Nanog in the twin fish models medaka and zebrafish functional divergence or pleiotropy of vertebrate pluripotency gene

Nanog in the Twin Fish Models Medaka and Zebrafish: Functional Divergence or Pleiotropy of Vertebrate Pluripotency Gene Li Zhendong (M.Sc, Nankai University) A THESIS SUBMITTED FOR THE DEGREE OF DOCTOR OF PHILOSOPHY DEPARTMENT OF BIOLOGICAL SCIENCES NATIONAL UNIVERSITY OF SINGAPORE 2009 Acknowledgements I would like to express my deepest gratitude to my supervisor A/P Hong Yunhan for giving me the opportunity to carry out research under his guidance, for his great patience and encouragement, for imparting his invaluable knowledge and technical expertise to me during the last six years I would like to thank A/P Wang Shu, A/P Peng Jinrong and Dr Paul Robson, as my QE committee members, for their support and sharing the ideas Thanks go to A/P Ng Huck Hui for sharing mouse nanog construct I am also debt to Madam Deng Jiaorong and Mr Zeng Qinghua for medaka breeding; Mr Subhas Balan for zebrafish support; Ms Veronica Wong for the ordering matters I greatly thank my labmates: Chen Tiansheng, Xu Hongyan, Li Mingyou, Hong Ni, Tan Sze ley, Wang Li, Yovita Ida Purwanti, Yi Meisheng, Guan Guijun, Zhao Haobing, Lu Wenqing, Wang Weijia, Lim Meng Huat, Liu Rong, Liu Lixiu and Yan Yan for their kind help and the happy time they brought to the lab I also thank Liang Dong, Li Yan, Xiang Wei, Wang Xingang, Li Zhen, and Zhan Huiqin for their kind help in zebrafish I thank National University of Singapore and Department of Biological Sciences for providing me scholarship and opportunity to study here Finally, I would like to thank my parents for their support all these years i Table of contents Acknowledgements i Table of Contents -ii Summary -vi List of Figures and Tables -viii List of Abbreviations -x List of Publications -xii Chapter I: Introduction - 1.1 Embryogenesis and stem cells - 1.1.1 Embryonic stem cells - 1.1.2 Adult stem cells - 1.1.3 Germ stem cells Mechanisms modulating pluripotency in stem cells - 1.2.1 Intrinsic transcription factors 1.2.2 Signaling pathways in maintaining ES cell pluripotency: 10 1.2.2.1 LIF/Stat3 pathway -10 1.2.2.2 Transforming growth factor β (TGF-β) superfamily pathway 11 1.2.2.3 WNT-beta catenin pathyway -14 1.2.2.4 FGF pathway 16 1.3 The homeodomain transcription factor Nanog -20 1.3.1 General introduction -20 1.3.2 Expression pattern -20 1.3.3 Nanog target genes -22 1.3.4 Regulation of nanog 23 1.3.5 Cofactors of Nanog -26 1.3.6 iPS –induced pluripotent stem cells by defined factors -26 1.3.7 Domain structure of Nanog protein -28 1.4 Medaka as a vertebrate model -32 1.4.1 General introduction -32 1.4.2 Stem cell research in medaka 35 1.4.3 Medaka embryonic development 35 1.5 Zebrafish as a vertebrate model -36 1.5.1 Zebrafish as a popular vertebrate model 36 1.5.2 Early Stages of embryonic development of zebrafish -37 1.5.3 Molecular vertebrate axis formation in zebrafish -41 1.6 Objetives of this study -45 Chapter II: Materials and Methods -47 2.1 DNA manipulation 47 ii 2.1.1 Polymerase chain reaction (PCR) -47 2.1.2 Reverse-transcriptase PCR (RT-PCR) -47 2.1.3 Rapid amplification of cDNA ends (RACE) 48 2.1.4 Cloning of PCR products (T-A cloning) 49 2.1.5 DNA ligation -49 2.1.6 Preparation of competent cells -49 2.1.7 Transformation -50 2.1.8 Colony screening by restricion enzyme digestion 51 2.1.9 Automatic sequencing -51 2.1.10 Isolation