Molecular mechanism of self renewal exit during endothelial differentiation

MOLCULAR MECHANISM OF SELF-RENEWAL EXIT DURING ENDOTHELIAL DIFFERENTIATION QUE JIANWEN NATIONAL UNIVERSITY OF SINGAPORE 2005 MOLCULAR MECHANISM OF SELF-RENEWAL EXIT DURING ENDOTHELIAL DIFFERENTIATION QUE JIANWEN (B. Med., China) A THESIS SUBMITTED FOR THE DEGREE OF DOCTOR OF PHILOSOPHY OF MEDICINE DEPARTMENT OF SURGERY NATIONAL UNIVERSITY OF SINGAPORE 2005 i ACKNOWLEDGMENT I would like to express my deep respect and gratitude to my main supervisor, Associate Professor Sai Kiang Lim (Genome Institute of Singapore) and co-supervisor Associate Professor Reida Oakley (Department of Surgery, NUS) for their valuable guidance and support during the course of this project. Without them, this thesis could not be produced in the present form. I am eternally grateful for the many opportunities given to me to explore the biological world as well as making progress in my life. I also thank Associate Professor Lim Bing (Genome Institute of Singapore and Harvard Medical School) and Dr Manuel Salto-Tellez (Department of Pathology, NUS) for experimental consultation. Thanks also go to past and present laboratory colleagues – Dr. Yin Yijun, Dr. Yu Fenggang, Dr. Lian Qizhou, Rani D/O Ettikkan, Yeo Keng Suan, Sharon Lim, Tiffany Tang, Marthia Lee, Lee Shee Han and others for their friendship and assistance. Special thanks extend to Dr. Andrew Hutchins for his helpful suggestions and revision of this thesis. I wish to extend my regards to the staff and students of Dept. of Surgery and Genome Institute of Singapore for their kind support and assistance during my study. I deeply appreciate the administrative assistance of Ms. Cecilia and Ms. Anne. I am grateful to my wife Li Haiyan for her love, understanding and encouragement throughout her course. Further extension of my appreciation is to my parents for their spiritual support. ii CONTENTS ACKNOWLEDGMENT Table of Contents List of Figures Abbreviation Summary Publication CHAPTER 1.1 i ii vi viii xi xii INTRODUCTION General statement 1.2 Mouse vascular development 1.2.1 Overview of vasculogenesis during mammalian development 1.2.2 Hemangioblast 1.2.3 Endothelial progenitor/stem cells 5 11 1.3 Molecular mechanisms of endothelial differentiation 1.3.1 Relationship between self-renewal and differentiation 1.3.2 Overview of Cell cycle 1.3.2.1 Cyclins 1.3.2.2 Cdks and CKIs 1.3.2.3 G1/S transition 1.3.2.4 Role of cell cycle in differentiating cells 1.3.2.5 Unique cell cycle control in murine stem cells 1.3.3 Signaling Pathways involved in the self-renewal and differentiation 1.3.3.1 Signaling pathways involved in the self-renewal and differentiation using ES as an example 1.3.3.2 PI3K signaling through mammalian Target Of Rapamycin (mTOR) 1.3.3.3 Overview of mTOR 1.3.3.4 Translational regulation by mTOR through S6K1 and 4E-BP1 1.3.3.4. mTOR regulation of 4E-BP1 1.3.3.4. mTOR regulation of S6K1 1.3.3.4. Other putative targets of mTOR-mediated translational regulation 1.3.3.4. Rapamycin-inhibitor of mTOR 13 13 14 15 17 18 19 20 21 1.4 Specific aims of the present study 1.4.1 Derivation and characterization of stem cell lines with endothelial potential from embryos 1.4.2 Understand the molecular mechanism underlying the switch from self-renewal to differentiation during endothelial differentiation 37 CHAPTER 40 2.1 Cell culture 2.1.1 Rosh cells MATERIALS AND METHODS 21 26 27 31 32 33 35 36 38 39 41 41 iii 2.1.1.1 Derivation of Rosh cells 2.1.1.1.1 Harvesting 5.5 dpc delayed blastocysts 2.1.1.1.2 Dissection of 6.0-7.5 dpc embryos 2.1.1.2 Culture of blastocysts and embryos 2.1.1.3 Establishment of cell lines 2.1.1.4 Karyotyping 2.1.1.5 RoSH2 cell culture 2.1.2 ES cell culture 2.1.3 MEL cell culture 2.1.4 Drug treatment 2.1.4.1 Treatment of RoSH2 cells 2.1.4.1.1 Rapamycin 2.1.4.1.2 Gleevec 2.1.4.1.3 Other drugs 2.1.4.2 Treatment of ES and MEL cells with rapamycin 41 41 41 42 43 43 44 45 45 45 45 45 46 46 47 2.2 2.2.1 2.2.2 2.2.3 2.2.4 Transplantation studies Animal handling Test of tumorigenic ability Co-transplantation of ES and RoSH2 cells RoSH2 cell transplantation into liver injury model 47 47 47 48 48 2.3 2.3.1 2.3.2 2.3.3 2.3.4 2.3.5 2.3.6 2.3.7 2.3.8 Tissue analysis Immunohitstochemistry staining Immunofluorescent staining Fluorescence activated cell sorting (FACs) analysis ImageneGreen staining Propidium iodide staining X-gal staining Acetylated LDL uptake and SYTOX fluorescent staining Electron microscopy 49 49 50 51 51 52 52 53 53 2.4 Cell cycle analysis 2.4.1 Calculation of cell cycle 2.4.2 G1 phase analysis 54 54 54 2.5 