Towards automatic gene synthesis with bioinformatics software, novel one step real time PCR assembly, and lab chip gene synthesis 2

National University of Singapore Department of Electrical and Computer Engineering CHAPTER V AUTOMATIC TOUCHDOWN ONE-STEP GENE SYNTHESIS This chapter describes an analytical model of PCR gene synthesis based on the thermodynamics and kinetics of the assembly and amplification processes. The kinetics difference between standard PCR amplification and one-step PCR gene synthesis has been analyzed using this model, and validated using real-time gene synthesis. In addition, a cost-effective Automatic TouchDown (ATD) gene synthesis method is introduced that enables the synthesis of long DNA of up to 1.5 kbp with just one PCR process. The ability of this ATD method has been demonstrated in the design and synthesis of human protein kinase B-2 (PKB2) (1446 bp) and the promoter of human calcium-binding protein A4 (S100A4) (752 bp) with oligonucleotides concentration of as low as nM. The Automatic TouchDown gene synthesis approach is co-developed by me and my colleague Dr. Wai Chye Cheong. I have initialized the one-step gene synthesis while Dr. Wai Chye Cheong has further optimized this method systematically. 5.1 Introduction The existence of various PCR gene synthesis methods suggests that there is lack of a standard or universal method [94] . Depending on the complexity of target genes, the synthetic genes are often constructed with a one-step or two-step overlapping process. The one-step process is preferred for short DNAs (< 500 bp), while two-step process is more suitable for long DNAs synthesis. Different PCR conditions should be applied to optimize the assembly and amplification processes separately. In order to combine the simplicity and cost-effectiveness of the one-step process, with the assembly efficiency of the two-step process in the synthesis of relatively long genes, and to develop a universal PCR based gene synthesis method, TopDown gene synthesis is introduced in Chapter VI. This method minimizes the competition between PCA and PCR by differentiating the melting temperature of inner oligos and outer primers and running these two processes in one step with two different annealing temperatures. However, this method has a limitation where the cycle number of assembly and amplification steps needed to be empirically optimized for genes with Page 63 National University of Singapore Department of Electrical and Computer Engineering different lengths and sequence contents. For relatively short DNA (< 500 bp), the emerge of fulllength DNA occurred at around to 11 cycles during PCA stage, and excess thermal cycles would result in the formation of non-specific long DNA with random sequence [103] . While long DNA might need more than 15 cycles. Insufficient thermal cycles would lead to the production of various truncate DNA instead of full- length DNA. In order to improve the TopDown one-step PCR gene synthesis and develop a more universal method, a novel approach – automatic TouchDown one-step PCR is developed. 5.1.1 Principle of Automatic TouchDown one-step gene synthesis Similar to TopDown PCR, automatic TouchDown (ATD) gene synthesis combines the simplicity and cost-effectiveness of the one-step process, with the assembly efficiency of the two-step process in the synthesis of relatively long genes. This method utilizes a software program (TmPrime) to design primers with two distinct melting temperatures not only to minimize the competition between PCA and PCR amplification in the one-step gene synthesis, but also to maximize the emerging full-length amplification. Figure 5.1: Schematic illustration of Automatic TouchDown (ATD) one-step gene synthesis combining PCR assembly and amplification into a single stage. The melting temperatures of inner oligonucleotides (Tmo) and outer primers (Tp1 and Tp2) are designed with the conditions of Tp2 ≥ 72°C and Tmo - Tp1 ≥ 5°C to minimize potential assembly-amplification interference and maximize the full-length amplification during PCR. Page 64 National University of Singapore Department of Electrical and Computer Engineering Figure 5.1 shows the concept of the proposed ATD one-step gene assembly method. The outer primers are designed with two melting temperatures (Tp1 and Tp2) where Tp1 is lower than the melting temperature of assembly oligonucleotides (Tmo), and Tp2 is ≥ 72°C. The overlapping gene synthesis is conducted in one PCR mixture with annealing temperature matched to T mo. The outer primers are subjected to an elevated annealing condition (Tmo – Tp1 ≥ 5°C) during assembly, which prevents mis-pairing among primers and oligonucleotides. When the full-length template emerges, the outer primers would initially create full-length DNA with flanked tails, causing the melting temperature of outer primer-flanked template to shift to elevated Tp2 (≥ 72°C). This cascade of reactions enhances the annealing possibility of outer primer with flanked template, and boosts the corresponding amplification of full-length template. This approach provides a unique benefit with its automatic switch in favor of full-length amplification as the reaction process progressed. This key feature is demonstrated in synthesizing a relatively long gene (1446 bp) with single PCR from a pool of 62 oligonucleotides of nM. 5.1.2 Mechanisms of PCR synthesis process In order to further understand the mechanisms of PCR synthesis process, the underlining kinetics of PCR gene synthesis and standard PCR amplification are investigated in this study. Typically, a standard PCR mixture contains only two different types of DNAs with excess outer primers (~0.4 µM) and a very small quantity of template (< 106 copies) [88]. The outer primer-template annealing temperature remains unchanged during the reaction process, which simplfies the conditions of mathematical modeling. Nevertheless, in gene synthesis reaction, the synthesis pool could consist of 20–60 distinct oligonucleoitdes of 10 nM with an excess of outer primers (~0.4 µM). As the synthesis process progressed, various intermediate DNAs would be generated from the original short oligonucleotides, which would complicate the annealing process of the mixture. Both extendable and unextendable pairings could occur. These factors would dramatically complicate the analysis modeling. From a molecular stand point, oligonucleotides in assembly mixture would require more time to find their complementary DNAs in a complex mixture, which would be reflected in the half-time constant of the hybridization reaction [110, 111]. Page 65 National University of Singapore Department of Electrical and Computer Engineering In this study ATD one-step gene synthesis and real-time PCR are combined together to investigate the gene synthesis process for the promoter of human calcium-binding protein A4 (S100A4; 752 bp) and protein kinase B-2 (PKB2; 1446 bp). Gel electrophoresis results are compared with the real-time fluorescence signals to study the effects of the oligonucleotide concentration, stringency of annealing temperature, duration of PCR extension (which would reflect the half-time constant of the hybridizaiton reaction), and the dNTPs concentration. 