiotics was carried out. Surprisingly, both SDH and FRD mutants were more susceptible to cidal drugs compared to wild type at similar concentrations. The reduction in CFU was often 1-3 logs more compared to wild type for mutants. All the cidal drugs, namely Rifampicin, Moxifloxacin, streptomycin and Isoniazid showed this trend, whilst p-Aminosalisylic acid treatment did not have a significant effect on the mutants. This could be due to poor cidal activity of PAS which needs to be further evaluated. All these results further strengthened the formulated hypothesis that SDH and FRD mutants could be generating more ROS species compared to wild type and hence becoming more susceptible to cidal drugs. Since moderate survival deficiency of respiratory mutants in nutrient-starved conditions had been seen, the wild type and mutants were subjected to various mycobactericidal drugs. Nutrient starved cells have been shown to be very resistant to all the standard anti-TB drugs (Betts et al., 2002, Gengenbacher et al., 2010). Recently Nguyen et al., 2011 described an anti-oxidant mechanism by which a starvation signaling stringent response leads to antibiotic resistance in pseudomonas aeruginosa and E. coli under nutrient starved conditions. They further showed that serine starvation in wild type bacteria decreased the number of bacilli killed by ofloxacin by ≈2300 fold compared to the ΔrelA spoT mutant which showed a 102 decrease in killing by only ≈34 fold (Nguyen et al., 2011). The results of this present study clearly showed that wild type M. tuberculosis H37Rv was very resistant to known-TB drugs such as Rifampicin, moxifloxacin, streptomycin and Isoniazid. Under similar doses, SDH and FRD mutants were exquisitely sensitive to these drugs but Isoniazid. These results further validated the hypothesis that the SDH and FRD mutants could be producing higher ROS, making them more sensitive to bactericidal drugs. Nutrient starved cells are usually non-growing and well documented evidence showing that Isoniazid targets growing cells exists, hence explaining the lack of phenotype seen for Isoniazid treated cells. Here, for the first time, this study has shown that respiratory complex genes could be successfully used as targets to kill recalcitrant, drug resistant quiescent Mtb cells that are very hard to kill by known drugs. Furthermore, these results reveal more respiratory complex genes that could be possible drug targets as they potentiate the killing of the bacteria by cidal drugs based on well defined studies and supported hypotheses that all cidal drugs eventually employ oxidative pathways to annihilate bacterial cells. 4.3 RESPIRATORY MEMBRANE VESICLE ASSAY DEVELOPEMENT FOR THE HIGH-THROUGHPUT SCREENING AND IDENTIFICATION OF RESPIRATORY ENZYME INHIBITORS A known ATP synthase inhibitor TMC207 has not only chemically but also clinically validated ATP synthase as a novel target which could be effectively targeted to make viable drugs (Andries et al., 2005; Koul et al., 2007, Koul et al., 2011, Diacon et al., 2009). This novel compound has opened up several thoughts on how to come out with novel assays to 103 find compounds specifically affecting respiratory pathways. Here the possibility of using M. smegmatis and M. bovis BCG vesicles to develop assays that could be used for finding novel compounds that affect respiratory pathways in mycobacteria was evaluated. With the production of ATP in measurable quantities in the presence of NADH, ADP and inorganic phosphate, the viability and activity of the membrane vesicles with intact complexes for the transfer of electrons and the ultimate production of ATP was proven. This also confirmed the belief that membrane vesicles had biological activity and truly carried away portions of the cell membrane. They could thus be exploited for other biochemical studies. The reduction observed in ATP production in the presence of the known ATP synthase inhibitor TMC 207 in comparison to generation in the absence of the drug further validated the vesicle assay. The feasibility of developing such assays for identifying respiratory membrane inhibitors has been shown here. With further studies and optimization, this assay could likely be improved and scaled up to produce a standard biochemical assay for routine screening purposes. 104 CHAPTER 5 5.0 CONCLUSION AND RECOMMENDATIONS FOR FUTURE WORK 5.1 CONCLUSION Among the mycobacteria are enzymes that have been conserved in all species and others whose existence has been limited to specific species. Bioinformatic analysis revealed the conservation of SDH in M. bovis BCG, M. tuberculosis, M smegmatis as well as M. ulcerans and M. leprae. Analysis also showed the conservation of NAR and the gene cluster RV 02479c/BCG 0285-7c in all species above but as psuedogenes in M. leprae as well as the presence of NUO operon in all these species but M. leprae which possessed only nuoN as a pseudogene. Finally, FRD was present in M. bovis BCG and M. tuberculosis but absent in all the other mycobacteria above. Enzymes conserved in all mycobacterial species drew attention to their essentiality among all species while those lost lead to more questions and the search for reasons for their nonexistence within the genomes they were absent. The concept of representative genomes helps provide information on genes that might be absolutely essential for survival across species. However, this information should be used cautiously to prevent overlooking other genes that might be absolutely necessary for survival in other pathogenic species