of plasmid DNA 52 2.1.11 Isolation of genomic DNA -53 2.1.12 Purification of DNA fragments from agarose gel -54 2.1.13 Purification of DNA from enzyme reaction solution -54 2.1.14 Restriction endonuclease (RE) digestion of DNA 54 2.1.15 DNA gel electrophoresis -55 2.1.16 Quantification of DNA by spectrophotometry 55 2.1.17 Bioinformatic analysis -55 2.1.18 Vectors -56 2.2 RNA manipulation 56 2.2.1 Isolation of total RNA -56 2.2.2 Synthesis of 5’ capped mRNA 56 2.2.3 Quantification of RNA by spectrophotometry 57 2.2.4 In situ hybridization -57 2.2.4.1 Probe synthesis 57 2.2.4.2 Whole mount in situ hybridization (WISH) 58 2.2.4.3 Section in situ hybridization (SISH) 60 2.2.4.4 Fluorescent in situ hybridization 60 2.3 Protein manipulation -61 2.3.1 His-tagged fusion protein expression and purification -61 2.3.2 Antibody preparation 62 2.3.3 SDS-polyacrylamide gel electrophoresis (SDS-PAGE) -62 2.3.4 Western Blot -63 2.3.5 Immunohistochemical staining 64 2.4 Culture of medaka ES cells -64 2.4.1 Preparation of medaka embryo extract 64 2.4.2 Preparation of fish serum -65 2.4.3 Preparation of tissue culture plate -65 2.4.4 Preparation of ES cell medium ESM4 -65 2.4.5 Subculture of ES cells 66 2.4.6 Counting Cells -66 2.4.7 Freezing of ES cells -66 2.4.8 Thawing of ES cells 66 2.4.9 Cell Transfection with GeneJuice -67 Microinjection into cytoplasm of medaka embryos -67 iii Chapter III: Characterization, expression and function of medaka nanog -69 3.1 Results -69 3.1.1 Isolation of a nanog homolog from medaka -69 3.1.2 Gene structure of Ong -70 3.1.3 Phylogenetic analysis 77 3.1.4 Synteny analysis of Ong -77 3.1.5 Expression analysis -79 3.1.5.1 Spatial and temporal expression analysis by RT-PCR -79 3.1.5.2 Expression analysis in ovary by ISH -81 3.1.5.3 Expression analysis in testis by ISH 81 3.1.5.4 Expression in early embryonic stages 84 3.1.5.5 Protein expression analysis by western blot 87 3.1.5.7 Ong protein localization in ovary -90 3.1.5.8 Ong protein expression in germ cells of fry fish -90 3.1.6 Functional analysis -93 3.1.6.1 Function analysis by overexpression in ES cells 93 3.1.6.2 ES cell identity is associated with Ong expression -94 3.1.6.3 Dominant Negative Mutant analysis -98 3.1.6.3 Functional analysis by Morpholino oligonucleotides (MO) knockdown - 102 3.1.7 Ong is required for cell fate decision - 111 3.2 Discussion - 114 3.2.1 Ong is specifically expressed in pluripotent cells - 114 3.2.2 Ong is maternally supplied - 115 3.2.3 Expression in spermatogonia 116 3.2.4 Expression in early cleavage stage 117 3.2.5 Expression in primordial germ cells (PGCs) - 118 3.2.6 Western blot analysis 118 3.2.7 Function analysis by DNM analysis 119 3.2.8 Ong function in medaka ES cells 120 Chapter IV: Expression and function of zebrafish nanog - 122 4.1 Results - 122 4.1.1 Isolation of zebrafish nanog (Zng) 122 4.1.2 Expression analysis of Zng 122 4.1.2.1 Expression of Zng by RT-PCR - 122 4.1.2.2 Expression of Zng in adult tissues by ISH. 122 4.1.2.3 Spatial expression of Zng in early embryos by WISH 123 4.1.3 Functional analysis by MO knockdown - 129 4.1.4 Rescue of MO knockdown phenotypes by Ong and mouse nanog - 133 4.1.5 Mechanisms of DV and neuroectoderm patterning defects 136 4.2 Discussion - 142 4.2.1 Zng is expressed in adult brain, kidney and gonad - 142 4.2.2 Zng is maternally expressed in all blastomeres - 142 4.2.3 Zng is weakly expressed in somitogensis stage - 142 