5.2 Experiment verification of Automatic TouchDown one-step gene synthesis 5.2.1 Design of oligonucleotides for gene synthesis Gene sequence for the promoter of human calcium-binding protein A4 (S100A4, 752 bp; chr1:1503312036-1503311284) (6) and E. coli codon-optimized human protein kinase B-2 (PKB2, 1446 bp) [26] are selected for synthesis via assembly PCR. Oligonucleotides are derived by the TmPrime program (prime.ibn.a-star.edu.sg). Two sets of oligonucleotides (SA100A4-1 and S100A4-2) with different melting temperature uniformities (∆Tm: 2.3°C and 9.1°C) were designed to investigate the effect of melting temperature on the assembly efficiency. The oligonucleotide sets designed for the selected genes are summarized in Table 5.1, and their detailed information is provided in Appendix III Table S1–S3. Table 5.1: Data of oligonucleotide set. Gene Length (bp) Average Tm (°C) ∆Tm (°C) Std. of Tm (°C) # of oligos Overlap length (nt) Oligo length (nt) S100A4-1 752 66.8 9.1 3.0 30 19–33 19, 41–66 S100A4-2 752 65.2 2.03 0.48 32 18–39 18, 39–64 PKB2 1446 66.2 1.9 0.59 62 16–32 36–57 5.2.2 Automatic TouchDown one-step real-time gene synthesis Automatic TouchDown (ATD) one-step process was optimized using real-time PCR conducted with Roche’s LightCycler 1.5 real-time thermal cycling machine with a temperature transition of 20°C/s. Real-time gene synthesis was conducted with 20 µl of reaction mixture containing 1× PCR buffer (Novagen), 2× LCGreen I (Idaho Technology Inc.), mM of MgSO4, mM each of Page 66 National University of Singapore Department of Electrical and Computer Engineering dNTP (Stratagene), 500 µg/ml of bovine serum albumin (BSA), 1–40 nM of oligonucleotides, 400 nM of forward and reverse primers, and U of KOD Hot Start (Novagen). The PCRs were conducted with: of initial denaturation at 95°C; 30 cycles of 95°C for s, 58–70°C for 30 s, 72°C for 90 s; and final extension at 72°C for 10 min. Desalted oligonucleotides were purchased from Sigma-Aldrich without additional purification. The outer primers are summarized in Table 5.2 with predicted melting temperatures calculated using IDT SciTools [85] according to the assembly buffer condition. 5.2.3 Gel electrophoresis The synthesized products were analyzed by 1.5% agarose gel (NuSieve® GTG®, Cambrex Corporation), stained with ethidium bromide (Bio-Rad Laboratories) or SYBR Green (Invitrogen), and visualized using Typhoon 9410 variable imager (Amersham Biosciences). Gel electrophoreses were performed at 100 V for 45 with 100 bp ladder (New England) and μL of DNA samples. Table 5.2: Summary of primers for conventional one-step, and ATD one-step gene syntheses. All PCR assemblies are performed with an annealing temperature of 70°C. Tm (°C) Length (nt) GTTTTTCTTTCTGAATCTTTATTTTTTTAAGAGACAAG AAGCTTGGCCGCCG AGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTgtttttg tttctgaatctttattttttt AGAAGAAGAAGAAGAAGAAGAAGAAGAAGAaagcttgg ccgccg 62.1 58 69.1 / 55.3 38 14 61 / 28 72.5 / 58 44 / 14 ATGAATGAGGTGTCTGTCATCAAAGAAGGC TCACTCGCGGATGCTGGCC AGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAatg aatgaggtgtctgtcat AGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTt cactcgcggatgctg 62.9 65.8 71.4/ 55.4 30 19 53 / 20 70.6/ 57.4 52 / 16 Primer (5’→3’) S100A4 1-step 1-step ATD ATD PKB2 1-step 1-step ATD ATD Page 67 National University of Singapore Department of Electrical and Computer Engineering 5.3 Theoretical analysis of DNA hybridization kinetics The assembly efficiency of PCR and LCR gene synthesis relies on the effectiveness of hybridization reaction of assembly oligonucleotides at the annealing temperature. The hybridization effectiveness, expressed as the half-time constant of the hybridization reaction of a single-stranded DNA (ssDNA) in a mixture, is a function of the number of unique oligonucleotides and the oligonucleotide concentration [110]. The DNA hybridization reaction starts when the portion of two complementary ssDNA strands collides and forms a nucleation site; then the rest of the sequence rapidly zippers to form a dsDNA. It has been shown that the nucleation step is the reaction limitation, and the hybridization reaction rate constant of a ssDNA in a mixture is given by [110]: k= k N LS N , 5.1 where LS is the length of the shorter strand participated, k N is a nucleation rate constant, and N is the complexity of the mixture, which is the number of unique oligonucleotide in the gene assembly mixture, or the primer length for standard PCR amplification. For standard PCR amplification whereby the mixture contains only excess primers and template DNA, the hybridization reaction can be described by a pseudo-first order reaction with a half-time constant of: t1 / = ln kC o 5.2 where Co is the total nucleotide concentration. Under the typical PCR amplification conditions ( k N ≈ ×104 /M⋅s) with a primer of 20 base long ( LS = N = 20) and a primer concentration (C) of µM ( Co = C × N), the annealing half-time is ~ s. For gene assembly where the DNA is constructed from a pool of oligonucleotides with equal concentration, the hybridization reactions can be described by second-order kinetics with a half-time constant of: Page 68 National University of Singapore Department of Electrical and Computer Engineering t1 / = kCo 5.3 If we consider assembling a pool of 30 oligonuceltoides (N = 30) with an average length of 50 nt ( LS ) and a concentration of 10 nM (C), the annealing half-time will be ~ 339 s. In addition, the annealing half-time of outer primer (20 nt, 400 nM) will be ~ 46.4 sec. For gene synthesis with an ultralow oligonucleotide concentration of nM and an outer primer of 400 nM, the assembly annealing half-time dramatically increases to ~ 3390 s, while the amplification half-time remains unchanged (~ 46.4 s). For overlapping PCR assembly, the average DNA length is getting longer with each PCR cycle, while the total number of strands does not change. As the reaction proceeds, various intermediate DNAs are generated from the original short oligonucleotides. Hence, the complexity (N) and will increase while concentration of each DNA fragment (C) will gradually decrease. Both extendable and unextendable pairings could occur. Duplex annealed in the 3’ recessed configuration can be extended, while dsDNA annealed with 3’ ends protruded will not be extended. Unlike the exponential nature of PCR amplification, the average DNA length is most likely to increase linearly while the complexity (N) may increase more rapidly as intermediate DNAs are generated. The unextendable annealing could further complicate the assembly. Accounting for these factors, the half-time constant may increase as reaction proceeds. The Lightcycler has an ultrafast temperature transition (20°C/s). For a typical thermocycler, the ramp rate is normally ≤ 4°C/s (DNA Engine PTC-200, Bio-Rad). With this thermocycler, the ramp time from 95°C to 60°C (annealing temperature) can take ~ 8.75 s, which would be sufficient for the annealing reaction to be completed in normal PCR amplification. In addition, KOD polymerase has a very fast elongation rate (~ 120 bases/s) [112] . The required extension time is shorter than 10s for kbp extension, which roots out the potential reaction limitation contributed by polymerase enzyme. In summary, it is important to realize that the complexity of the assembly mixture will increase the half-life in gene assembly. The outer primer and assembly oligonucleotide have Page 69 National University of Singapore Department of Electrical and Computer Engineering different annealing half-times that depend on their concentrations. Reducing the oligonucleotide concentration may only slightly affect its melting temperature, but it can profoundly affect the annealing kinetics. The same derivation may be applied to the ligase chain reaction (LCR) gene synthesis, which has similar underlying annealing reaction. 