and thus potential drug targets. Such “representative genomes” could be used for comparative purposes leading to more questions driving research. Examples of such genes are frdABCD and narGHJI which have been lost from the genome of M. leprae but preserved in M. tuberculosis and M. bovis BCG and whose absence from the genomes of the latter under aerobic nutrient limiting conditions led to drastic attenuation in 105 growth and many logs of reduction in CFUs as shown in the present study. There was little information available on the functions and essentiality of the respiratory chain enzymes in M. tuberculosis. With SDH and FRD as examples, most of the information available on these enzymes was based on studies in E. coli and humans. This implied that in M. tuberculosis these enzymes were underexploited and had not been extensively studied. Kana et al, 2009 stated in their review that the role of SDH in M. tuberculosis was unclear and further work was required to fully characterize this and other enzymes of the Krebs cycle. Research results of this study have therefore added to the characterization of some of these enzymes by showing that their dispensability for growth and survival varies under different conditions. They may not be dispensable for growth under nutrient available aerobic conditions but once nutrients become limiting, they become necessary for survival due to the antioxidant properties they appear to have for the prevention and control of oxygen toxicity and ROS generation, “weapons of mass destruction”. From results of this project, the application of knowledge from basic science, and support from the studies of Ermilov and co-workers (1999), it is proposed that nutrient availability reduces molecular oxygen availability and ultimately ROS generation while nutrient limitation or starvation leads to the exact opposite increasing oxygen availability and the subsequent elevation of ROS levels causing bacteria to succumb, most especially bacilli with impaired antioxidant functions. Nutrients could therefore be considered as a form of natural “oxygen radical scavengers”. The presence of bactericidal antibiotics, massive depletion of NADH and the leaking of iron sulphur clusters present in the proposed antioxidant enzymes of the M. bovis BCG and Mtb 106 SDH and FRD mutants could have led to an induction of the ‘Fenton reaction’ resulting in the production of hydroxyl radicals (highly lethal ROS) and in the increase in sensitivity of the mutants particularly to cidal antibiotics under nutrient aerobic conditions and nutrient limiting conditions as seen in the impaired growth and reduced CFUs observed under Loebel cidal studies. The absence of SDH and heme b in the SDH mutant and thus no electron sink, might have increased the electron density at the FAD site and thus resulted in high ROS production leading to death in the presence of bactericidal antibiotics and under nutrient starved aerobic conditions while the absence of FRD might have hampered electron transfer and redox balancing leading to an increase in electron density and ROS production. Finally, in light of recent discoveries validating respiration as vulnerable in M. tuberculosis, potentiating certain respiratory pathway components, and based on the findings of this study on other vulnerable enzymes required for survival under defined conditions similar to those encountered during infection in man, the success in showing the viability of respiratory membrane vesicles and their possession of an intact ETC as well as their assayability is exciting and indicative of the feasibility of developing a biochemical assay for the routine screening of respiratory chain inhibitors. Notably, these results have also revealed the possibility of overcoming the cell wall; which has remained an obstacle, in drug screening projects. Further optimization is therefore required. 5.2 FUTURE WORK In light of severe attenuation and significant reduction of CFUs seen in SDH, NAR and FRD mutant studies it would be exciting to see how double and triple mutants would fare. Future work could therefore include double and/or triple mutant studies under nutrient limiting 107 conditions and drug pressure to further characterize these respiratory enzyme complexes. The present study could also be repeated solely under or incorporating other conditions such as hypoxia for a comparative analysis. Importantly, in vivo studies using these mutants to assess infection, pathology and disease development would be recommended and would paint the ultimate picture providing more data to further potentiate these respiratory complexes. It would be interesting to find out if the reduction in numbers of mutant bacteria seen in vitro would translate to fewer bacteria in vivo and reduced or abolished disease severity. Complementation studies to determine if wild type phenotypes could be successfully restored would be interesting and indeed helpful in the further characterization and potentiating of these enzymes. SDH mutant bacteria could for instance be complemented with wild type to determine if this mutant could be rescued with its growth being restored to wild type ability. To confirm the presence, levels and effects of ROS generated, quantitation experiments could be performed to measure ROS and to confirm if under nutrient starved aerobic conditions in comparison to conditions of nutrient availability more ROS are generated. It would also be interesting to study these mutants under nutrient available and starved anaerobic conditions and to measure ROS generation and levels under such conditions as well. It could be determined if in the presence of a ROS quencher such as thiourea; known to be highly effective in scavenging hydroxyl radicals, mutants grown under nutrient starved conditions could be rescued. This would help to further substantiate the hypothesis generated in this study that nutrient starved conditions lead to higher free molecular oxygen and thus ROS generation making nutrients somewhat ‘natural oxygen and thus ROS scavengers’. 