RNA analysis 2.5.1 RNA isolation 2.5.1.1 Total cellular RNA isolation 2.5.1.2 Polysome-associated RNA isolation 2.5.2 RNA integrity analysis 55 55 55 56 56 2.6 Reverse transcriptase-polymerase chain reaction (RT-PCR) 57 2.7 Microarray analysis 58 2.8 Protein analysis 2.8.1 Protein extraction and quantitation 2.8.2 Western blot 59 59 59 iv CHAPTER RESULTS Derivation and characterization of cell lines with endothelial potential from delayed blastocysts and earlier embryos 3.1.1 Introduction 3.1.2 Collection of embryos for derivation of endothelial progenitor cell lines 3.1.3 Embryo culture 3.1.4 Isolation and establishment of cell lines 3.1.5 Characterization of endothelial potential of cell lines 3.1.5.1 Morphology and culture requirements 3.1.5.2 Confirmation of the source of RoSH2 cells 3.1.5.3 Population doubling time 3.1.5.4 Karyotype 3.1.5.5 Tumorigenesis 3.1.5.6 In vitro endothelial differentiation 3.1.5.6.1 Endothelial differentiation condition 3.1.5.6.2 Verification of endothelial cells 3.1.5.6.2.1 Endothelial gene expression 3.1.5.6.2.2 Endothelial surface markers 3.1.5.6.2.3 Endothelial function study 3.1.5.7 In vivo endothelial differentiation 61 3.1 Study of the molecular mechanism underlying the decisionmaking between self-renewal and differentiation in stem cells 3.2.1 Introduction 3.2.2 Molecular mechanism underlying endothelial differentiation 3.2.2.1 Cell cycle reduction during endothelial differentiation 3.2.2.2 Cyclin D2 responsible for reduced cell cycle activity during endothelial differentiation 3.2.2.2.1 Microarray analysis implied translational control of cyclin D2 3.2.2.2.1.1 Microarray analysis 3.2.2.2.1.2 Verification of microarray data 3.2.2.2.1.3 Implication of translational regulation of cyclin D2 3.2.2.2.2 Verification by RT-PCR and western blot 3.2.2.3 mTOR/PI3K pathway-mediated translational regulation during endothelial differentiation 3.2.2.3.1 Implication of mTOR-mediated translational regulation during endothelial differentiation 3.2.2.3.2 Decreased mTOR activity after differentiation evident by 4EBP1 and S6K1 phosphorylation state 3.2.2.3.3 Reduction in cell cycle activity by treatment with mTOR inhibitor rapamycin 3.2.2.3.4 Cyclin D2 protein is under mTOR-mediated translational regulation 3.2.2.3.5 PI3K/mTOR pathway-mediated translation regulation 3.2.2.3.6 Translational regulation is not mediated by Raf/MEK/Erk pathway 3.2.2.3.7 Non mTOR-mediated cell cycle arrest leads to no 62 62 62 63 65 66 66 67 68 68 70 70 70 72 72 73 75 76 3.2 79 79 79 79 83 83 83 84 88 89 92 92 92 96 98 100 103 106 v differentiation 3.2.3 Translational regulation mediated by mTOR also couples ES selfrenewal to differentiation 3.2.3.1 Decreased cell cycle activity during ES cell differentiation, correlating with downregulation of mTOR activity 3.2.3.2 Induction of differentiation by rapamycin in ES cells 3.2.4 mTOR-mediated translational regulation in MEL cells CHAPTER DISCUSSION 108 108 111 114 117 4.1. Derivation of embryonic cell lines with endothelial potential 119 4.2. Decision making process in self-renewal versus differentiation 123 CHAPTER 134 CONCLUSIONS AND FUTURE STUDY REFERENCES 139 APPENDICES 157 vi LIST OF FIGURES AND TABLES Figure 1.1 The G1/S checkpoint 19 Figure 1.2 The primary structure of mTOR 29 Figure 3.1 Derivation of RoSH cell lines from mouse blastocysts/embryos 64 Figure 3.2 Morphology of RoSH2 cells in culture 67 Figure 3.3 Karyotyping of RoSH2 cells 69 Figure 3.4 Differentiating RoSH2 cells in culture 71 Figure 3.5 Gene expression pattern of RoSH2 cells 72 Figure 3.6 Endothelial antigen expression profile of RoSH2 cells 74 Figure 3.7 AcLDL uptaking and electron microscopy analysis 75 Figure 3.8 In vivo endothelial cell differentiation of RoSH2 cells after cotransplantation with ES cells 77 Figure 3.9 Endothelial differentiation of RoSH2 cells in anti-fas induced liver injury model 78 Figure 3.10 Proliferation of RoSH2 cells before and after induction of endothelial differentiation 81 Figure 3.11 Cells at G1 phase of cell cycle during endothelial differentiation 82 Figure 3.12 Microarray analysis of un- and differentiated RoSH2 cells 86 Figure 3.13 Verification of microarray analysis by RT-PCR and Western blot analysis 87 Figure 3.14 Cell cycle regulatory proteins during endothelial differentiation 91 Figure 3.15 mTOR activity evidenced by phosphorylated 4E-BP1 and S6K1 during RoSH2 cell differentiation and rapamycin treatment 94 Figure 3.16 Induction of differentiation by blocking mTOR activity in RoSH2 cells 95 Figure 3.17 Effect of rapamycin on undifferentiated RoSH2 cells 97 Figure 