5.4 Real-time performance study of ATD one-step gene synthesis For normal PCR amplifications, their half-time constant could be as short as a few seconds, dependent on the outer primer concentration. However, this constant can be significantly increased to hundreds to thousands of seconds due to the low oligonucleotide concentration (usually 10–40 nM), and the complex assembly mixture containing several tens of oligonucleotides. 5.4.1 Effect of varying extension time during ATD one-step gene synthesis The key mechanism of reaction half-time was demonstrated by synthesizing the S100A4 (752 bp) and PKB2 (1446 bp) using a rapid thermal cycler with a temperature transition of 20°C/s. ATD one-step gene synthesis was performed using the empirically optimized real-time gene synthesis protocol (Chapter IV), with either 20 s or 120 s of combined annealing (70°C) and extension (72°C), 2× LCGreen I, mM dNTPs, and mM Mg2+ ion. Results clearly indicated that insufficient hybridization (20-s reaction) could cause the assembly efficiency to degrade, resulting in incomplete products with DNA length of ~ 200–300 bp (Figure 5.2). The effect of reaction time was further studied by varying the extension time from 30 s to 120 s for S100A4, assembled with 10 nM and nM oligonucleotide, respectively. For assembly with 10 nM oligonucleotide, the reaction time was less critical. Fairly high assembly efficiency was observed where the fluorescence intensity increased as the assembly process progressed (Figures 5.3a,c). The normal 30-s extension was sufficient to generate the full-length products, whereas prolonged extension (≥ 90 s) promoted the reaction so that the assembly process reached the plateau faster (in ~ 25 cycles). In contrast, the assembly from nM oligonucleotide has very low assembly efficiency (Figures 5.3b,d), with a fluorescence curve like the single molecular Page 70 National University of Singapore Department of Electrical and Computer Engineering DNA amplification [88]. The gel results clearly indicated that prolonged hybridization (≥ 90 s) was essential for ssDNA to be effectively annealed at such a low oligonucleotide concentration. (a) (b) (c) (d) Figure 5.2: Effect of hybridization reaction time. Top: Agarose gel results of (a) S100A4-1, (b) S100A4-2, and (c) PKB2 synthesized with: (1) 10-s annealing (70°C) plus 10-s extension (72°C), and (2) 30-s annealing (70°C) plus 90-s extension (72°C). Bottom: The corresponding fluorescent curves for S100A4-1 (□: 20 s, ■: 120 s), S100A4-2 (Δ: 20 s, ▲: 120 s), and PKB2 (○: 20 s, ●: 120 s). The concentrations of oligonucleotides and outer primers are 10 nM and 400 nM, respectively. 5.4.2 Effect of varying initial oligonucleotides concentration The gene synthesis took place in several phases, as revealed by the variation in slopes with the number of PCR cycles (Figure 5.4). The overlapping assembly was a parallel process (see Appendix IV for the derivation). Theoretically, PCR cycles would be sufficient for assembling S100A4 (752 bp) from a pool of 32 oligonucleotides. Hence, relatively few PCR cycles were needed to create a full-length dsDNA. This was clearly indicated by the slope change in the fluorescent curve in the early cycles (< 10 cycles). The slope became steeper as the full-length Page 71 National University of Singapore Department of Electrical and Computer Engineering template emerged and became amplified, taking advantage of the exponential nature of PCR amplification. This phenomenon was remarkable with an oligonucleotide concentration of 5–20 nM. No obvious full-length gene product was obtained with nM oligonucleotide within 30 PCR cycles, since the amplification stage was delayed due to its low assembly efficiency. (a) (b) (c) (d) Figure 5.3: The synthesis yield is dependent on the extension time. S100A4-2 (752 bp) is synthesized with various extension time from 30 s to 120 s at an annealing temperature of 70°C (30 s) with oligonucleotide concentration of (a,c) 10 nM and (b,d) nM. (a, b) Fluorescence as a function of extension time of 30 s (◊), 60 s (▲), 90 s (♦), and 120 s (□). (c, d) The corresponding agarose gel electrophoresis results. The synthesis from 10 nM oligonucleotides reaches the plateau within 30 cycles, while the reaction from nM oligonucleotides only enters the amplification phase after 30 cycles. For gene synthesis with ≥ 20 nM of oligonucleotides, the PCR process reached the plateau within 15–20 cycles. Additional cycles would favor non-specific PCR, and lead to the build up of high molecular weight products (7,10-12) and the generation of spurious bands as shown in Figure 5.4b (indicated by the arrow). The gel results and real-time PCR curves Page 72 National University of Singapore Department of Electrical and Computer Engineering Table A1.4: Oligonucleotides set designed for S100A4. Label F0 Oligonucleotide sequence (5’ to 3’) GTTTTTGTTTCTGAATCTTTATTTTTTTAAGAGACAAGGTCCTCTGTGTTGCTCAGGCT R0 F1 R1 F2 R2 F3 R3 TGCTCAAGCCACTGCTCTCCAGCCTGAGCAACACAGAGGAC GGAGAGCAGTGGCTTGAGCATAGCCAACTGCAGTCTCGAACT AGGAGGATCATTTGAGCCCAGGAGTTCGAGACTGCAGTTGGCTA CCTGGGCTCAAATGATCCTCCTGTCTCAGCTTCCTGACTAGCTGG GCATGGCTGTAGCCTGTAGTCCCAGCTAGTCAGGAAGCTGAGAC GACTACAGGCTACAGCCATGCTGCCCAGCTAATTAAAAAAAAAAATTGTTTTTC GCAACATAGAGAGACTTCTGTCTCTATAAAAAGGAAAAACAATTTTTTTTTTTAATTAGC TGGGCA CTTTTTATAGAGACAGAAGTCTCTCTATGTTGCCTAGGCTGGTCTTGAACTCCTGG F4 R4 GAGATGGGAGGATCGCCTGAGGCCAGGAGTTCAAGACCAGCCTAG CCTCAGGCGATCCTCCCATCTCCCCCCTAGCTTTTGTGTCACCACATTT F5 R5 TGACAGGTGGGAGATTGCCCTGGAAATGTGGTGACACAAAAGCTAGGGGG CCAGGGCAATCTCCCACCTGTCACCCACCACCCCCTGCATCTCC F6 R6 GGAGTAGTCCCATGGGGACCTAGGAAAGGAGATGCAGGGGGTGGTGGG TTTCCTAGGTCCCCATGGGACTACTCCCTGTCCCCCATGCTCCAGGCAC F7 R7 AGGTGGAGGAAGGGGCAGCCTGTGCCTGGAGCATGGGGGACAG AGGCTGCCCCTTCCTCCACCTCTCTAAAACTCAGGCTGAGCTATGTACACTGGG F8 R8 GGGGACTGGATGAGATGGGCACCACCCAGTGTACATAGCTCAGCCTGAGTTTTAGAG F9 TGGTGCCCATCTCATCCAGTCCCCTGCTAGTAACCGCTAGGGCTTACCCGTTAC R9 TTCCCAGGTGGGCACCCGTGGGTAACGGGTAAGCCCTAGCGGTTACTAGCA F10 CCACGGGTGCCCACCTGGGAACAGGAGGCTTGGTTCCACGGCTGG R10 