108 Experiments could also be designed with the dye 2, 2’dipyridyl; which impedes the activation of the ‘Fenton reaction’ and also destroys hydroxyl radicals generated via this reaction, to monitor mutant survival potential for improvement in the presence of the bactericidal drugs under both nutrient rich aerobic and Loebel cidal drug studies. Using flow cytometric analysis, the flourescent reporter dye 3’-(p-hydroxyphenyl) flourescein could be used to measure hydroxyl radical formation of mutants grown under nutrient rich aerobic and starved conditions as well as before and after drug pressure in comparison to wild type bacilli. Finally, with the success achieved by this study in showing the viability of the respiratory membrane vesicles of M. smegmatis and M. bovis BCG as well as their possession of an intact ETC, it is proposed that the vesicle extraction of M. tuberculosis be carried out as well and the Vesicle assay be further optimized and standardized for larger scale and routine screening purposes for the identification of respiratory chain complex inhibitors. 109 CHAPTER 6 6.0 References Ackrell, B.A., Kearney, E.B., and Singer, T.P. (1978). Mammalian succinate dehydrogenase. Methods in enzymology 53, 466-483. Andries, K., Verhasselt, P., Guillemont, J., Gohlmann, H.W., Neefs, J.M., Winkler, H., Van Gestel, J., Timmerman, P., Zhu, M., Lee, E., et al. (2005). A diarylquinoline drug active on the ATP synthase of Mycobacterium tuberculosis. Science 307, 223-227. Aronson, N.E., Santosham, M., Comstock, G.W., Howard, R.S., Moulton, L.H., Rhoades, E.R., and Harrison, L.H. (2004). Long-term efficacy of BCG vaccine in American Indians and Alaska Natives: A 60-year follow-up study. JAMA : the journal of the American Medical Association 291, 2086-2091. Bardella, C., Pollard, P.J., and Tomlinson, I. (2011). SDH mutations in cancer. Biochimica et biophysica acta 1807, 1432-1443. Barry, C.E., 3rd, Boshoff, H.I., Dartois, V., Dick, T., Ehrt, S., Flynn, J., Schnappinger, D., Wilkinson, R.J., and Young, D. (2009). The spectrum of latent tuberculosis: rethinking the biology and intervention strategies. Nature reviews Microbiology 7, 845-855. Baysal, B.E., Ferrell, R.E., Willett-Brozick, J.E., Lawrence, E.C., Myssiorek, D., Bosch, A., van der Mey, A., Taschner, P.E., Rubinstein, W.S., Myers, E.N., et al. (2000). Mutations in SDHD, a mitochondrial complex II gene, in hereditary paraganglioma. Science 287, 848-851. Behr, M.A. (2002). BCG--different strains, different vaccines? The Lancet infectious diseases 2, 86-92. Behr, M.A., Wilson, M.A., Gill, W.P., Salamon, H., Schoolnik, G.K., Rane, S., and Small, P.M. (1999). Comparative genomics of BCG vaccines by whole-genome DNA microarray. Science 284, 1520-1523. 110 Betts, J.C., Lukey, P.T., Robb, L.C., McAdam, R.A., and Duncan, K. (2002). Evaluation of a nutrient starvation model of Mycobacterium tuberculosis persistence by gene and protein expression profiling. Molecular microbiology 43, 717-731. Boshoff, H.I., and Barry, C.E., 3rd (2005). Tuberculosis - metabolism and respiration in the absence of growth. Nature reviews Microbiology 3, 70-80. Bott, M., and Niebisch, A. (2003). The respiratory chain of Corynebacterium glutamicum. Journal of biotechnology 104, 129-153. Brandt, L., Feino Cunha, J., Weinreich Olsen, A., Chilima, B., Hirsch, P., Appelberg, R., and Andersen, P. (2002). Failure of the Mycobacterium bovis BCG vaccine: some species of environmental mycobacteria block multiplication of BCG and induction of protective immunity to tuberculosis. Infection and immunity 70, 672-678. Cecchini, G., Maklashina, E., Yankovskaya, V., Iverson, T.M., and Iwata, S. (2003). Variation in proton donor/acceptor pathways in succinate:quinone oxidoreductases. FEBS letters 545, 31-38. Cecchini, G., Schroder, I., Gunsalus, R.P., and Maklashina, E. (2002). Succinate dehydrogenase and fumarate reductase from Escherichia coli. Biochimica et biophysica acta 1553, 140-157. Cellestis. Quantiferon-TB gold. 2009. [Accessed 20 October 2009.] Available from URL: http://www.cellestis.com/ Centres for Disease Control and Prevention, Core Curriculum on Tuberculosis: What the Clinician Should Know, Transmission and Pathogenesis of Tuberculosis, (2011) Chapter2, Progression of TB, 5th Edition, pg 28-29 Chatterjee, S., Dwivedi, V.P., Singh, Y., Siddiqui, I., Sharma, P., Van Kaer, L., 111 Chattopadhyay, D., and Das, G. (2011). Early secreted antigen ESAT-6 of Mycobacterium tuberculosis promotes protective T helper 17 cell responses in a toll-like receptor-2-dependent manner. PLoS pathogens 7, e1002378. Cole, S.T., Eiglmeier, K., Parkhill, J., James, K.D., Thomson, N.R., Wheeler, P.R., Honore, N., Garnier, T., Churcher, C., Harris, D., et al. (2001). Massive gene decay in the leprosy bacillus. Nature 409, 1007-1011. Corbett El, W.C.J.W.N., and et al. (2003). The growing burden of tuberculosis: Global trends and interactions with the hiv epidemic. Archives of Internal Medicine 163, 1009-1021. Goble, M., Iseman, M.D., Madsen, L.A., Waite, D., Ackerson, L., and Horsburgh, C.R. (1993). Treatment