3.18 Cyclin D2 and cyclin E1 after treatment with rapamycin in RoSH2 cells 99 vii Figure 3.19 Effect of PI3K inhibitors on 14-3-3ζ and cyclin D2 102 Figure 3.20 Raf/MEK/Erk signaling during endothelial differentiation 104 Figure 3.21 Effects of FTI and PD98059 on cell cycle activity 105 Figure 3.22 Gleevec treatment on RoSH2 cells 107 Figure 3.23 Cell cycle activity in mouse ES cells during differentiation 109 Figure 3.24 mTOR activity during ES cells differentiation 110 Figure 3.25 Cell cycle activity in ES cells during rapamycin treatment 111 Figure 3.26 SSEA-1 immunhistochemical staining in LIF-depleted or rapamycin-treated ES cells 112 Figure 3.27 Rapamycin induces ES cells differentiation 113 Figure 3.28 MEL Cell cycle activity during differentiation and rapamycin treatment 114 Figure 3.29 mTOR activity during differentiation and rapamycin treatment in MEL cells 116 Table 4A. Comparison of ES cells and RoSH2 cells 122 Figure 4.1 Effects of mTOR knockdown by siRNA transfection 130 Figure 4.2 Model for translational regulation of cyclin D2 mRNA through PI3K/Akt/mTOR signaling pathway 133 viii ABBREVIATION β-gal β-galactosidase AFP α-fetoprotein AGM aorta-gonad-mesonephros ApoE apolipoprotein E ATM telangiectasia mutated protein ATR ataxia-telangiectasia and Rad3-related protein BM bone marrow Cdks cyclin-dependent kinases CFDA/SE 5-(and 6-)-carboxyfluorescein diacetate, succinimidyl ester CIA chloroform, isoamyl alcohol CKIs Cdk inhibitors DAB 3,3’-diaminobenzidine DEPC diethyl pryrocarbonate DMEM Dulbecco’s modified Eagle’s medium dpc days post coitus DPR differentiated polysome-associated RNA DTR differentiated total RNA DTT dithiotheritol EBs embryoid bodies ECS Enhanced Chemiluminescent Substrate EM electron microscopy EPCs endothelial progenitor cells FAT domain FRAP, ATM, TRAP domain 152 Poulin F, Gingras AC, Olsen H, Chevalier S, Sonenberg N. 1998. 4E-BP3, a new member of the eukaryotic initiation factor 4E-binding protein family. J Biol Chem. 273: 14002-7 Proud CG. 1992. Protein phosphorylation in translational control. Curr Top Cell Regul 32: 243-369 Que J, El Oakley RM, Salto-Tellez M, Wong N, de Kleijn DP, Teh M, Retnam L, Lim SK. 2004. Generation of hybrid cell lines with endothelial potential from spontaneous fusion of adult bone marrow cells with embryonic fibroblast feeder. In Vitro Cell Dev Biol Anim. 40: 143-9 Quelle DE, Ashmun RA, Shurtleff SA, Kato JY, Bar-Sagi D, et al. 1993. Overexpression of mouse D-type cyclins accelerates G1 phase in rodent fibroblasts. Genes Dev 7: 1559-71 Radimerski T, Montagne J, Hemmings-Mieszczak M, Thomas G. 2002. Lethality of Drosophila lacking TSC tumor suppressor function rescued by reducing dS6K signaling. Genes Dev. 16: 2627-32 Rajan P, Panchision DM, Newell LF, McKay RD. 2003. BMPs signal alternately through a SMAD or FRAP-STAT pathway to regulate fate choice in CNS stem cells. J Cell Biol 161: 911-21 Rao SS, Chu C, Kohtz DS. 1994. Ectopic expression of cyclin D1 prevents activation of gene transcription by myogenic basic helix-loop-helix regulators. Mol Cell Biol. 14: 5259-67 Rathjen PD, Toth S, Willis A, Heath JK, Smith AG. 1990. Differentiation inhibiting activity is produced in matrix-associated and diffusible forms that are generated by alternate promoter usage. Cell 62: 1105-14 Raught B, Gingras AC, Gygi SP, Imataka H, Morino S, et al. 2000. Serumstimulated, rapamycin-sensitive phosphorylation sites in the eukaryotic translation initiation factor 4GI. Embo J 19: 434-44 Resnitzky D, Gossen M, Bujard H, Reed SI. 1994. Acceleration of the G1/S phase transition by expression of cyclins D1 and E with an inducible system. Mol Cell Biol. 14: 1669-79 Reya T, Morrison SJ, Clarke MF, Weissman IL. 2001. Stem cells, cancer, and cancer stem cells. Nature. 414: 105-11 Ribatti D, Vacca A, Nico B, Ria R, Dammacco F. 2002. Cross-talk between hematopoiesis and angiogenesis signaling pathways. Curr Mol Med. 2: 537-43 Risau W. 1997. Mechanisms of angiogenesis. Nature 386: 671-4 153 Rodig SJ, Meraz MA, White JM, Lampe PA, Riley JK, et al. 1998. Disruption of the Jak1 gene demonstrates obligatory and nonredundant roles of the Jaks in cytokine-induced biologic responses. Cell 93: 373-83 Rogers PA, Jones GH. 1982. Preparation of messenger RNA from mature skeletal and cardiac muscle. Can J Biochem 60: 587-92 Romanowski P, Marr J, Madine MA, Rowles A, Blow JJ, Gautier J, Laskey RA. 2000. Interaction of Xenopus Cdc2 x cyclin A1 with the origin recognition complex. J Biol Chem. 275: 4239-43 Rosenblatt J, Gu Y, Morgan DO. 1992. Human cyclin-dependent kinase is activated during the S and G2 phases of the cell cycle and associates with cyclin A.1992 Apr 1;89(7):2824-8. Proc Natl Acad Sci U S A. 89: 2824-8 Rosenwald IB, Lazaris-Karatzas A, Sonenberg N, Schmidt EV. 1993. Elevated levels of cyclin D1 protein in response to increased expression of eukaryotic initiation factor 4E. Mol Cell Biol 13: 7358-63 Ross J. 1999. Assays for analyzing exonucleases in vitro. Methods. 