GCCACAGCACCCTCCACCAGCCCAGCCGTGGAACCAAGCCTCCTG F11 GCTGGTGGAGGGTGCTGTGGCACTTACCGCATCAGCCCACAGCAG R11 GACAGGGGAGAGCGGATACTGCCTTCCTGCTGTGGGCTGATGCGGTAAGT F12 GAAGGCAGTATCCGCTCTCCCCTGTCCCCTGCTATGGGCAGGGCCTG R12 GCCCAGAGGTCTGACCTATTTATACCCCAGCCAGGCCCTGCCCATAGCAGGG F13 GCTGGGGTATAAATAGGTCAGACCTCTGGGCCGTCCCCATTCTTCCCCTCTCTACAACC R13 AGATCTTGATGAAGAAGCGCTGAGGAGAGAGGGTTGTAGAGAGGGGAAGAATGGGGACG F14 CTCTCTCCTCAGCGCTTCTTCATCAAGATCTGGCCTCGGCGGCCAAGCTT R14 AAGCTTGGCCGCCGAGGCC F_Primer GTTTTTGTTTCTGAATCTTTATTTTTTTAAGAGACAAG AAGCTTGGCCGCCGAGGCC R_Primer Tm (°C) Overlap Length (bp) (nt) 62.6 21 59 62.8 62.0 62.1 62.6 61.1 61.2 62.2 20 22 22 23 21 33 33 41 42 44 45 44 54 66 62.5 64.2 65.8 66.6 67.2 66.8 67.7 67.9 67.8 68.3 69.2 69.4 69.8 68.5 67.6 68.3 67.6 69.2 68.0 67.5 68.7 23 22 27 23 21 27 22 21 33 24 30 21 24 21 24 26 21 31 28 31 19 56 45 49 50 44 48 49 43 54 57 54 51 45 45 45 50 47 52 59 59 50 19 38 19 61.3 68.7 References of appendix I: 1. Binkowski,B.F., Richmond,K.E., Kaysen,J., Sussman,M.R. and Belshaw,P.J. (2005) Correcting errors in synthetic DNA through consensus shuffling. Nucleic Acids Res., 33, e55. 2. Gao,X., Yo,P., Keith,A., Ragan,T.J. and Harris,T.K. (2003) Thermodynamically balanced inside-out (TBIO) PCR-based gene synthesis: A novel method of primer design for highfidelity assembly of longer gene sequences. Nucleic Acids Res., 31, e143. Page 124 National University of Singapore Department of Electrical and Computer Engineering Appendix II Table A2.1: Oligonucleotides set designed for S100A4. Label Oligonucleotide sequence (5’ to 3’) Tm (°C) Overlap (bp) Length (nt) GTTTTTGTTTCTGAATCTTTATTTTTTTAAGAGACAAGGTCCTCTGTGTTGCTCA GGCT TGCTCAAGCCACTGCTCTCCAGCCTGAGCAACACAGAGGAC GGAGAGCAGTGGCTTGAGCATAGCCAACTGCAGTCTCGAACT AGGAGGATCATTTGAGCCCAGGAGTTCGAGACTGCAGTTGGCTA CCTGGGCTCAAATGATCCTCCTGTCTCAGCTTCCTGACTAGCTGG GCATGGCTGTAGCCTGTAGTCCCAGCTAGTCAGGAAGCTGAGAC GACTACAGGCTACAGCCATGCTGCCCAGCTAATTAAAAAAAAAAATTGTTTTTC 62.6 21 59 62.8 62.0 62.1 62.6 61.1 61.2 20 22 22 23 21 33 41 42 44 45 44 54 62.2 33 66 62.5 23 56 R4 GCAACATAGAGAGACTTCTGTCTCTATAAAAAGGAAAAACAATTTTTTTTTTTAA TTAGCTGGGCA CTTTTTATAGAGACAGAAGTCTCTCTATGTTGCCTAGGCTGGTCTTGAACTCCTG G GAGATGGGAGGATCGCCTGAGGCCAGGAGTTCAAGACCAGCCTAG 64.2 22 45 F5 R5 F6 R6 F7 R7 F8 CCTCAGGCGATCCTCCCATCTCCCCCCTAGCTTTTGTGTCACCACATTT TGACAGGTGGGAGATTGCCCTGGAAATGTGGTGACACAAAAGCTAGGGGG CCAGGGCAATCTCCCACCTGTCACCCACCACCCCCTGCATCTCC GGAGTAGTCCCATGGGGACCTAGGAAAGGAGATGCAGGGGGTGGTGGG TTTCCTAGGTCCCCATGGGACTACTCCCTGTCCCCCATGCTCCAGGCAC AGGTGGAGGAAGGGGCAGCCTGTGCCTGGAGCATGGGGGACAG AGGCTGCCCCTTCCTCCACCTCTCTAAAACTCAGGCTGAGCTATGTACACTGGG 65.8 66.6 67.2 66.8 67.7 67.9 67.8 27 23 21 27 22 21 33 49 50 44 48 49 43 54 R8 GGGGACTGGATGAGATGGGCACCACCCAGTGTACATAGCTCAGCCTGAGTTTTAG AG TGGTGCCCATCTCATCCAGTCCCCTGCTAGTAACCGCTAGGGCTTACCCGTTAC TTCCCAGGTGGGCACCCGTGGGTAACGGGTAAGCCCTAGCGGTTACTAGCA CCACGGGTGCCCACCTGGGAACAGGAGGCTTGGTTCCACGGCTGG GCCACAGCACCCTCCACCAGCCCAGCCGTGGAACCAAGCCTCCTG GCTGGTGGAGGGTGCTGTGGCACTTACCGCATCAGCCCACAGCAG GACAGGGGAGAGCGGATACTGCCTTCCTGCTGTGGGCTGATGCGGTAAGT GAAGGCAGTATCCGCTCTCCCCTGTCCCCTGCTATGGGCAGGGCCTG GCCCAGAGGTCTGACCTATTTATACCCCAGCCAGGCCCTGCCCATAGCAGGG GCTGGGGTATAAATAGGTCAGACCTCTGGGCCGTCCCCATTCTTCCCCTCTCTAC AACC AGATCTTGATGAAGAAGCGCTGAGGAGAGAGGGTTGTAGAGAGGGGAAGAATGGG GACG CTCTCTCCTCAGCGCTTCTTCATCAAGATCTGGCCTCGGCGGCCAAGCTT 68.3 24 57 69.2 69.4 69.8 68.5 67.6 68.3 67.6 69.2 68.0 30 21 24 21 24 26 21 31 28 54 51 45 45 45 50 47 52 59 67.5 31 59 68.7 19 F0 R0 F1 R1 F2 R2 F3 R3 F4 F9 R9 F10 R10 F11 R11 F12 R12 F13 R13 F14 AAGCTTGGCCGCCGAGGCC R14 GTTTTTCTTTCTGAATCTTTATTTTTTTAAGAGACAAG 1-Step F Primer AAGCTTGGCCGCCGAGGCC 1-Step R Primer GTTTTTGTTTCTGAATCTTTATTTT TD 1-step F Primer AAGCTTGGCCGCCG TD 1-step R Primer 59.4 63.4 49.4 50.9 50 19 38 19 25 14 Page 125 National University of Singapore Department of Electrical and Computer Engineering Appendix III Table A3.1: Semi-optimized oligonucleotides set (S100A4-1) designed for S100A4 with oligonucleotide concentration of 10 nM. Label Oligonucleotide sequence (5’ to 3’) F1 GTTTTTGTTTCTGAATCTTTATTTTTTTAAGAGACAAGGTCCTCTGTGTTGCTCA GGCT TGCTCAAGCCACTGCTCTCCAGCCTGAGCAACACAGAGGAC R1 GGAGAGCAGTGGCTTGAGCATAGCCAACTGCAGTCTCGAACT F2 AGGAGGATCATTTGAGCCCAGGAGTTCGAGACTGCAGTTGGCTA R2 CCTGGGCTCAAATGATCCTCCTGTCTCAGCTTCCTGACTAGCTGG F3 GCATGGCTGTAGCCTGTAGTCCCAGCTAGTCAGGAAGCTGAGAC R3 GACTACAGGCTACAGCCATGCTGCCCAGCTAATTAAAAAAAAAAATTGTTTTTC F4 GCAACATAGAGAGACTTCTGTCTCTATAAAAAGGAAAAACAATTTTTTTTTTTAA R4 TTAGCTGGGCA CTTTTTATAGAGACAGAAGTCTCTCTATGTTGCCTAGGCTGGTCTTGAACTCCTG F5 G GAGATGGGAGGATCGCCTGAGGCCAGGAGTTCAAGACCAGCCTAG R5 F6 CCTCAGGCGATCCTCCCATCTCCCCCCTAGCTTTTGTGTCACCACATTT TGACAGGTGGGAGATTGCCCTGGAAATGTGGTGACACAAAAGCTAGGGGG R6 CCAGGGCAATCTCCCACCTGTCACCCACCACCCCCTGCATCTCC F7 GGAGTAGTCCCATGGGGACCTAGGAAAGGAGATGCAGGGGGTGGTGGG R7 TTTCCTAGGTCCCCATGGGACTACTCCCTGTCCCCCATGCTCCAGGCAC F8 R8 AGGTGGAGGAAGGGGCAGCCTGTGCCTGGAGCATGGGGGACAG AGGCTGCCCCTTCCTCCACCTCTCTAAAACTCAGGCTGAGCTATGTACACTGGG F9 GGGGACTGGATGAGATGGGCACCACCCAGTGTACATAGCTCAGCCTGAGTTTTAG R9 AG TGGTGCCCATCTCATCCAGTCCCCTGCTAGTAACCGCTAGGGCTTACCCGTTAC F10 TTCCCAGGTGGGCACCCGTGGGTAACGGGTAAGCCCTAGCGGTTACTAGCA R10 CCACGGGTGCCCACCTGGGAACAGGAGGCTTGGTTCCACGGCTGG F11 GCCACAGCACCCTCCACCAGCCCAGCCGTGGAACCAAGCCTCCTG R11 GCTGGTGGAGGGTGCTGTGGCACTTACCGCATCAGCCCACAGCAG F12 GACAGGGGAGAGCGGATACTGCCTTCCTGCTGTGGGCTGATGCGGTAAGT R12 GAAGGCAGTATCCGCTCTCCCCTGTCCCCTGCTATGGGCAGGGCCTG F13 GCCCAGAGGTCTGACCTATTTATACCCCAGCCAGGCCCTGCCCATAGCAGGG R13 GCTGGGGTATAAATAGGTCAGACCTCTGGGCCGTCCCCATTCTTCCCCTCTCTAC F14 AACC AGATCTTGATGAAGAAGCGCTGAGGAGAGAGGGTTGTAGAGAGGGGAAGAATGGG R14 GACG CTCTCTCCTCAGCGCTTCTTCATCAAGATCTGGCCTCGGCGGCCAAGCTT F15 AAGCTTGGCCGCCGAGGCC R15 GTTTTTCTTTCTGAATCTTTATTTTTTTAAGAGACAAG 1-Step F Primer AAGCTTGGCCGCCGAGGCC 1-Step R Primer AGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTgtttttgtttc ATD 1-Step F Primer tgaatctttattttttt ATD 1-Step R Primer AGAAGAAGAAGAAGAAGAAGAAGAAGAAGAaagcttggccgccg Tm (°C) Overlap (bp) Length (nt) 62.6 21 59 62.8 62.0 62.1 62.6 61.1 61.2 62.2 20 22 22 23 21 33 33 41 42 44 45 44 54 66 62.5 23 56 64.2 65.8 66.6 67.2 66.8 67.7 67.9 67.8 68.3 22 27 23 21 27 22 21 33 24 45 49 50 44 48 49 43 54 57 69.2 69.4 69.8 68.5 67.6 68.3 67.6 69.2 68.0 30 21 24 21 24 26 21 31 28 54 51 45 45 45 50 47 52 59 67.5 31 59 68.7 67.7 59.4 63.4 69.3 / 55.7 70.1 / 58 19 19 28 50 19 38 19 61 14 44 Page 126 National University of Singapore Department of Electrical and Computer Engineering Table A3.2: Optimized oligonucleotides set (S100A4-2) designed for S100A4 with oligonucleotide concentration of 10 nM. Label Oligonucleotide sequence (5’ to 3’) GTTTTTGTTTCTGAATCTTTATTTTTTTAAGAGACAAGGTCCTCTGTGTTGCTC AGGCTGGA GGCTATGCTCAAGCCACTGCTCTCCAGCCTGAGCAACACAGAGG GAGCAGTGGCTTGAGCATAGCCAACTGCAGTCTCGAACTCCTGGG GAAGCTGAGACAGGAGGATCATTTGAGCCCAGGAGTTCGAGACTGCAGTT CTCAAATGATCCTCCTGTCTCAGCTTCCTGACTAGCTGGGACTACAGGCTAC TTTTAATTAGCTGGGCAGCATGGCTGTAGCCTGTAGTCCCAGCTAGTCAG AGCCATGCTGCCCAGCTAATTAAAAAAAAAAATTGTTTTTCCTTTTTATAGAGA CAGAAGTCTC F4 TTCAAGACCAGCCTAGGCAACATAGAGAGACTTCTGTCTCTATAAAAAGGAAAA ACAATTTTTTT R4 F5 TCTATGTTGCCTAGGCTGGTCTTGAACTCCTGGCCTCAGGCGATCC R5 CAAAAGCTAGGGGGGAGATGGGAGGATCGCCTGAGGCCAGGAG F6 