of 171 Patients with Pulmonary Tuberculosis Resistant to Isoniazid and Rifampin. New England Journal of Medicine 328, 527-532. de Jong, B.C., Antonio, M., and Gagneux, S. (2010). Mycobacterium africanum--review of an important cause of human tuberculosis in West Africa. PLoS neglected tropical diseases 4, e744. de Kantor, I.N., LoBue, P.A., and Thoen, C.O. (2010). Human tuberculosis caused by Mycobacterium bovis in the United States, Latin America and the Caribbean. The international journal of tuberculosis and lung disease : the official journal of the International Union against Tuberculosis and Lung Disease 14, 1369-1373. Diacon, A.H., Pym, A., Grobusch, M., Patientia, R., Rustomjee, R., Page-Shipp, L., Pistorius, C., Krause, R., Bogoshi, M., Churchyard, G., et al. (2009). The diarylquinoline TMC207 for multidrug-resistant tuberculosis. The New England journal of medicine 360, 2397-2405. Dick, T. (2001). Dormant tubercle bacilli: the key to more effective TB chemotherapy? The Journal of antimicrobial chemotherapy 47, 117-118. Dimroth, P., and Cook, G.M. (2004). Bacterial Na+-or H+-coupled ATP Synthases Operating 112 at Low Electrochemical Potential. Advances in microbial physiology 49, 175-218. Dudkina, N.V., Eubel, H., Keegstra, W., Boekema, E.J., and Braun, H.P. (2005). Structure of a mitochondrial supercomplex formed by respiratory-chain complexes I and III. Proceedings of the National Academy of Sciences of the United States of America 102, 3225-3229. Dwyer, D.J., Kohanski, M.A., Hayete, B., and Collins, J.J. (2007). Gyrase inhibitors induce an oxidative damage cellular death pathway in Escherichia coli. Molecular systems biology 3, 91. Dye, C., and Williams, B.G. (2010). The population dynamics and control of tuberculosis. Science 328, 856-861. Dyer A. C., (2010) Biographies of Disease, Tuberculosis, Greenwood Press, pg 29-33 Edson, N.L. (1951). The intermediary metabolism of the mycobacteria. Bacteriological reviews 15, 147-182. Ehlers, M.R. (1993). The wolf at the door. Some thoughts on the biochemistry of the tubercle bacillus. South African medical journal = Suid-Afrikaanse tydskrif vir geneeskunde 83, 900903. Eng, R.H., Padberg, F.T., Smith, S.M., Tan, E.N., and Cherubin, C.E. (1991). Bactericidal effects of antibiotics on slowly growing and nongrowing bacteria. Antimicrobial agents and chemotherapy 35, 1824-1828. Ermilov, A., Diamond, M.P., Sacco, A.G., and Dozortsev, D.D. (1999). Culture media and their components differ in their ability to scavenge reactive oxygen species in the plasmid relaxation assay. Fertility and sterility 72, 154-157. Fine, P.E. (1995). Variation in protection by BCG: implications of and for heterologous immunity. Lancet 346, 1339-1345. 113 Flores, L.L., Pai, M., Colford, J.M., Jr., and Riley, L.W. (2005). In-house nucleic acid amplification tests for the detection of Mycobacterium tuberculosis in sputum specimens: meta-analysis and meta-regression. BMC microbiology 5, 55. Gengenbacher, M., Rao, S.P., Pethe, K., and Dick, T. (2010). Nutrient-starved, nonreplicating Mycobacterium tuberculosis requires respiration, ATP synthase and isocitrate lyase for maintenance of ATP homeostasis and viability. Microbiology 156, 81-87. Gilman G. A, Goodman L.S., Limberd Lee E., Milinoff P.B.,Ruddon R.W. (1996) Goodman and Gilman’s The Pharmacological Basis of Therapeutics, 9TH ED., Mcgraw-Hill, pg1160 Gennis R.B., Stewart V. (1996) Respiration. In: Escherichia coli and Salmonella: Cellular and Molecular Biology. Neidhardt F.C., editor Vol. 1. ASM Press; Washington, D.C.:. pp. 217– 261. Gilpin, C., Kim, S.J., Lumb, R., Rieder, H.L., and Van Deun, A. (2007). Critical appraisal of current recommendations and practices for tuberculosis sputum smear microscopy. The international journal of tuberculosis and lung disease : the official journal of the International Union against Tuberculosis and Lung Disease 11, 946-952. Ginsberg, A.M., Laurenzi, M.W., Rouse, D.J., Whitney, K.D., and Spigelman, M.K. (2009). Safety, tolerability, and pharmacokinetics of PA-824 in healthy subjects. Antimicrobial agents and chemotherapy 53, 3720-3725. Goble, M., Iseman, M.D., Madsen, L.A., Waite, D., Ackerson, L., and Horsburgh, C.R. (1993). Treatment of 171 Patients with Pulmonary Tuberculosis Resistant to Isoniazid and Rifampin. New England Journal of Medicine 328, 527-532. Golden, M.P., and Vikram, H.R. (2005). Extrapulmonary tuberculosis: an overview. American family physician 72, 1761-1768. 114 Guroff M., The Patient Scientist (2007) The Magazine of the Johns Hopkins Bloomberg School of Public Health, Online Edition Hederstedt, L., and Rutberg, L. (1981). Succinate dehydrogenase--a comparative review. Microbiological reviews 45, 542-555. Hippocrates, Of The Epidemics, Book I, Section I. First Constitution, Translated by Francis Adams Hoekstra, D., van der Laan, J.W., de Leij, L., and Witholt, B. (1976). Release of outer membrane fragments from normally growing Escherichia coli. Biochimica et biophysica acta 455, 889-899. Hurdle, J.G., O'Neill, A.J., Chopra, I., and Lee, R.E. (2011). Targeting bacterial membrane function: an underexploited mechanism for treating persistent infections. Nature reviews Microbiology 9, 62-75. Im, J.G., Itoh, H., Shim, Y.S., Lee, J.H., Ahn, J., Han, M.C., and Noma, S. (1993). Pulmonary tuberculosis: CT findings--early active disease and sequential change with antituberculous therapy. Radiology 186, 653-660. Imlay, J.A. (2008). Cellular defenses against superoxide and hydrogen peroxide. Annual review of biochemistry 77, 755-776. Kana B. D., Machowski E.E., Schechter N., Teh J-S, Rubin H., Mizrahi V. (2009) Electron Transport and Respiration in Mycobacteria, Mycobacterium Genomics and Molecular Biology edited by Parish T. and Brown A. Chapter 3, 35-64 Kato, S., Kowashi, Y., and Demuth, D.R. (2002). Outer membrane-like vesicles secreted by Actinobacillus actinomycetemcomitans are enriched in leukotoxin. Microbial pathogenesis 32, 1-13. 