17: 52-9 Russell L. 1979. Sensitivity patterns for the induction of homeotic shifts in a favorable strain of mice. Teratology. 20: 115-25 Sabatini DM, Erdjument-Bromage H, Lui M, Tempst P, Snyder SH. 1994. RAFT1: a mammalian protein that binds to FKBP12 in a rapamycindependent fashion and is homologous to yeast TORs. Cell. 78: 35-43 Sabers CJ, Martin MM, Brunn GJ, Williams JM, Dumont FJ, et al. 1995. Isolation of a protein target of the FKBP12-rapamycin complex in mammalian cells. J Biol Chem 270: 815-22 Sabin FR. 1920. Preliminary note on the differentiation of angioblasts and the method by which they produce blood-vessels, blood plasma and red blood-cells as seen in the living chick. Anat. Rec. 13: 199-204 Sarbassov dos D, Ali SM, Kim DH, Guertin DA, Latek RR, et al. 2004. Rictor, a novel binding partner of mTOR, defines a rapamycininsensitive and raptor-independent pathway that regulates the cytoskeleton. Curr Biol 14: 1296-302 Savatier P, Huang S, Szekely L, Wiman KG, Samarut J. 1994. Contrasting patterns of retinoblastoma protein expression in mouse embryonic stem cells and embryonic fibroblasts. Oncogene 9: 809-18 Schalm SS, Blenis J. 2002. Identification of a conserved motif required for mTOR signaling. Curr Biol. 12: 632-9 154 Schalm SS, Fingar DC, Sabatini DM, Blenis J. 2003. TOS motif-mediated raptor binding regulates 4E-BP1 multisite phosphorylation and function. Curr Biol. 13: 797-806 Schmelzle T, Hall MN. 2000. TOR, a central controller of cell growth. Cell 103: 253-62 Schnurch H, Risau W. 1993. Expression of tie-2, a member of a novel family of receptor tyrosine kinases, in the endothelial cell lineage. Development 119: 957-68 Sekulic A, Hudson CC, Homme JL, Yin P, Otterness DM, Karnitz LM, Abraham RT. 2000. A direct linkage between the phosphoinositide 3kinase-AKT signaling pathway and the mammalian target of rapamycin in mitogen-stimulated and transformed cells. Cancer Res. 60: 3504-13 Shalaby F, Ho J, Stanford WL, Fischer KD, Schuh AC, Schwartz L, Bernstein A, Rossant J. 1997. A requirement for Flk1 in primitive and definitive hematopoiesis and vasculogenesis. Cell 89: 981-90 Shalaby F, Rossant J, Yamaguchi TP, Gertsenstein M, Wu XF, et al. 1995. Failure of blood-island formation and vasculogenesis in Flk-1-deficient mice. Nature 376: 62-6 Sheng Z, Knowlton K, Chen J, Hoshijima M, Brown JH, Chien KR. 1997. Cardiotrophin (CT-1) inhibition of cardiac myocyte apoptosis via a mitogen-activated protein kinase-dependent pathway. Divergence from downstream CT-1 signals for myocardial cell hypertrophy. J Biol Chem. 272: 5783-91 Sherr CJ. 1994. G1 phase progression: cycling on cue. Cell 79: 551-5 Sherr CJ. 2000. The Pezcoller lecture: cancer cell cycles revisited. Cancer Res. 60: 3689-95 Sherr CJ, Roberts JM. 1999. CDK inhibitors: positive and negative regulators of G1-phase progression. Genes Dev. 13: 1501-12 Shima H, Pende M, Chen Y, Fumagalli S, Thomas G, Kozma SC. 1998. Disruption of the p70(s6k)/p85(s6k) gene reveals a small mouse phenotype and a new functional S6 kinase. EMBO J. 17: 6649-59 Sicinska E, Aifantis I, Le Cam L, Swat W, Borowski C, et al. 2003. Requirement for cyclin D3 in lymphocyte development and T cell leukemias. Cancer Cell 4: 451-61 Sicinski P, Donaher JL, Geng Y, Parker SB, Gardner H, Park MY, Robker RL, Richards JS, McGinnis LK, Biggers JD, Eppig JJ, Bronson RT, Elledge SJ, Weinberg RA. 1996. Cyclin D2 is an FSH-responsive gene 155 involved in gonadal cell proliferation and oncogenesis. Nature 384: 470-4 Sicinski P, Donaher JL, Parker SB, Li T, Fazeli A, Gardner H, Haslam SZ, Bronson RT, Elledge SJ, Weinberg RA. 1995. Cyclin D1 provides a link between development and oncogenesis in the retina and breast. Cell 82: 621-30 Sinor AD, Lillien L. 2004. Akt-1 expression level regulates CNS precursors. J Neurosci 24: 8531-41 Smith AG, Hooper ML. 1987. Buffalo rat liver cells produce a diffusible activity which inhibits the differentiation of murine embryonal carcinoma and embryonic stem cells. Dev Biol. 121: 1-9 Sun H, Lesche R, Li DM, Liliental J, Zhang H, Gao J, Gavrilova N, Mueller B, Liu X, Wu H. 1999. PTEN modulates cell cycle progression and cell survival by regulating phosphatidylinositol 3,4,5,-trisphosphate and Akt/protein kinase B signaling pathway. Proc Natl Acad Sci U S A. 96: 6199-204 Suri C, Jones PF, Patan S, Bartunkova S, Maisonpierre PC, et al. 1996. Requisite role of angiopoietin-1, a ligand for the TIE2 receptor, during embryonic angiogenesis. Cell 87: 1171-80 Takahashi T, Hara K, Inoue H, Kawa Y, Tokunaga C, Hidayat S, Yoshino K, Kuroda Y, Yonezawa K. 2000. Carboxyl-terminal region conserved among phosphoinositide-kinase-related kinases is indispensable for mTOR function in vivo and in vitro. Genes Cells. 