TCCCATCTCCCCCCTAGCTTTTGTGTCACCACATTTCCAGGGCAATCT R6 GGTGGTGGGTGACAGGTGGGAGATTGCCCTGGAAATGTGGTGACA F7 CCCACCTGTCACCCACCACCCCCTGCATCTCCTTTCCTAGGTCC R7 GGGACAGGGAGTAGTCCCATGGGGACCTAGGAAAGGAGATGCAGGG F8 CCATGGGACTACTCCCTGTCCCCCATGCTCCAGGCACAGGCT R8 TTTTAGAGAGGTGGAGGAAGGGGCAGCCTGTGCCTGGAGCATGG F9 GCCCCTTCCTCCACCTCTCTAAAACTCAGGCTGAGCTATGTACACTGGG R9 GGACTGGATGAGATGGGCACCACCCAGTGTACATAGCTCAGCCTGAG F10 TGGTGCCCATCTCATCCAGTCCCCTGCTAGTAACCGCTAGGGCTT R10 GCACCCGTGGGTAACGGGTAAGCCCTAGCGGTTACTAGCAGG F11 ACCCGTTACCCACGGGTGCCCACCTGGGAACAGGAGGCTT R11 CCAGCCCAGCCGTGGAACCAAGCCTCCTGTTCCCAGGTGG F12 GGTTCCACGGCTGGGCTGGTGGAGGGTGCTGTGGCACTT R12 TGCTGTGGGCTGATGCGGTAAGTGCCACAGCACCCTCCA F13 ACCGCATCAGCCCACAGCAGGAAGGCAGTATCCGCTCTCCC R13 CCTGCCCATAGCAGGGGACAGGGGAGAGCGGATACTGCCTTCC F14 CTGTCCCCTGCTATGGGCAGGGCCTGGCTGGGGTATAAATAGGTCA R14 GGGGACGGCCCAGAGGTCTGACCTATTTATACCCCAGCCAGGC F15 GACCTCTGGGCCGTCCCCATTCTTCCCCTCTCTACAACCCTCTCT R15 CAGATCTTGATGAAGAAGCGCTGAGGAGAGAGGGTTGTAGAGAGGGGAAGAAT F16 CCTCAGCGCTTCTTCATCAAGATCTGGCCTCGGCGGCCAAGCTT R16 AAGCTTGGCCGCCGAGGC GTTTTTCTTTCTGAATCTTTATTTTTTTAAGAGACAAG 1-Step F Primer AAGCTTGGCCGCCGAGGCC 1-Step R Primer AGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTgtttttgtttct ATD 1-Step F gaatctttattttttt Primer AGAAGAAGAAGAAGAAGAAGAAGAAGAAGAaagcttggccgccg ATD 1-Step R Primer F1 R1 F2 R2 F3 R3 Tm (°C) Overlap (bp) Length (nt) 65.45 64.77 65.38 64.6 64.92 64.91 22 22 23 27 25 25 62 44 45 50 52 50 64.72 39 64 65.06 65.24 64.78 66.05 65.59 65.28 64.52 65.73 64.92 65.65 65.04 65.03 65.38 64.99 66.39 64.93 65.4 65.41 65.46 65.28 64.6 65.56 65.1 66.55 65.6 59.4 63.4 69.3 / 55.7 70.1 / 58 26 20 23 25 20 24 22 20 24 25 22 23 19 21 19 20 19 22 21 25 18 27 26 18 18 28 65 46 43 48 45 44 46 42 44 49 47 45 42 40 40 39 39 41 43 46 43 45 53 44 18 38 19 61 14 44 Page 127 National University of Singapore Department of Electrical and Computer Engineering Table A3.3: Oligonucleotides set designed for PKB2 with oligonucleotide concentration of 10 nM. Label Oligonucleotide sequence (5’ to 3’) Tm (°C) Overlap (bp) Length (nt) F1 ATGAATGAGGTGTCTGTCATCAAAGAAGGCTGGCTCCACAAGCGTGGTGAA 65.71 21 R1 CCGTGGCCTCCAGGTCTTGATGTATTCACCACGCTTGTGGAGCCA 67.23 24 45 F2 TACATCAAGACCTGGAGGCCACGGTACTTCCTGCTGAAGAGCGACGG 65.43 23 47 R2 GCCTCTCCTTGTACCCAATGAAGGAGCCGTCGCTCTTCAGCAGGAAGTA 66.07 26 49 F3 CTCCTTCATTGGGTACAAGGAGAGGCCCGAGGCCCCTGATCAGACTCTA 65.89 23 49 R3 GCTACGGAGAAGTTGTTTAAGGGGGGTAGAGTCTGATCAGGGGCCTCGG 66.49 26 49 F4 CCCCCCTTAAACAACTTCTCCGTAGCAGAATGCCAGCTGATGAAGACCGAGA 67.24 26 52 R4 AAAGGTGTTGGGTCGCGGCCTCTCGGTCTTCATCAGCTGGCATTCT 66.79 20 46 F5 GGCCGCGACCCAACACCTTTGTCATACGCTGCCTGCAGTGGA 66.05 22 42 R5 TGGAAGGTCCTCTCGATGACTGTGGTCCACTGCAGGCAGCGTATGAC 66.82 25 47 F6 CCACAGTCATCGAGAGGACCTTCCACGTGGATTCTCCAGACGAGAGGGA 66.46 24 49 R6 GGATGGCCCGCATCCACTCCTCCCTCTCGTCTGGAGAATCCACG 66.16 20 44 F7 GGAGTGGATGCGGGCCATCCAGATGGTCGCCAACAGCCTCAA 65.48 22 42 R7 GCCTGGGGCCCGCTGCTTGAGGCTGTTGGCGACCATCT 66.58 16 38 F8 R8 GCAGCGGGCCCCAGGCGAGGACCCCATGGACTACAAGTGTG TGGAGGAGTCACTGGGGGAGCCACACTTGTAGTCCATGGGGTCCTC 65.82 66.23 25 21 41 46 F9 GCTCCCCCAGTGACTCCTCCACGACTGAGGAGATGGAAGTGGCG 66.00 23 44 R9 66.71 23 46 66.81 32 55 R10 ACTTTAGCCCGTGCCTTGCTGACCGCCACTTCCATCTCCTCAGTCG GTCAGCAAGGCACGGGCTAAAGTGACCATGAATGACTTCGACTATCTCAAACT CC ACTTTGCCAAAGGTTCCCTTGCCAAGGAGTTTGAGATAGTCGAAGTCATTCAT GGTC 67.20 25 57 F11 TTGGCAAGGGAACCTTTGGCAAAGTCATCCTGGTGCGGGAGAAGGC 66.25 21 46 R11 TGGCGTAGTAGCGGCCAGTGGCCTTCTCCCGCACCAGGATG 65.37 20 41 F12 CACTGGCCGCTACTACGCCATGAAGATCCTGCGAAAGGAAGTCATCA 65.69 27 47 R12 GTGTGAGCGACTTCATCCTTGGCAATGATGACTTCCTTTCGCAGGATCTTCA 66.94 25 52 F13 TTGCCAAGGATGAAGTCGCTCACACAGTCACCGAGAGCCGGGTCC 66.60 20 45 R13 ACGGGTGCCTGGTGTTCTGGAGGACCCGGCTCTCGGTGACT 66.96 21 41 F14 TCCAGAACACCAGGCACCCGTTCCTCACTGCGCTGAAGTATGCC 66.00 23 44 R14 AGGCGGTCGTGGGTCTGGAAGGCATACTTCAGCGCAGTGAGGA 66.54 20 43 F15 TTCCAGACCCACGACCGCCTGTGCTTTGTGATGGAGTATGCCAACG 66.17 26 46 R15 CAGGTGGAAGAACAGCTCACCCCCGTTGGCATACTCCATCACAAAGCAC 66.20 23 49 F16 GGGGTGAGCTGTTCTTCCACCTGTCCCGGGAGCGTGTCTTCACA 66.66 21 44 R16 F17 AAAACCGGGCCCGCTCCTCTGTGAAGACACGCTCCCGGGA GAGGAGCGGGCCCGGTTTTATGGTGCAGAGATTGTCTCGGCTC 65.79 65.95 19 24 40 43 R17 GTCCCGCGAGTGCAAGTACTCAAGAGCCGAGACAATCTCTGCACCAT 66.13 23 47 F18 TTGAGTACTTGCACTCGCGGGACGTGGTATACCGCGACATCAAGCTGG 66.85 25 48 R18 65.72 26 51 F19 GCCATCTTTGTCCAGCATGAGGTTTTCCAGCTTGATGTCGCGGTATACCAC AAAACCTCATGCTGGACAAAGATGGCCACATCAAGATCACTGACTTTGGCCTC T 66.49 28 54 R19 CCCGTCACTGATGCCCTCTTTGCAGAGGCCAAAGTCAGTGATCTTGATGTG 67.04 23 51 F20 GCAAAGAGGGCATCAGTGACGGGGCCACCATGAAAACCTTCTGTGGG 65.58 24 47 R20 GCGCCAGGTACTCCGGGGTCCCACAGAAGGTTTTCATGGTGGC 67.11 19 43 F21 ACCCCGGAGTACCTGGCGCCTGAGGTGCTGGAGGACAATGACT 65.37 24 43 R21 AGTCCACGGCCCGGCCATAGTCATTGTCCTCCAGCACCTCAG 66.98 18 42 F22 ATGGCCGGGCCGTGGACTGGTGGGGGCTGGGTGTGG 65.54 18 36 R22 GGCCGCACATCATCTCGTACATGACCACACCCAGCCCCCACC 66.23 24 42 F23 TCATGTACGAGATGATGTGCGGCCGCCTGCCCTTCTACAACCAGGAC 66.26 23 47 R23 AGCTCGAAGAGGCGCTCGTGGTCCTGGTTGTAGAAGGGCAGGC 65.65 20 43 F24 CACGAGCGCCTCTTCGAGCTCATCCTCATGGAAGAGATCCGCTTCC 66.17 26 46 R24 GGGGCTGAGCGTGCGCGGGAAGCGGATCTCTTCCATGAGGATG 67.28 17 43 F25 CGCGCACGCTCAGCCCCGAGGCCAAGTCCCTGCTTGCT 65.88 21 38 F10 51 Page 128 National University of Singapore Department of Electrical and Computer Engineering R25 TTGGGGTCCTTCTTAAGCAGCCCAGCAAGCAGGGACTTGGCCTC 65.75 23 44 F26 GGGCTGCTTAAGAAGGACCCCAAGCAGAGGCTTGGTGGGGGG 65.83 19 42 R26 ACCTCCTTGGCATCGCTGGGCCCCCCACCAAGCCTCTGC 65.45 20 39 F27 CCCAGCGATGCCAAGGAGGTCATGGAGCACAGGTTCTTCCTCAGC 66.80 25 45 R27 GGACCACGTCCTGCCAGTTGATGCTGAGGAAGAACCTGTGCTCCATG 65.76 22 47 F28 ATCAACTGGCAGGACGTGGTCCAGAAGAAGCTCCTGCCACCCTTCA 66.94 24 46 R28 66.97 23 47 65.87 31 54 R29 GACCTCGGACGTGACCTGAGGTTTGAAGGGTGGCAGGAGCTTCTTCT AACCTCAGGTCACGTCCGAGGTCGACACAAGGTACTTCGATGATGAATTTACC G GGGGTGTGATTGTGATGGACTGGGCGGTAAATTCATCATCGAAGTACCTTGTG TC 66.45 24 55 F30 CCCAGTCCATCACAATCACACCCCCTGACCGCTATGACAGCCTGGG 65.88 22 46 R30 TCCGCTGGTCCAGCTCCAGTAAGCCCAGGCTGTCATAGCGGTCAG 67.08 23 45 66.90 65.80 66.97 65.80 72.7 / 57.2 71.7 / 59 25 19 20 48 44 30 19 53 16 52 F29 F31 CTTACTGGAGCTGGACCAGCGGACCCACTTCCCCCAGTTCTCCTACTC R31 TCACTCGCGGATGCTGGCCGAGTAGGAGAACTGGGGGAAGTGGG F Primer ATGAATGAGGTGTCTGTCATCAAAGAAGGC R Primer TCACTCGCGGATGCTGGCC AGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAatgaatga ATD 1-Step F Primer ggtgtctgtcat AGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTtcact ATD 1-Step R Prim er cgcggatgctg Page 129 National University of Singapore Department of Electrical and Computer Engineering Table A3.4: Partial list of potential mishybridizations for SA100A4 gene synthesis predicted by TmPrime gene synthesis software (http://prime.ibn.a-star.edu.sg). The oligonucleotides are alternately displayed in upper and lower case for ease of finding the oligonucleotide boundaries. Both the forward and reverse mishybridizations are reported, which have the same number of matched bases, but may generate different mishybridization formations during the assembly. Motif match forward No: hit count: 32 length: 48 86 ACTGCAGTCTCGAACTCCTGGGctcaaatgatcctcctgtctcagctt | |||| |||||||||| |||| |||||||| |||| | 236 TCCGACCAGAACTTgaggaccggagtccgctaggagggtagagggggg 