115 Kohanski, M.A., Dwyer, D.J., Hayete, B., Lawrence, C.A., and Collins, J.J. (2007). A common mechanism of cellular death induced by bactericidal antibiotics. Cell 130, 797-810. Kohanski, M.A., Dwyer, D.J., Wierzbowski, J., Cottarel, G., and Collins, J.J. (2008). Mistranslation of membrane proteins and two-component system activation trigger antibioticmediated cell death. Cell 135, 679-690. Kohl, N.E., Emini, E.A., Schleif, W.A., Davis, L.J., Heimbach, J.C., Dixon, R.A., Scolnick, E.M., and Sigal, I.S. (1988). Active human immunodeficiency virus protease is required for viral infectivity. Proceedings of the National Academy of Sciences of the United States of America 85, 4686-4690.Koul, A., Arnoult, E., Lounis, N., Guillemont, J., and Andries, K. (2011). The challenge of new drug discovery for tuberculosis. Nature 469, 483-490.Koul, A., Dendouga, N., Vergauwen, K., Molenberghs, B., Vranckx, L., Willebrords, R., Ristic, Z., Lill, H., Dorange, I., Guillemont, J., et al. (2007). Diarylquinolines target subunit c of mycobacterial ATP synthase. Nature chemical biology 3, 323-324. Krausslich, H.G., Ingraham, R.H., Skoog, M.T., Wimmer, E., Pallai, P.V., and Carter, C.A. (1989). Activity of purified biosynthetic proteinase of human immunodeficiency virus on natural substrates and synthetic peptides. Proceedings of the National Academy of Sciences of the United States of America 86, 807-811. Kuehn, M.J., and Kesty, N.C. (2005). Bacterial outer membrane vesicles and the hostpathogen interaction. Genes & development 19, 2645-2655. Kulp, A., and Kuehn, M.J. (2010). Biological functions and biogenesis of secreted bacterial outer membrane vesicles. Annual review of microbiology 64, 163-184. L'Homme R, F., Nijland, H.M., Gras, L., Aarnoutse, R.E., van Crevel, R., Boeree, M., Brinkman, K., Prins, J.M., Juttmann, J.R., and Burger, D.M. (2009). Clinical experience with 116 the combined use of lopinavir/ritonavir and rifampicin. AIDS 23, 863-865. Lancaster, C.R. (2002). Succinate:quinone oxidoreductases: an overview. Biochimica et biophysica acta 1553, 1-6. Lancaster, C.R., and Kroger, A. (2000). Succinate: quinone oxidoreductases: new insights from X-ray crystal structures. Biochimica et biophysica acta 1459, 422-431. Lars R. (1974), Role of Undecaprenyl Phosphokinase in mycobacteria: impact on biofilm formation, growth properties, persistence, and virulence Dissertation, pg 14 Lee, K.S., and Im, J.G. (1995). CT in adults with tuberculosis of the chest: characteristic findings and role in management. AJR American journal of roentgenology 164, 1361-1367. Lenaerts, A.J., Gruppo, V., Marietta, K.S., Johnson, C.M., Driscoll, D.K., Tompkins, N.M., Rose, J.D., Reynolds, R.C., and Orme, I.M. (2005). Preclinical testing of the nitroimidazopyran PA-824 for activity against Mycobacterium tuberculosis in a series of in vitro and in vivo models. Antimicrobial agents and chemotherapy 49, 2294-2301. Lenaerts, A.J., Hoff, D., Aly, S., Ehlers, S., Andries, K., Cantarero, L., Orme, I.M., and Basaraba, R.J. (2007). Location of persisting mycobacteria in a Guinea pig model of tuberculosis revealed by r207910. Antimicrobial agents and chemotherapy 51, 3338-3345. Loeb, M.R., and Kilner, J. (1979). Effect of growth medium on the relative polypeptide composition of cellular outer membrane and released outer membrane material in Escherichia coli. Journal of bacteriology 137, 1031-1034. MacMicking, J.D., North, R.J., LaCourse, R., Mudgett, J.S., Shah, S.K., and Nathan, C.F. (1997). Identification of nitric oxide synthase as a protective locus against tuberculosis. Proceedings of the National Academy of Sciences of the United States of America 94, 52435248. Maklashina, E., Berthold, D.A., and Cecchini, G. (1998). Anaerobic expression of Escherichia 117 coli succinate dehydrogenase: functional replacement of fumarate reductase in the respiratory chain during anaerobic growth. Journal of bacteriology 180, 5989-5996. Manjunatha, U., Boshoff, H.I., and Barry, C.E. (2009). The mechanism of action of PA-824: Novel insights from transcriptional profiling. Communicative & integrative biology 2, 215218. Martin, C. (2006). Tuberculosis vaccines: past, present and future. Current opinion in pulmonary medicine 12, 186-191. Mashburn-Warren, L., McLean, R.J., and Whiteley, M. (2008). Gram-negative outer membrane vesicles: beyond the cell surface. Geobiology 6, 214-219. Mashburn, L.M., and Whiteley, M. (2005). Membrane vesicles traffic signals and facilitate group activities in a prokaryote. Nature 437, 422-425. Mc, D.W. (1958). Microbial persistence. The Yale journal of biology and medicine 30, 257291. McGuinness, G., Naidich, D.P., Jagirdar, J., Leitman, B., and McCauley, D.I. (1992). High resolution CT findings in miliary lung disease. Journal of computer assisted tomography 16, 384-390. McNeil, M.R., and Brennan, P.J. (1991). Structure, function and biogenesis of the cell envelope of mycobacteria in relation to bacterial physiology, pathogenesis and drug resistance; some thoughts and possibilities arising from recent structural information. Research in microbiology 142, 451-463. Messner, K.R., and Imlay, J.A. (2002). Mechanism of superoxide and hydrogen peroxide formation by fumarate reductase, succinate dehydrogenase, and aspartate oxidase. The Journal of biological chemistry 277, 42563-42571. Miesel, L., Weisbrod, T.R., Marcinkeviciene, J.A., Bittman, R., and Jacobs, W.R., Jr. (1998). 