5: 765-75 Tang XM, Beesley JS, Grinspan JB, Seth P, Kamholz J, Cambi F. 1999. Cell cycle arrest induced by ectopic expression of p27 is not sufficient to promote oligodendrocyte differentiation. J Cell Biochem. 76: 270-9 Tanguay DA, Colarusso TP, Pavlovic S, Irigoyen M, Howard RG, et al. 1999. Early induction of cyclin D2 expression in phorbol ester-responsive B1 lymphocytes. J Exp Med 189: 1685-90 Thompson C. 1995. Apoptosis in the pathogenesis and treatment of disease. Science 267: 1456-62 Tokumoto YM, Durand B, Raff MC. 1999. An analysis of the early events when oligodendrocyte precursor cells are triggered to differentiate by thyroid hormone, retinoic acid, or PDGF withdrawal. Dev Biol. 213: 327-39 Tolan DR, Traut RR. 1981. Protein topography of the 40 S ribosomal subunit from rabbit reticulocytes shown by cross-linking with 2-iminothiolane. J Biol Chem 256: 10129-36 156 Tuazon PT, Merrick WC, Traugh J. 1989. Comparative analysis of phosphorylation of translational initiation and elongation factors by seven protein kinases. J Biol Chem. 264: 2773-7 Vilella-Bach M, Nuzzi P, Fang Y, J. C. 1999. The FKBP12-rapamycinbinding domain is required for FKBP12-rapamycin-associated protein kinase activity and G1 progression. J Biol Chem. 274: 4266-72 Vittet D, Prandini MH, Berthier R, Schweitzer A, Martin-Sisteron H, Uzan G, Dejana E. 1996. Embryonic stem cells differentiate in vitro to endothelial cells through successive maturation steps. Blood. 88: 342431 Volarevic S, Stewart MJ, Ledermann B, Zilberman F, Terracciano L, et al. 2000. Proliferation, but not growth, blocked by conditional deletion of 40S ribosomal protein S6. Science 288: 2045-7 Walsh K, Perlman H. 1997. Cell cycle exit upon myogenic differentiation. Curr Opin Genet Dev. 7: 597-602 Weinstein B. 2002. Building the house around the plumbing. Bioessays 24: 397-400 Whitman M, Melton D. 1992. Involvement of p21ras in Xenopus mesoderm induction. Nature 357: 252-4 Wilson V, Manson L, Skarnes WC, Beddington RS. 1995. The T gene is necessary for normal mesodermal morphogenetic cell movements during gastrulation. Development. 121: 877-86 Wojnowski L, Zimmer AM, Beck TW, Hahn H, Bernal R, et al. 1997. Endothelial apoptosis in Braf-deficient mice. Nat Genet 16: 293-7 Wong S, McLaughlin J, Cheng D, Witte ON. 2003. Cell context-specific effects of the BCR-ABL oncogene monitored in hematopoietic progenitors. Blood 101: 4088-97 Wyllie A. 1995. The genetic regulation of apoptosis. Curr Opin Genet Dev. 5: 97-104 Xia Z, Dickens M, Raingeaud J, Davis RJ, Greenberg ME. 1995. Opposing effects of ERK and JNK-p38 MAP kinases on apoptosis. Science. 270: 1326-31 Yamada M, Kubo H, Kobayashi S, Ishizawa K, Numasaki M, et al. 2004. Bone marrow-derived progenitor cells are important for lung repair after lipopolysaccharide-induced lung injury. J Immunol 172: 1266-72 157 Yamagiwa Y, Marienfeld C, Tadlock L, Patel T. 2003. Translational regulation by p38 mitogen-activated protein kinase signaling during human cholangiocarcinoma growth. Hepatology 38: 158-66 Yamaguchi TP, Dumont DJ, Conlon RA, Breitman ML, Rossant J. 1993. flk1, an flt-related receptor tyrosine kinase is an early marker for endothelial cell precursors. Development. 118: 489-98 Yew PR. 2001. Ubiquitin-mediated proteolysis of vertebrate G1- and S-phase regulators. J Cell Physiol 187: 1-10 Yin Y, Lim YK, Salto-Tellez M NS, Lin CS, Lim SK. 2002. AFP(+), ESCderived cells engraft and differentiate into hepatocytes in vivo. Stem Cells. 