236 aggctggtcttgaactcctggcctcaggcgatccTCCCATCTCCCCCC | |||| |||||||||| |||| |||||||| |||| | 86 TGACGTCAGAGCTTGAGGACCCGAGTTTACTAGGAGGACAGAGTCGAA 133 283 283 133 Motif match forward No: hit count: 24 length: 36 30 agagacaaggtcctctgtgttgctcaggctggaGAG 65 ||| | ||| |||| |||||| ||||||| 211 TCTGTCTTCAGAGAGATACAACGGATCCGACCAGAA 246 211 AGACAGAAGTCTCtctatgttgcctaggctggtctt ||| | ||| |||| |||||| ||||||| 30 TCTCTGTTCCAggagacacaacgagtccgacctctc 246 65 Motif match forward No: hit count: 23 length: 35 402 CTgccccttcctccacctctctaaaactcaggctg 436 | |||| | || | |||||||| ||| | || 675 GCAGGGGtaagaaggggagagatgttgggagagag 709 675 cgtccccattcttcccctctctacaaccctctctC | |||| | || | |||||||| ||| | || 402 GACGGGGAAGGAGGTGGAGAGATTTTgagtccgac 709 436 Motif match forward No: hit count: 19 length: 29 396 CACAGGCTgccccttcctccacctctcta 424 | || || ||||| || || | |||| 679 GGGtaagaaggggagagatgttgggagag 707 679 cccattcttcccctctctacaaccctctc | || || ||||| || || | |||| 396 GTGTCCGACGGGGAAGGAGGTGGAGAGAT 707 424 Motif match reverse No: hit count: 18 length: 29 419 tctctaaaactcaggctgagctatgtaca 447 | | | | ||||| ||||| | | | | 447 acatgtatcgagtcggactcaaaatctct 419 419 tctctaaaactcaggctgagctatgtaca | | | | ||||| ||||| | | | | 447 acatgtatcgagtcggactcaaaatctct 447 419 Motif match reverse No: hit count: 18 length: 28 507 ccacgggtgcccacctgggaacaggagg 534 || | || |||| |||| || | || 534 ggaggacaagggtccacccgtgggcacc 507 507 ccacgggtgcccacctgggaacaggagg || | || |||| |||| || | || 534 ggaggacaagggtccacccgtgggcacc 534 507 Motif match reverse No: hit count: 16 length: 26 377 CTGTCCCCCATGCTCCAGGCACAGGC 402 | || | |||||| || ||| | 89 GTCAACCGATACGAGTTCGGTGACGA 64 64 AGCAGTGGCTTGAGCATAGCCAACTG | ||| || |||||| | || | 402 CGGACACGGACCTCGTACCCCCTGTC 89 377 Motif match reverse No: hit count: 16 length: 24 205 TTATAGAGACAGAAGTCTCtctat 228 || |||||| |||||| || 228 tatctCTCTGAAGACAGAGATATT 205 Page 130 National University of Singapore Department of Electrical and Computer Engineering 205 TTATAGAGACAGAAGTCTCtctat 228 || |||||| |||||| || 228 tatctCTCTGAAGACAGAGATATT 205 Motif match reverse No: hit count: 16 length: 27 63 GAGCAGTGGCTTGAGCATAGCCAACTG 89 | ||| || |||||| | || | 403 TCGGACACGGACCTCGTACCCCCTGTC 377 377 CTGTCCCCCATGCTCCAGGCACAGGCT | || | |||||| || ||| | 89 GTCAACCGATACGAGTTCGGTGACGAG 403 63 Motif match reverse No: 10 hit count: 16 length: 24 479 CTAGTAACCGCTAGGGCTTacccg 502 | |||| | |||| | |||| | 502 gcccaTTCGGGATCGCCAATGATC 479 479 CTAGTAACCGCTAGGGCTTacccg | |||| | |||| | |||| | 502 gcccaTTCGGGATCGCCAATGATC 502 479 Motif match forward No: 11 hit count: 15 length: 22 40 tcctctgtgttgctcaggctgg 61 ||||| | ||||||||| 416 TGGAGAGATTTTgagtccgact 437 416 acctctctaaaactcaggctga ||||| | ||||||||| 40 Aggagacacaacgagtccgacc 437 61 Motif match forward No: 12 hit count: 15 length: 24 242 gtcttgaactcctggcctcaggcg 265 || | || |||||||| | | 721 aagtagttctagacCGGAGCCGCC 744 721 TTCATCAAGATCTGGCCTCGGCGG || | || |||||||| | | 242 CAGAACTTgaggaccggagtccgc 744 265 Motif match forward No: 13 hit count: 15 length: 27 463 CTCATCCAGTCCCCTGCTAGTAACCGC 489 || ||||||||||| | | 612 agaggggacaggggacgatacccgtcc 638 612 tctcccCTGTCCCCTGCTATGGGCAGG || ||||||||||| | | 463 gagtaggtcaggGGACGATCATTGGCG 638 489 Motif match reverse No: 14 hit count: 15 length: 24 589 cacagcaggaaggcagtatccgct 612 | |||| | ||| ||| || | 174 GACCCGTCGTACCGAcatcggaca 151 151 acaggctacAGCCATGCTGCCCAG | || ||| ||| | |||| | 612 tcgcctatgacggaaggacgacac 174 589 Motif match reverse No: 15 hit count: 15 length: 24 151 acaggctacAGCCATGCTGCCCAG 174 | || ||| ||| | |||| | 612 tcgcctatgacggaaggacgacac 589 589 cacagcaggaaggcagtatccgct | |||| | ||| ||| || | 174 GACCCGTCGTACCGAcatcggaca 612 151 Page 131 National University of Singapore Department of Electrical and Computer Engineering Table A3.5: Partial list of potential mishybridizations for PKB2 gene synthesis predicted by TmPrime gene synthesis software (http://prime.ibn.a-star.edu.sg). Motif match reverse No: hit count: 44 length: 66 1123 cccgaggccaagtccctgcttgctGGGCTGCTTAAGAAGGACCCCAAGCAGAGGCTTGGTGGGGGG ||| ||||| | ||||||| | || |||||| || | ||||||| | ||||| ||| 1188 GGGGGGTGGTTCGGAGACGAACCCCAGGAAGAATTCGTCGGGtcgttcgtccctgaaccggagccc 1188 1123 1123 cccgaggccaagtccctgcttgctGGGCTGCTTAAGAAGGACCCCAAGCAGAGGCTTGGTGGGGGG 1188 ||| ||||| | ||||||| | || |||||| || | ||||||| | ||||| ||| 1188 GGGGGGTGGTTCGGAGACGAACCCCAGGAAGAATTCGTCGGGtcgttcgtccctgaaccggagccc 1123 Motif match reverse No: hit count: 24 length: 37 941 cggagtacctggcgcctgaggtgctggaggacaatga 977 ||| | | || ||||| || ||||||||| | 638 CACTCCTTGCCCACGGACCACAAGACCTcctgggccg 602 602 gccgggtccTCCAGAACACCAGGCACCCGTTCCTCAC | ||||||||| || ||||| || | | ||| 638 977 agtaacaggaggtcgtggagtccgcggtccatgaggc 941 Motif match reverse No: hit count: 24 length: 37 601 agccgggtccTCCAGAACACCAGGCACCCGTTCCTCA 637 | ||||||||| || ||||| || | | ||| 978 cagtaacaggaggtcgtggagtccgcggtccatgagg 942 942 ggagtacctggcgcctgaggtgctggaggacaatgac ||| | | || ||||| || ||||||||| | 637 ACTCCTTGCCCACGGACCACAAGACCTcctgggccga 978 601 Motif match reverse No: hit count: 22 length: 34 251 TCGAGAGGACCTTCCACGTGGATTCTCCAGACGA 284 ||| ||| |||||||||| ||| ||| 284 AGCAGACCTCTTAGGTGCACCTTCCAGGAGAGCT 251 251 TCGAGAGGACCTTCCACGTGGATTCTCCAGACGA ||| ||| |||||||||| ||| ||| 284 AGCAGACCTCTTAGGTGCACCTTCCAGGAGAGCT 284 251 Motif match reverse No: hit count: 22 length: 33 553 AAGGAAGTCATCAttgccaaggatgaagtcgct 585 | || ||||| ||| ||| ||||| || | 585 tcgctgaagtaggaaccgttACTACTGAAGGAA 553 553 AAGGAAGTCATCAttgccaaggatgaagtcgct | || ||||| ||| ||| ||||| || | 585 tcgctgaagtaggaaccgttACTACTGAAGGAA 585 553 Motif match forward No: hit count: 19 length: 29 546 CCTGCGAAAGGAAGTCATCAttgccaagg 574 ||| | || || | ||||| || | || 885 ggagacgtttctcccgtagtcactgcccC 913 885 cctctGCAAAGAGGGCATCAGTGACGGGG ||| | || || | ||||| || | || 546 GGACGCTTTCCTTCAGTAGTAACGGTTCC 913 574 Motif match forward No: hit count: 18 length: 28 tgaatgaggtgtctgtcatcaaagaagg 29 || || ||| | |||| ||| | | | 404 tctaccttcaccgccagtcgttccgtgc 431 404 agatggaagtggcgGTCAGCAAGGCACG || || ||| | |||| ||| | | | ACTTACTCCACAGACAGTAGTTTCTTCC 431 29 Motif match forward No: hit count: 18 length: 30 652 GCCttccagacccacgaccgcctgtgcttt 681 | |||| |||||| ||||| | | 1051 atgttggtcctggtgctcgcggagaagctc 1080 1051 tacaaccaggacCACGAGCGCCTCTTCGAG | |||| |||||| ||||| | | 652 CGGAAGGTCTGGGTGCTGGCGGAcacgaaa 1080 681 Page 132 National University of Singapore Department of Electrical and Computer Engineering Motif match reverse No: hit count: 18 length: 28 297 gatgcgggccatccagatggtcgccaac 324 | || | ||||| ||||| | || | 324 caaccgctggtagacctaccgggcgtag 297 297 gatgcgggccatccagatggtcgccaac | || | ||||| ||||| | || | 324 caaccgctggtagacctaccgggcgtag 324 297 Motif match reverse No: 10 hit count: 18 length: 26 471 CCttggcaagggaacctttggcaaag 496 | ||| ||| || || ||| ||| | 496 gaaacggtttccaagggaacggttCC 471 471 CCttggcaagggaacctttggcaaag | ||| ||| || || ||| ||| | 496 gaaacggtttccaagggaacggttCC 496 471 Motif match reverse No: 11 hit count: 18 length: 28 837 aaacctcatgctggacaaagatggccac 864 || |||| || | ||| |||| | | 583 gctgaagtaggaaccgttACTACTGAAG 556 556 GAAGTCATCAttgccaaggatgaagtcg | | |||| ||| | || |||| || 