118 NADH dehydrogenase defects confer isoniazid resistance and conditional lethality in Mycobacterium smegmatis. Journal of bacteriology 180, 2459-2467. Minnikin, D.E. (1991). Chemical principles in the organization of lipid components in the mycobacterial cell envelope. Research in microbiology 142, 423-427. Murray, J.F. (2004). Mycobacterium tuberculosis and the cause of consumption: from discovery to fact. American journal of respiratory and critical care medicine 169, 1086-1088. Nguyen, D., Joshi-Datar, A., Lepine, F., Bauerle, E., Olakanmi, O., Beer, K., McKay, G., Siehnel, R., Schafhauser, J., Wang, Y., et al. (2011). Active starvation responses mediate antibiotic tolerance in biofilms and nutrient-limited bacteria. Science 334, 982-986. Niemann, S., and Muller, U. (2000). Mutations in SDHC cause autosomal dominant paraganglioma, type 3. Nature genetics 26, 268-270. Niemi, M., Backman, J.T., Fromm, M.F., Neuvonen, P.J., and Kivisto, K.T. (2003). Pharmacokinetic interactions with rifampicin : clinical relevance. Clinical pharmacokinetics 42, 819-850. Nikaido, H. (1994). Prevention of drug access to bacterial targets: permeability barriers and active efflux. Science 264, 382-388. Noor F, Choudhury S, Choudhury SAR (2011). Understanding Tuberculosis. Ibrahim Card Med J 1(2), 56-58 Nuermberger, E.L., Yoshimatsu, T., Tyagi, S., O'Brien, R.J., Vernon, A.N., Chaisson, R.E., Obermeyer, Z., Abbott-Klafter, J., and Murray, C.J. (2008). Has the DOTS strategy improved case finding or treatment success? An empirical assessment. PloS one 3, e1721. OxfordImmunotec. T.Spot-TB. 2009. [Accessed 20 Dec 2009.] Available from URL: http://www.oxfordimmunotec.com/ North_America 119 Pachar M., (2011) Diagnostic Methods for Tuberculosis: Past, Present and Future, Health, Medical Issues, Robben Island Official Blog of the Centre for African Affairs and Global Peace Prados-Rosales, R., Baena, A., Martinez, L.R., Luque-Garcia, J., Kalscheuer, R., Veeraraghavan, U., Camara, C., Nosanchuk, J.D., Besra, G.S., Chen, B., et al. (2011). Mycobacteria release active membrane vesicles that modulate immune responses in a TLR2dependent manner in mice. The Journal of clinical investigation 121, 1471-1483. Rao, S.P.S., Alonso, S., Rand, L., Dick, T., and Pethe, K. (2008). The protonmotive force is required for maintaining ATP homeostasis and viability of hypoxic, nonreplicating Mycobacterium tuberculosis. Proceedings of the National Academy of Sciences of the United States of America 105, 11945-11950. Raviglione, M.C., and Uplekar, M.W. (2006). WHO's new Stop TB Strategy. Lancet 367, 952-955. Raygada, M., Pasini, B., and Stratakis, C.A. (2011). Hereditary paragangliomas. Advances in oto-rhino-laryngology 70, 99-106. Rutter, J., Winge, D.R., and Schiffman, J.D. (2010). Succinate dehydrogenase - Assembly, regulation and role in human disease. Mitochondrion 10, 393-401. Sarmiento, O.L., Weigle, K.A., Alexander, J., Weber, D.J., and Miller, W.C. (2003). Assessment by meta-analysis of PCR for diagnosis of smear-negative pulmonary tuberculosis. Journal of clinical microbiology 41, 3233-3240. Sassetti, C.M., Boyd, D.H., and Rubin, E.J. (2003). Genes required for mycobacterial growth defined by high density mutagenesis. Molecular microbiology 48, 77-84. Schooling, S.R., and Beveridge, T.J. (2006). Membrane vesicles: an overlooked component of 120 the matrices of biofilms. Journal of bacteriology 188, 5945-5957. Seelmeier, S., Schmidt, H., Turk, V., and von der Helm, K. (1988). Human immunodeficiency virus has an aspartic-type protease that can be inhibited by pepstatin A. Proceedings of the National Academy of Sciences of the United States of America 85, 6612-6616. Senoo-Matsuda, N., Yasuda, K., Tsuda, M., Ohkubo, T., Yoshimura, S., Nakazawa, H., Hartman, P.S., and Ishii, N. (2001). A defect in the cytochrome b large subunit in complex II causes both superoxide anion overproduction and abnormal energy metabolism in Caenorhabditis elegans. The Journal of biological chemistry 276, 41553-41558. Sharma, S.K., and Mohan, A. (2004). Extrapulmonary tuberculosis. The Indian journal of medical research 120, 316-353. Shatalin, K., Shatalina, E., Mironov, A., and Nudler, E. (2011). H2S: a universal defense against antibiotics in bacteria. Science 334, 986-990. Shetty, A., Chen, S., Tocheva, E.I., Jensen, G.J., and Hickey, W.J. (2011). Nanopods: a new bacterial structure and mechanism for deployment of outer membrane vesicles. PloS one 6, e20725. Shui, G., Bendt, A.K., Jappar, I.A., Lim, H.M., Laneelle, M., Herve, M., Via, L.E., Chua, G.H., Bratschi, M.W., Zainul Rahim, S.Z., et al. (2012). Mycolic acids as diagnostic markers for tuberculosis case detection in humans and drug efficacy in mice. EMBO molecular medicine 4, 27-37. Smith and Reynard, Textbook of Pharmacology, 1992, pg 863 Sohaskey, C.D., and Wayne, L.G. (2003). Role of narK2X and narGHJI in hypoxic upregulation of nitrate reduction by Mycobacterium tuberculosis. Journal of bacteriology 185, 7247-7256. Steingart, K.R., Ng, V., Henry, M., Hopewell, P.C., Ramsay, A., Cunningham, J., Urbanczik, 121 R., Perkins, M.D., Aziz, M.A., and Pai, M. (2006). Sputum processing methods to improve the sensitivity of smear microscopy for tuberculosis: a systematic review. The Lancet infectious diseases 6, 