20: 338-46 Ying QL, Nichols J, Chambers I, Smith A. 2003. BMP induction of Id proteins suppresses differentiation and sustains embryonic stem cell selfrenewal in collaboration with STAT3. Cell 115: 281-92 Yonezawa K, Tokunaga C, Oshiro N, Yoshino K. 2004. Raptor, a binding partner of target of rapamycin. Biochem Biophys Res Commun 313: 437-41 Young PE, Baumhueter S, Lasky LA. 1995. The sialomucin CD34 is expressed on hematopoietic cells and blood vessels during murine development. Blood 85: 96-105 Zhang JM, Wei Q, Zhao X, Paterson BM. 1999. Coupling of the cell cycle and myogenesis through the cyclin D1-dependent interaction of MyoD with cdk4. EMBO J. 18: 926-33 Zhang P, Wong C, DePinho RA, Harper JW, Elledge SJ. 1998. Cooperation between the Cdk inhibitors p27(KIP1) and p57(KIP2) in the control of tissue growth and development. Genes Dev 12: 3162-7 Zhu L, Skoultchi AI. 2001. Coordinating cell proliferation and differentiation. Curr Opin Genet Dev. 11: 91-7 158 APPENDICES Culture media Appendix 2.1 RoSH and ES cell culturing medium (per 550 ml) Component Volume (ml) Fetal Calf Serum 110 Non-essential amino acid MEM 5.5 Penicillin-Streptomycin-Glutamine (100 ×) 5.5 Dulbecco’s modified Eagle’s medium (DMEM) 439 Beta-mercaptoethanol (Sigma, St. Louis, MO) 3.6 µl * All solutions except beta-mercap are from GIBCO/BRL, NY. * A final concentration of 1000 unit/ml LIF is for ES cells only. Appendix 2.2 Methycellulose-based medium (per 10 ml) Component Volume (ml) Fetal Calf Serum 1.5 MethoCultTM (StemCell Technologies, Vancouver, Canada) 3.9 DMEM 4.2 Penicillin-Streptomycin-Glutamine (100 ×) 100 µl Diluted monothioglycerol solution 100 µl * Dilute monothioglycerol solution: 37.8 µl monothioglycerol stock solution (Sigma, St. Louis, MO) in 10 ml PBS Appendix 2.3 MEL cell culturing medium (per 500 ml) Component Volume (ml) Fetal Calf Serum 50 Non-essential amino acid MEM 5.5 Penicillin-Streptomycin-Glutamine (100 ×) 5.5 RPMI 1640 medium 439 * All solutions are from GIBCO/BRL, NY. 159 Antigen Staining Appendix 2.4 Primary antibody for FACs staining Primary Ab Host species Dilution Source P-Selectin Goat 1: 100 Santa Cruz Biotechnology, USA CD34 Goat 1: 100 Santa Cruz Biotechnology, USA Tie-2 Rabbit 1: 100 Santa Cruz Biotechnology, USA Thy-1 Rabbit 1: 100 BD Biosciences Pharmingen, USA Sca-1 Rat 1: 100 BD Biosciences Pharmingen, USA Flk-1 Rat 1: 100 BD Biosciences Pharmingen, USA CD31 Rat 1:100 BD Biosciences Pharmingen, USA CD45 Rat 1:100 BD Biosciences Pharmingen, USA Appendix 2.5 Second antibody for FACs Secondary Ab For 1st Ab Dilution Source Anti-goat conjugated with FITC P-selectin and CD34 1: 1000 Sigma, USA Anti-rabbit conjugated with FITC Tie-2 and Thy-1 1: 1000 Sigma, USA Anti-rat conjugated with FITC Sca-1, Flk-1, CD31 and CD45 1: 1000 Chemicon International, USA 160 Appendix 2.6 X-gal staining Appendix 2.6.1 Rinse solution (100 ml) Component Volume (ml) 0.01 M PBS (pH 7.4) 98.8 200 mM MgCl2 10% Sodium Deoxycholate 0.1 20% NP-40/IGEPAL 0.1 Appendix 2.6.2 Staining solution (10 ml) Component Volume (ml) Rinse solution 9.3 2% X-Gal 0.5 500mM K3Fe(CN)6 0.1 500mM K4Fe(CN)6 0.1 RNA analysis Appendix 2.7 Incomplete GITC buffer (per 100 ml) Component Volume Guanidinium thiocyanate 47.2 g Sodium Lauryl sarcosine 0.5 g Sodium citrate 0.735 g Distilled water Top-up to 100 ml Appendix 2.8 Buffer A for polysome-associated RNA extraction Appendix 2.8.1 Incomplete (per 100 ml) Stock Volume (ml) Final concentration M Tris-HCl pH7.8 10 mM M potassium acetate 0.1 mM M magnesium acetate 0.15 1.5 mM M DTT 0.2 mM glycerol 10 10% (v/v) 161 Appendix 2.8.2 Complete Buffer A (per 10 ml) Stock Volume Final concentration Incomplete buff A 9.93 ml 10 mM µg/µl leupeptin 10 µl µg/ml µg/µl pepstatin A 10 µl µg/ml PMSF (20 µg/µl) 50 µl 100 µg/ml Appendix 2.9 Glyoxal denaturation buffer Components Glyoxal buffer (see next Appendix) RNA Sterile water Total volume Glyoxal buffer (per 50 ml) Components M NaPO4,pH 7.0 DMSO Deionized glyoxal (40%) 10% SDS Volume (µl) 11.25 µg Top-up to 15 µl 15 Volume 750 µl 37.5 ml 8.55 ml 750 µl Appendix 2.10 RNA gel loading dye (per 10 ml) Components M NaPO4,pH 7.0 Bromophenol blue Xylene cyanol Glycerol Volume 0.1 ml 0.025 g 0.025 g ml Appendix 2.11 Reverse transcription Components 5× Reaction buffer dNTP (25 mM) rRNasin RNase inhibitor (40 unit/µl) Volume (µl) 1.25 0.35 M-MLV Reverse transcriptase (200 u/µl) Oligo-dT primer (10 µM) 1 RNA µg RNase-free water water Top to 25 µl Total volume 25 * All reagents are from Promega (Promega, WI) 162 Appendix 2.12 PCR reaction solution Components 10 × PCR reaction buffer dNTP (25 mM) Taq polymerase Volume (µl) 0.4 0.5 primer sets (20 pM) cDNA Sterile water Total volume 32.1 40 Appendix 2.13 Primers used for PCR Gene Primers: Sense Product size Anti-sense Flk-1 (bp) 5'- ATTGCACACACGGGATTCTG -3' 5'-CATACAGTACGACACTGACG-3’ VEGF 744 5'- CCTATGACCACCCACATCCG -3' 5'- GATGAGGACCAGAATGAGAGAC -3' 702 Tie-2 5'-CTGTTG GCGTTTCTGATTATG-3' 5'-GGGTCTGTCTCTAGCACTCTG-3' Ang-1 5'- GGGAGGAAAAAGAGAAGAAGAG -3' 5'- TGAAATCAGCACCGTGTAAG -3' TPI 242 5'-ATGTCACTGCTGGTGCTGGA-3' 5'-TGCTAGCCAATTCCTCCCAG-3' Oct4 458 5'-CCCTGGCATGATCAAAGACTT-3' 5'-CCTTGCTCCAGTCTTTCACAT-3' Rex-1 482 409 5'-GGAGCACGAGTGGAAAGCAAC-3' 