864 caccggtagaaacaggtcgtactccaaa 583 837 Motif match reverse No: 12 hit count: 18 length: 27 556 GAAGTCATCAttgccaaggatgaagtc 582 | | |||| ||| | || |||| || 864 caccggtagaaacaggtcgtactccaa 838 838 aacctcatgctggacaaagatggccac || |||| || | ||| |||| | | 582 ctgaagtaggaaccgttACTACTGAAG 864 556 Motif match forward No: 13 hit count: 17 length: 27 52 TACATCAAGACCTGGAGGCCACGGTAC 78 || |||||| |||||| || | 184 GACTACTTCTGGCTCTCCGGCGCTGGG 210 184 CTGATGAAGACCGAGAggccgcgaccc || |||||| |||||| || | 52 atgtagttctggacctccggtgccATG 210 78 Motif match forward No: 14 hit count: 17 length: 28 238 tggaCCACAGTCATCGAGAGGACCTTCC 265 |||||||| |||||| ||| 583 CGAGTGTGtcagtggctctcggcccagg 610 583 gctcacacagtcaccgagagccgggtcc |||||||| |||||| ||| 238 acctggtgtcagtagctctcctggaagg 610 265 Motif match forward No: 15 hit count: 17 length: 26 345 AGGCGAGGACCCCATGGACTACAAGT 370 | | |||| |||||| ||| || 1197 ACGGTTCCTCCAgtacctcgtgtcca 1222 1197 tgccaaggaggtcatggagcacaggt | | |||| |||||| ||| || 345 tccgCTCCTGGGGTACCTGATGTTCA 1222 370 Motif match forward No: 16 hit count: 17 length: 27 501 cctggtgcgggagaaggcCACTGGCCG 527 | | ||| |||| | |||| || | 678 gaaacactacctcatacggttgccccc 704 678 ctttgtgatggagtatgccaacgGGGG | | ||| |||| | |||| || | 501 ggaccacgccctcttccggtgaccggc 704 527 Motif match forward No: 17 hit count: 17 length: 28 513 gaaggcCACTGGCCGCTACTACGCCATG 540 | || ||| |||||| || | || 1350 gtgtggggGACTGGCGATACTGTCGGAC 1377 Page 133 National University of Singapore Department of Electrical and Computer Engineering 1350 CACACCCCCTGACCGCTATGACAGCCTG | || ||| |||||| || | || 513 cttccggtgaccggcgatgatgcggtAC 1377 540 Motif match forward No: 18 hit count: 17 length: 29 660 gacccacgaccgcctgtgctttgtgatgg 688 | | ||| ||||| |||| || | 1362 GGCGATACTGTCGGACCCGAATGACCTCG 1390 1362 CCGCTATGACAGCCTGGGcttactggagc | | ||| ||||| |||| || | 660 CTGGGTGCTGGCGGAcacgaaacactacc 1390 688 Motif match forward No: 19 hit count: 17 length: 28 794 ACTTGCACTCGCGGGACGTGGTATACCG 821 | | ||| || ||||||||| | 1232 cgtagttgaccgtcctgcaccaggTCTT 1259 1232 gcATCAACTGGCAGGACGTGGTCCAGAA | | ||| || ||||||||| | 794 tgaacgtgagcgccctgCACCATATGGC 1259 821 Motif match forward No: 20 hit count: 17 length: 27 828 CAAGCTGGaaaacctcatgctggacaa 854 | | | |||||||| || |||| 914 GGTGGTACTTTTGGAAGACACCCTGGG 940 914 CCACCATGAAAACCTTCTGTGGGaccc | | | |||||||| || |||| 828 GTTCGACCTTTTGGAGTACGACCTGTT 940 854 Motif match reverse No: 21 hit count: 17 length: 28 1223 tcttcctcagcATCAACTGGCAGGACGT 1250 ||| || ||||| |||||| | 199 AGAGCCAGAAGTAGTCGACCGTAAGACG 172 172 GCAGAATGCCAGCTGATGAAGACCGAGA | |||||| ||||| || ||| 1250 TGCAGGACGGTCAACTAcgactccttct 199 1223 Motif match reverse No: 22 hit count: 17 length: 28 172 GCAGAATGCCAGCTGATGAAGACCGAGA 199 | |||||| ||||| || ||| 1250 TGCAGGACGGTCAACTAcgactccttct 1223 1223 tcttcctcagcATCAACTGGCAGGACGT ||| || ||||| |||||| | 199 AGAGCCAGAAGTAGTCGACCGTAAGACG 1250 172 Motif match forward No: 23 hit count: 16 length: 26 aggtgtctgtcatcaaagaaggctgg 33 || | |||| ||| ||| | || 728 CCCTCGCACAGAAGTGTCTCCTCGCC 753 728 GGGAGCGTGTCTTCACAgaggagcgg || | |||| ||| ||| | || TCCACAGACAGTAGTTTCTTCCGacc 753 33 Page 134 National University of Singapore Department of Electrical and Computer Engineering Appendix IV Derivation of minimum cycle number for full-length assembly The overlapping PCR assembly is a parallel process. The lengths of overlapping oligonucleotides are extended after each PCR cycle. Careful examination of Figure S1 reveals that the theoretical minimum number of cycles (x) in order to construct a full-length double-stranded DNA (dsDNA) molecule from a pool of n oligonucleotides can be calculated by: x ≥ log2 (n) Theoretically, and PCR cycles are sufficient for assembling S100A4 (752 bp) from a pool of 32 oligonucleotides, and PKB2 (1446 bp) from a pool of 62 oligonucleotides, respectively. Relatively few PCR cycles are needed to create a full-length dsDNA. Figure S1: Scheme of overlapping PCR gene synthesis Derivation of melting temperature and hybridization possibility The hybridization of two single strands of DNA is a chemical reaction that can be described using basic terms of chemistry. For short oligonucleotides, the process of DNA hybridization can be described by a two-state reaction: S1 + S2 ↔ D, [1] where S1 and S2 represent the two single-stranded DNA, and D is a hybridized double-stranded DNA. The equilibrium constant, K, for this reaction is given by: K = [D] / [S1] [S2] [2] If η is the fraction of molecule S2 forming the duplex, the concentrations of all species can be expressed as: Page 135 National University of Singapore Department of Electrical and Computer Engineering [D] = η [S2]o [S2] = [S2]o – [D] = [S2 ]o (1- η) [S1] = [S2]o – [D] = [S1]o – η [S2]o Therefore, K= η ([S1 ]o − η[ S ]o )(1 − η ) [3] For PCR amplification with excess out primers ([S1]o >> [S2]o), the equilibrium constant can be simplified as: K= η , CT (1 − η ) [4] where CT is the concentration of outer primer (S1). For PCR gene assembly from equal concentration of inner oligonucleotides ([S1]o = [S2]o, Eq. is given by: K= 2η , CT (1 − η ) [5] where CT = [S1]o + [S2]o is the total molar strand concentration. The annealing probability (η) can be calculated from the equilibrium constant (K) as expressed in term of Gibb’s free energy change (∆G) of this annealing reaction: K = exp(-∆G/RT) [6] ∆G = ∆H -T ∆S, [7] where R is the gas constant, and ∆H and ∆S are the enthalpy and entropy changes of the annealing reaction, respectively. The melting temperature Tm (K) of this reaction, defined as η = 0.5, can be calculated from Eqs. 4–7. Tm = ∆H/(∆S + R × ln(CT/b)) [8] When both strands are distinct sequences with equal concentration as in the PCR assembly reaction, the value of b is and K is equal to 4/CT (see Eq. 5). In the case of normal PCR amplification, the value of b is and K is equal to 1/C T, as derived from Eq. 4. Page 136 National University of Singapore Department of Electrical and Computer Engineering ∆H, ∆S and ∆G of this reaction can be calculated with the following equations by using the nearest-neighbor model with SantaLucia’s thermodynamic parameter (1), corrected with salt concentrations. ∆G[Na+, Mg2+] = ∆G[1 M NaCl] – 0.114 × N/2 × ln[Na+, Mg2+], ∆S[Na+, Mg2+] = ∆S[1 M NaCl] + 0.368 × N/2 × ln[Na+, Mg2+], [Na+, Mg2+] = [Na+] + × [Mg2+]0.5 [9] [10] [11] where N is the total number of phosphates in the duplex, and [Na+, Mg2+] is the concentration of sodium, potassium and magnesium cations. The annealing possibility curves of oligonucleotide sets of S100A4-1 and S100A4-2 were calculated from Eqs. and using a Matlab program with SantaLucia’s thermodynamic parameter. Figure S4 shows the relationship of annealing possibility and temperature for S100A41 and S100A4-2 at oligonucleotide concentration of nM and 10 nM. The oligonucleotide sets were originally designed at oligonucleotide concentration of 10 nM. The average hybridization possibilities at 70°C (annealing temperature of PCR) were ~ 23.3% (S100A4-1) and 5.3% (S100A4-2) when oligonucleotide concentration was 10 nM, as estimated from Figure S2. These values