664-674. Tan, M.P., Sequeira, P., Lin, W.W., Phong, W.Y., Cliff, P., Ng, S.H., Lee, B.H., Camacho, L., Schnappinger, D., Ehrt, S., et al. (2010). Nitrate respiration protects hypoxic Mycobacterium tuberculosis against acid- and reactive nitrogen species stresses. PloS one 5, e13356 Toth, A., Fackelmann, J., Pigott, W., and Tolomeo, O. (2004). Tuberculosis prevention and treatment. The Canadian nurse 100, 27-30. Trnka, L., and Smith, D.W. (1970). Proteosynthetic activity of isolated ribosomes of Mycobacteria and its alteration by rifampicin and related tuberculostatic drugs. Antibiotics and chemotherapy 16, 369-379. Trusov, A., Bumgarner, R., Valijev, R., Chestnova, R., Talevski, S., Vragoterova, C., and Neeley, E.S. (2009). Comparison of Lumin LED fluorescent attachment, fluorescent microscopy and Ziehl-Neelsen for AFB diagnosis. The international journal of tuberculosis and lung disease : the official journal of the International Union against Tuberculosis and Lung Disease 13, 836-841. Van Hellemond, J.J., and Tielens, A.G. (1994). Expression and functional properties of fumarate reductase. The Biochemical journal 304 ( Pt 2), 321-331. Velmurugan, K., Chen, B., Miller, J.L., Azogue, S., Gurses, S., Hsu, T., Glickman, M., Jacobs, W.R., Jr., Porcelli, S.A., and Briken, V. (2007). Mycobacterium tuberculosis nuoG is a virulence gene that inhibits apoptosis of infected host cells. PLoS pathogens 3, e110.Warner, D.F., and Mizrahi, V. (2006). Tuberculosis chemotherapy: the influence of bacillary stress and damage response pathways on drug efficacy. Clinical microbiology reviews 19, 558-570.Wayne, L.G., and Hayes, L.G. (1996). An in vitro model for sequential 122 study of shiftdown of Mycobacterium tuberculosis through two stages of nonreplicating persistence. Infection and immunity 64, 2062-2069.Wayne, L.G., and Sohaskey, C.D. (2001). Nonreplicating persistence of mycobacterium tuberculosis. Annual review of microbiology 55, 139-163. Weber, I., Fritz, C., Ruttkowski, S., Kreft, A., and Bange, F.C. (2000). Anaerobic nitrate reductase (narGHJI) activity of Mycobacterium bovis BCG in vitro and its contribution to virulence in immunodeficient mice. Molecular microbiology 35, 1017-1025. World Health Organization Map ,Tuberculosis, Fact Sheet (2012). No. 104 World Health Organization Map Production, Public Health Information and Geographic Information Systems (2012) WHO Global TB Control Report, The Global Burden of TB, Estimated epidemiological burden of TB, 2009, Table 1, Pg. 5, 2010 WHO. New WHO policy and retooling activities for liquid culture systems. [Accessed 20 Dec 2009.]. Available from URL: http://www.who.int/tb/research/retooling/en/index.html World Health Organization. Geneva: World Health Organization (2007). Global Tuberculosis Control: surveillance, planning, financing WHO. Global Tuberculosis Control (2009). Epidemiology,Strategy, Financing, Geneva Yankovskaya, V., Horsefield, R., Tornroth, S., Luna-Chavez, C., Miyoshi, H., Leger, C., Byrne, B., Cecchini, G., and Iwata, S. (2003). Architecture of succinate dehydrogenase and reactive oxygen species generation. Science 299, 700-704. http://www.drugbank.ca/drugs 123 http://www.eoearth.org/article/History_of_pathogenstopic=4955 http://www.goodreads.com/quotes/tag/past http://www.emedicinehealth.com/tuberculosis/page3_em.htm http://www.cdc.gov/tb/education/corecurr/pdf/chapter2.pdf http://www.mayoclinic.com/health/tuberculosis/DS00372/DSECTION=prevention http://www.caaglop.com/robbenisland-blog/tag/medical-debate/ http://whc.unesco.org/en/list/438/ http //genolist.pasteur.fr/tuberculist http://people.oregonstate.edu/~mahmudt/pictures/Mycobacterium cell envelope.jpg http://pubchem.ncbi.nlm.nih.gov/summary/summary.cgi?cid=3000502 www.cdc.gov/tb/publications/factsheet/testing/skintesting.htm www.ncbi.nlm.nih.gov/BLAST/Blast.cgi 124 APPENDIX MIC DRUG CONCENTRATIONS RIF MOXI INH STREP PAS CYCLO 0.025 2 2 2 2 2 0.0125 1 1 1 1 1 0.00625 0.5 0.5 0.5 0.5 0.5 0.003125 0.25 0.25 0.25 0.25 0.25 0.001563 0.125 0.125 0.125 0.125 0.125 0.000781 0.0625 0.0625 0.0625 0.0625 0.0625 0.000391 0.03125 0.03125 0.03125 0.03125 0.03125 0.000195 0.015625 0.015625 0.015625 0.015625 0.015625 9.77E-05 0.007813 0.007813 0.007813 0.007813 0.007813 4.88E-05 0.003906 0.003906 0.003906 0.003906 0.003906 2.44E-05 0.001953 0.001953 0.001953 0.001953 0.001953 125 ANNEXE 1 GENERATION OF KNOCK-OUT MUTANTS AND COMPLEMENTED STRAINS OF M. BOVIS BCG Disruption of mycobacterial genes All disruptions in the knock-out strains were obtained using allelic exchange (homologous recombination) method as described (Bardarov et al, 2002). The general mechanism of allelic exchange is to construct a gene replacement cassette, followed by transforming into the cells and further selected as depicted schematically (Figure ANNEXE 1). 