5'-TTCCTCCACCCACTTCTCCAG-3' 327 brachyury (First set) 5'- TCC AGG TGC TAT ATA TTG CC-3' 5'-TGC TGC CTG TGA GTC ATA AC-3' 980 163 brachyury (Second set) 5'-GAAGCCAAGGACAGAGAGAC-3' 5'-GCAACAAGGGAGGACATTAG-3' FKBP12 194 5’-CAC GGG GAT GCT TGA AGA TGG-3' 5'- GTC TAT ACA AAG GGT GGT GGG-3' 371 AFP 5’-TCC ACG TTA GAT TCC TCC CAG-3' 5'-TTG CAG CAT GCC AGA ACG ACC-3' nestin 5'-TGT GGG ATG ATG GCT TGA GT-3' 5'-ACA GAA GAA AGG GGG CGT TG-3' brachyury 744 5'-ATG CTC AAA CCA AGT GCC CA-3' 5'-GTA CAC GCA GCT GAA AAT GC-3' TSP1 482 5'- ATT GCA CAC ACG GGA TTC TG -3' 5'- CAT ACA GTA CGA CAC TGA CG-3' c-Kit 616 5'-CTG TTG GCG TTT CTG ATT ATG-3' 5'-GGG TCT GTC TCT AGC ACT CTG-3' Flk-1 300 5'-GCG GAG TTG AAT GAA TGA AGA-3' 5'-TGG TGG AAG TTG TGA AGG GAG-3' Tie-2 655 5'- CTC CAA CCT ATG CGG ACA AT-3' 5'- GTG GTG TGT AAT GTG CAG GG-3' nurr1 471 730 5'-AGA AAG AAA ACA CAA TCA CCT-3' 5'-ACT GGG AAG TAA AAA GCA AAA-3' 514 PDGFA 5'-CTC GAA GTC AGA TCC ACA GCA-3' 5'-GCT TCT TCC TGA CAT ACT CCA-3' PDGFRα 384 5'-CCA GTA GTT CCA CCT TCA TCA-3' 5'-CAA GTA TCC CAG CTA TCC ACA-3' 275 164 ApoE 5'-CTG AAC CGA TTC TGG GAT TAC-3' 5'-GCT CAC GGA TGG CAC TCA CAC-3' fibronectin 5'-CGT GGG ATG TTT TGA GAC TTC-3' 5'-GTA GTA AAG CGT TGG CAT GTG-3' cyclin D1 456 5'-GCC TTC ACT TGC TAT CTG GAT-3' 5'-CCT CTT CTT CTT CAC TTC TCT-3' beta-globin 603 5'-GGA TAT GGA AGA AGC GAG TCA-3' 5'-TTC GGA GCT GTT TAC GTC TGG-3' rpL5 326 5'-GAA ATC TAC GCT CCT AAA CTC-3' 5'-GTG TTT TCC TGG TGG TTT TTC-3' p27 381 5'-CGC TGC TCT GCC TTC TTA CTG-3' 5'-GTC CTC GCT GCT TCT GCT TTG-3' cyclin E2 585 5'-CGC AAT TGC AGC TTC TAG GTA-3' 5'-CAT GGC CAG ACA TAG AGC AGG-3' cyclin E1 732 5'-GTA AGA TGC TTA CAG GAG AAC-3' 5'-CCT CAC CCT CTT CCC TTA CAC -3' cyclin D3 484 5'-GTG AGG GAA GAG GTG AAG GTG-3' 5'-GGT TTG GTT TTG CCC GTG GTG-3' cyclin D2 451 375 5'-CTG ACA GAT GCT CTC TTG GG -3' 5'-CAC AAC CCC AGA AAC AGA CA -3' 578 *All primers span at least one intron Appendix 2.14 Amplification condition for PCR Cycle Program Denaturation Denaturation Annealing Extension Extension Temperature (°C) 94 94 60 72 72 Time (min:s) 2:00 0:30 1:00 1:20 7:00 Cycle number 35 165 Western blot Appendix 2.15 RIPA buffer Appendix 2.15.1 Incomplete buffer Stock Volume (ml) Final concentration M Tris-HCl pH7.8 10 50 mM M NaCl 150 mM 0.5 M EDTA 0.2 0.5 mM Deoxycholate 1g 0.5% (w/v) NP-40 (IGEPAL CA-630) 1% (v/v) 10% (w/v) SDS 0.2 0.1% (w/v) Appendix 2.15.2 Complete buffer (per ml) Stock Volume µl Final concentration 0.5 M NaVO3 mM M NaF 25 25 mM M PMSF 10 10 mM M dithiothreitol (DTT) 20 20 mM Proteinase inhibitor cocktail 1% (v/v) * Proteinase inhibitor cocktail (Roche Diagnostics, Basel Switzerland) Appendix 2.16 × Protein loading buffer (per 10 ml) Stock Volume (ml) M Tris-HCl pH 6.8 0.9 Distilled water 2.3 10% SDS 0.8 Glycerol Beta-mercaptoethanol Bromophenol blue 100 µg 166 Appendix 2.17 Gel recipe for western blot Separating Gel 15% 12% Distilled H2O 2.7 1.5M Tris-HCl 1.85 2.1 pH8.8 0.5M Tris-HCl pH6.8 30% Acrylamide 3.7 3.2 10% SDS 150 82 10%Ammon100 82 iumpersulfate TEMED 10 8.4 protein size 180 kD and TEMED are from BioRad (BioRad Appendix 2.18 Primary antibodies used for western blot analysis Primary Ab Host species Dilution Manufacturer 4E-BP1 Goat 1: 200 Santa Cruz Biotechnology Cyclin E2 Goat 1: 200 Santa Cruz Biotechnology Cyclin E1 Rabbit 1: 200 Santa Cruz Biotechnology Cyclin D1 Rabbit 1: 200 Santa Cruz Biotechnology Cyclin D2 Rabbit 1: 200 Santa Cruz Biotechnology Cyclin D3 Rabbit 1: 200 Santa Cruz Biotechnology p27/KIP Rabbit 1: 200 Santa Cruz Biotechnology p70S6K1 Rabbit 1: 200 Santa Cruz Biotechnology Phosphop70S6K1 Rabbit 1: 200 Santa Cruz Biotechnology Oct Rabbit 1: 200 Santa Cruz Biotechnology c-myc Rabbit 1: 200 Santa Cruz Biotechnology TSC2 Rabbit 1:200 Santa Cruz Biotechnology nestin Mouse 1: 200 Santa Cruz Biotechnology Tie-2 Rabbit 1: 200 PharMingen, MA Flk-1 Rat 1: 500 PharMingen, MA Phosphor-MAPK (p42/44) Rabbit 1: 200 Cell signalling Technology Phosphor-Akt Rabbit 1:200 Cell signalling Technology 167 Beta-globin Rabbit 1:200 Developed in the lab by immunonizing rabbit with human beta-globin Appendix 2.19 Secondary antibodies used for western blot analysis Secondary Ab Host species Dilution Manufacturer Anti-goat conjugated with HRP Goat 1: 7000 Santa Cruz Biotechnology,USA Anti- rat conjugated with biotin Donkey 1: 7000 Sigma, USA Anti-rabbit conjugated with HRP Goat 1: 5000 Santa Cruz Biotechnology,USA Anti-mouse conjugated with HRP Goat 1: 5000 Santa Cruz Biotechnology,USA [...]