were reduced to 5.8% (S100A401) and 0.6% (S100A4-2), respectively, when the oligonucleotide mixture was diluted to nM. As the assembly reaction progressed, the DNA fragments became longer after each PCR cycle. The length of overlap regions and the corresponding melting temperature would increase. The hybridization curves would shift towards higher temperature. This suggested that the hybridization efficiency of DNA mixtures at the PCR annealing temperature (70°C) might gradually improve as reaction progressed. The melting temperature and oligonucleotide concentration plots for S100A-1 and S100A4-2, calculated from Eq. 8, are shown in Figure S3. The melting temperature was approximately linearly proportional to the logarithmic oligonucleotide concentration. The melting temperatures at oligonucleotide concentration of nM and 10 nM are summarized in Table A4.1. Page 137 National University of Singapore Department of Electrical and Computer Engineering (a) (b) Figure S2: Calculated annealing possibility distribution of (a) S100A4-1 and (b) S100A4-2 at oligonucleotide concentration of nM (dash line) and 10 nM (solid line). Plotted for oligonucleotides with minimum Tm (black line), maximum Tm (gray line) and average Tm (blue line). Figure S3: The melting temperature versus oligonucleotide concentration plot for oligonucleotide sets of S100A4-1 (dash line) and S100A4-2 (solid line). Plotted for oligonucleotides with minimum Tm (black line), maximum Tm (gray line) and average Tm (blue line). Both oligonucleotide sets contains more than 30 different oligonucleotides. The slopes of the average Tm versus the logarithmic oligonucleotide concentration were ~ 1.21 and 1.28 for S100A4-1 and S100A4-2, respectively. Table A4.1: Summary of melting temperatures of S100A4-1, S100A4-2 and PKB2 oligonucleotide sets at oligonucleotide concentrations of 10 nM and nM. Gene [Oligos] Average T m Std. of Tm ∆T m Minimum Tm Maximum Tm (nM) (°C) (°C) (°C) (°C) (°C) S100A4-1 10 66.81 3.0 9.1 61.64 70.73 S100A4-2 PKB2 64.04 3.05 9.93 58.56 68.5 10 65.25 0.48 2.03 64.52 66.55 62.31 0.55 2.60 60.96 63.57 10 66.31 0.56 1.91 65.37 67.28 63.37 0.70 2.86 61.85 64.71 Page 138 National University of Singapore Department of Electrical and Computer Engineering For the case where R ∆S ⋅ ln( CT / b ) [...]... GFPuv gene segment with a total length of 760 bp (sequence 26 1-1 020 with T357C, T811A and C812G base substitutions) was selected for the synthesis experiment The gene segment was assembled using 37 of 40-mer and 2 of 20 -mer oligonucleotides with 20 bp overlap [86] (Appendix I Table S2) The PCR synthesis reactions were performed both within the microfluidic devices and in the standard 0 .2- ml PCR tubes with. .. (b) S100A4 -2 (7 52 bp), and (c) PKB2 (1446 bp) All PCRs are conducted with 30-s annealing at 70°C and 90-s extension at 72 C The concentrations of oligonucleotides and outer primers are 10 nM and 400 nM, respectively Figure 5.8: Agarose gel electrophoresis results of S100A4-1 (lanes 1 and 3) and S100A4 -2 (lanes 2 and 4) with oligonucleotide concentrations of 10 nM and 1 nM, and PKB2 (lane 5) with 1 nM... INTEGRATED TWO -STEP GENE SYNTHESIS ON CHIP The final goal of this project is to develop a miniaturized automatic gene synthesis system In Chapter III, IV and V, bioinformatics software, TopDown and Automatic TouchDown one- step gene synthesis methods are presented respectively The development of these methods is aimed to provide a most suitable gene synthesis protocol for the integrated gene synthesis In... optimized synthesis condition determined in previous experiments, and conducted the gene synthesis with dNTPs of 4 mM (4 mM Mg2+) and 0.8 mM (1.5 mM Mg2+) with Mg2+ ion (MgSO4) concentration adjusted to compensate the dNTPs–Mg2+ chelation, which would affect the polymerase activity (18,19) Successful gene syntheses were achieved in both of conventional one- step and ATD onestep gene synthesis for all three genes,... the first time that the successful gene synthesis has been achieved with an ultralow concentration of oligonucleotides of 1 nM (a) (b) (c) Figure 5.6: Agarose gel electrophoresis results of conventional 1 -step and ATD one- step (30cycle) gene syntheses with dNTPs concentrations of 4 mM and 0.8 mM for (a) S100A4-1 (7 52 bp), (b) S100A4 -2 (7 52 bp) and (c) PKB2 (1446 bp) All PCRs are conducted with 30-s... the relatively long gene, PKB2 (1446 bp), which could not be achieved by the conventional one- step gene synthesis [26 ] Surprisingly, the PKB2 has higher assembly efficiency than that of S100A4, even although the PKB2 is ~ 2 longer than S100A4 The fluorescent signal indicated the S100A4 and PKB2 syntheses reached the plateau at ~ 28 and ~ 22 cycles, respectively Indeed, the ATD onestep process has fairly... illustration of PCR- based gene synthesis One- step synthesis combines PCA and PCR amplification into a single stage The two -step synthesis is performed with separate stages for assembly and amplification 6 .2 Device fabrication and thermal cycling system construction 6 .2. 1 Microfluidic device fabrication The fabrication process flow of the microfluidic device is shown in Figures 6.2a and b Instead of... than two -step gene synthesis, TopDown and Automatic TouchDown one- step gene synthesis method are also suitable approaches for chip based DNA assembly The assembled sequence was identified by DNA sequencing Synthesized products from the microfluidic devices and PCR tubes were cloned directly without further purification using PCR 2. 1-TOPO® cloning vector (Invitrogen) Full-length target along with intermediary... electrophoresis comparing the synthesis results conducted within commercial thermal cycler (machine) and microfluidic device (a) One- step process (device: single-chamber chip) and (b) two -step process (device: two -step chip) conducted with an oligonucleotide concentration of 10 nM and a primer concentration of 0.4 µM Compared to the one- step process, the two -step process generated much more full-length... with a commercial thermal cycler (DNA Engine PTC -20 0, Bio-Rad) for comparison of the synthesis performance Synthesis via PCR was performed either as a one- step process, combining assembly PCR and amplification PCR into a single stage, or as a two -step process with separate stages for assembly and amplification The one- step process in PCR tube was conducted with 50 µl of reaction mixture Page 85 National . S100A4-1 7 52 66.8 9.1 3.0 30 19–33 19, 41–66 S100A4 -2 7 52 65 .2 2.03 0.48 32 18–39 18, 39–64 PKB2 1446 66 .2 1.9 0.59 62 16– 32 36–57 5 .2. 2 Automatic TouchDown one- step real- time gene synthesis Automatic. TopDown one- step PCR gene synthesis and develop a more universal method, a novel approach – automatic TouchDown one- step PCR is developed. 5.1.1 Principle of Automatic TouchDown one- step gene synthesis. (ATD) one- step process was optimized using real- time PCR conducted with Roche’s LightCycler 1.5 real- time thermal cycling machine with a temperature transition of 20 °C/s. Real- time gene synthesis