126 Figure ANNEXE 1: Gene disruption using homologous recombination method. (A) Construction of gene replacement cassette. (B). Transformation and selection. Construction of knock-out (gene replacement) plasmids To generate an allelic exchange substrate for gene replacement, chromosomal sequences flanking the gene of interest were PCR-amplified from M. tuberculosis H37Rv genomic DNA. Primers used in generating the various gene replacement constructs are listed in Table ANNEXE 1. The cloned fragments (without mutation) were subsequently introduced one after the other into the allelic exchange plasmid vector pYUB854, flanking the hygromycin resistance gene as a result. The final fragment to be introduced was excised from pGOAL17 plasmid at its PacI sites. This fragment containing lacZ and sacB marker genes was cloned into the different intermediate pYUB854 vectors to generate knock-out plasmids. Making of the NUO and NAR mutants were reported earlier in Rao et al., 2008 and Tan et a., 2010 studies, respectively. TABLE ANNEXE 1: PCR primers to amplify 5’ and 3’-flanks of mycobacterial genes Gene Flank Sequence (5’-3’)a SDH 5’ b F: CGACTAGTCGCAGGCGGCGACGACGGGCA R: GCAAGCTTCCGCAGCCATGGCGGCGTCCAG 3’ c F: GCTCTAGACGCCGCCGAGCGCCTCGACAT R: CGCTTAAGCTGCCGACTTCACCGTTGTAC FRD 5’ d F: CGACTAGGCCGATAACCACGATGTTGTGTT R: GCAAGCTTCGCAACACCGCGATCCATATCCT 3’ e F: ATCCATGGGTTACGGCATGGCCGTGTTG R: ATTTCGAACGCAGCCAACTTGTCCAAGGT 127 a F, Forward; R, Reverse b Restriction sites of 3’ flank: R, HindIII; F, SpeI c Restriction sites of 5’ flank: R, AflII; F, XbaI d Restriction sites of 3’ flank: R, HindIII; F, SpeI e Restriction sites of 5’ flank: R, BstBI; F, NcoI 128 [...]... out (Lee et al, 1995; Im et al, 1993; McGuinness et al, 1992).The tuberculin skin test also known as the Mantoux test, involves intradermally injecting an individual with the tuberculin purified protein derivative (PPD) in the inner surface of the forearm Within 48-72 hours after administration, results of the diagnosis are determined by a pale swelling of the skin known as a wheal This test is considered... 1 present in selected Mycobacteria 54 Fig 3.2 Subunits of Succinate Dehydrogenase present in selected Mycobacteria 58 Fig 3.3 Subunits of Fumarate Reductase present in selected Mycobacteria 59 Fig 3.4 Subunits of the Rv0247-9c present in selected Mycobacteria 60 Fig 3.5 Subunits of Nitrate Reductase present in selected Mycobacteria 62 Fig 3.6 Legend describing the coding sequences of the respiratory. .. notable inhibitory effect of specific fungi, the actinomycetes, on the growth of bacteria With these encouraging 12 results, he, along with his team attempted and successfully isolated actinomycin, a potent antibiotic against tuberculosis Unfortunately however, actinomycin had high toxicity Not long after this disappointing finding, the team found streptomycin from the fungi, Streptomyces griseus, in 1943... specifying certain drug combinations for therapy 14 In the treatment of drug susceptible TB, there is given within the first two months, Isoniazid, a Rifamycin such as Rifampicin, Rifabutin, Rifapentine, as well as Ethambutol and Pyrazinamide This is then followed by doses of Isoniazid and a Rifamycin for another 4 months If the regimen and timing are followed perfectly, individuals could be cured within... reductase, InhA by forming a bond with the cofactor NAD and competing with InhA (http://www.drugbank.ca/drugs/DB00951) It is classified as a first line drug for TB treatment An aminoglycoside from Streptomyces griseus, it binds to the 30S STREPTOMYCIN ribosomal subunit and interferes with the initiation and elongation steps in protein synthesis Specifically, it binds to the 16S rRNA and an amino acid... also interfere with the synthesis of spermidine (Smith and Reynard, 1992) It is bacteriostatic and inhibits folic acid synthesis by binding to p-AMINO SALYCYLIC ACID pteridine synthetase, an enzyme which binds to para-aminobenzoic acid towards the formation of folic acid By binding to pteridine synthatase and cutting off the supply of folic acid, the growth and division of the bacteria slows down since... dividing cells was also developed in the 1950’s and used in combination with Streptomycin and PAS Pyrazinamide, Ethambutol, Ethionamide and Cycloserine were developed in the years following development of the first three drugs previously discussed Cycloserine for example was used in cases where individuals had developed resistance to the prioritized drugs (Goble et al, 1993) Another notable event in. .. contained by the immune system and cleared, however, in 50-60% of cases, the disease makes a come back Tuberculosis pleuritis may develop in about 10% of individuals with pulmonary tuberculosis when nodules containing bacteria rapture into the pleural space located between the lung and lining of the abdominal cavity (http://www.emedicinehealth.com) Tuberculosis can develop in the lungs (pulmonary) or in. .. protective efficacy in adults has been a challenge Protective efficacy of the BCG vaccine against Pulmonary tuberculosis was found between 0 to 70% in India and the UK, respectively (Fine, 1995) Many reasons for the variation in efficacy have been proposed including the possibility of prior exposure to environmental mycobacteria (Brandt et al, 2002) especially in developing countries as well as in the tropics... protein S12 leading to misreading of mRNA, insertion of incorrect amino acids and the formation of nonsense, toxic 15 peptides (http://www.drugbank.ca/drugs/DB01082) It is a flouroquinolone and is bactericidal It prevents DNA replication by binding to DNA gyrase (topoisomearse II), an enzyme that causes the unwinding of the DNA double helix, an action necessarily required for the reading and coping ... Mantoux test, involves intradermally injecting an individual with the tuberculin purified protein derivative (PPD) in the inner surface of the forearm Within 48-72 hours after administration,... isolated actinomycin, a potent antibiotic against tuberculosis Unfortunately however, actinomycin had high toxicity Not long after this disappointing finding, the team found streptomycin from the... subunit and interferes with the initiation and elongation steps in protein synthesis Specifically, it binds to the 16S rRNA and an amino acid of the protein S12 leading to misreading of mRNA, insertion