... express markers of pluripotency and can be induced to differentiate into endothelial cells that exhibited typical endothelial properties such as expression of endothelial specific marker Tie-2 and Flk-1, endocytosis of acetylated LDL To understand the molecular mechanism of endothelial differentiation, we began by investigating one aspect of endothelial differentiation i.e inhibition of self- renewal Microarray... exclusively into endothelial cells 13 1.3 Molecular mechanisms of endothelial differentiation 1.3.1 Relationship between self- renewal and differentiation The proper development of an embryo requires not only accumulation of cell number but also differentiation to generate various cell types in a spatial and temporal manner in response to different developmental cues However, proliferation and differentiation. .. and endothelial stem cell biology in particular The one most distinctive and defining feature of stem cells is their ability to self- renew and remain undifferentiated or to exit self- renewal and differentiate into functionally distinct daughter cells Therefore, an understanding of the decision-making processes in choosing self- renewal versus differentiation is central to understanding the biology of. .. concentration-dependent manner By activating or inhibiting signaling pathways, each environmental factor elicits molecular responses that promote either self- renewal or differentiation Therefore, in a microenvironment that contains a plethora of factors known to promote self- renewal or differentiation, the decision to selfrenew and differentiate will not depend on a single factor or pathway but rather on the equilibrium... generation of progenitor cells with the potential to differentiate into endothelial differentiation cells, it is not a suitable experimental model for an in-depth study of endothelial differentiation as the process for generating these cells is laborious and the number of cells generated are too small An ideal way to resolve this problem is to establish an endothelial progenitor cell line that can self- renew... downregulation of cyclin D2 as a major candidate in the inhibition of self- renewal PI3K/mTOR pathway was found to mediate this translational regulation Inhibition of the mTOR pathway resulted in spontaneous differentiation in RoSH2 cells and embryonic stem cells Together these observations suggest that the PI3K/mTOR pathway is one common pathway regulating the switch from self- renewal into differentiation. .. Therefore, cell cycle regulation appears to be pivotal in the decision-making process of self- renewal versus differentiation An important corollary in this hypothesis is that cell cycle regulation is unique 14 in stem cells with at least one aspect of cell cycle regulation in self- renewal being coupled to the induction of differentiation (Zhu and Skoultchi 2001; Edgar and Lehner 1996) Cell cycle regulation... Pharmacological Science 2003, Vol 24, 139-145 1.3.2.4 Role of cell cycle in differentiating cells When stem cells exit from self- renewal to undergo differentiation, progression of cell cycle is inhibited leading to speculation that cell cycle arrest leads to differentiation Does cell-cycle arrest always lead to stem cell differentiation? A number of recent experiments indicate that the answer to this question... for the proliferation and differentiation of EPCs, their expression is restricted to 12 endothelial lineages, they are routinely used as markers for tracing endothelial differentiation in experimental studies (Vittet et al., 1996; Pillebout et al., 2001) The study of vasculogenesis has been hampered by the availability and the small size of early embryos, and the difficulty of gaining access to cells... transducer and activator of transcription 3 TSC tuberous sclerosis complex UPR undifferentiated polysome-associated RNA UTR undifferentiated total RNA VEGF endothelial growth factor vWF von Willebrand Factor xi SUMMARY Endothelial differentiation during vasculogenesis proceeds through many sequential transitional embryonic cell stages To understand the molecular mechanism of this process, we first . endocytosis of acetylated LDL. To understand the molecular mechanism of endothelial differentiation, we began by investigating one aspect of endothelial differentiation i.e. inhibition of self- renewal. . characterization of stem cell lines with endothelial potential from embryos 38 1.4.2 Understand the molecular mechanism underlying the switch from self- renewal to differentiation during endothelial differentiation. MOLCULAR MECHANISM OF SELF- RENEWAL EXIT DURING ENDOTHELIAL DIFFERENTIATION QUE JIANWEN NATIONAL UNIVERSITY OF SINGAPORE 2005 MOLCULAR MECHANISM