4.2.4 Maternal Zng is required for neuroectoderm specification 143 iv 4.2.5 Zng is required for tail formation - 143 Chapter V: General Discussion - 145 5.1 Why choosing fish nanog 145 5.2 Existence of fish nanog - 146 5.3 Ong and Zng are homologues of mammalian nanog 147 5.4 Divergence of nanog among vertebrates - 147 5.5 Nanog regulates pluripotency or DV patterning - 148 5.6 Models of Nanog function in fish 148 Chapter VI: Conclusion and perspective - 151 Conclusion - 151 Perspective - 152 Reference 153 Appendix 175 v Summary Pluripotency maintenance and embryo patterning are key events of early embryogenesis Transcription factors Nanog, Oct4 and Sox2 constitute a core circuit for regulating pluripotency in mouse embryonic stem (ES) cells and early developing embryos However, zebrafish Pou2, homolog of mammalian Oct4, is a maternal determinant for dorsoventral patterning Nanog shows extensive sequence divergence, producing an as low as 26% identity between mammals and chicken Whether nanog exists and plays a conserved role in pluripotency or patterning in lower vertebrates, in particular in fish, the ancient vertebrate lineage, has been unclear This work was aimed at the identification, expression and function of nanog in the medaka and zebrafish as excellent models for analyzing pluripotency and patterning The medaka and zebrafish nanog termed Ong and Zng respectively, encode proteins of 420 amino acids (aa, Ong) and 384 aa (Zng), which exhibit a best but 16-18% low sequence identity to tetrapod Nanog and lacks chromosomal synteny to tetrapod vertebrates It has, however, the conserved 4-exon structure and a unique motif The homology between fish and mouse nanog genes was established by the experiments where the mouse nanog can produce gain-of-function phenotype and rescue the loss-of-function phenotype in both fish species In vivo, Ong is expressed throughout the pluripotency cycle, including the zygote and germline In vitro, Ong RNA and protein are high in ES cells and down-regulated upon differentiation Importantly, forced Ong expression supported ES cell proliferation under differentiation conditions Upon zygotic RNA injection, Ong overexpression affected blastomeres proliferation, whereas Ong interference by dominant-negative mutants or morpholino-based knockdown compromised cell divisions and lineage commitment, leading to gastrula arrest as well as to the loss of yolk vein and tail defects Strikingly, despite extensive sequence divergence and chromosome rearrangements, medaka nanog possesses the conserved role in pluripotency maintenance at early stages and previously unidentified roles in late stages Zng exhibits a similar expression pattern to Ong with a salient difference: in contrast vi to restricted Ong expression in the central blastomeres, Zng distributes in all blastomeres Zng knockdown led to strongly dorsalized embryos and other profound defects including eyeless phenotype, loss of yolk vein and tail defects Zng knockdown led to severe reduction in the early zygotic expression of ventralizing genes (vox, ved and vent), dorsoventral patterning gene pou2 and neuroectodermal genes (pax2.1 and pax6.1) and to the expanded expression of the mesendodermal gene ntl (no tail) Therefore, similar to zebrafish Pou2, Zng becomes another determinant for dorsoventral patterning in early embryogenesis In conclusion, nanog plays an essential role in pluripotency maintenance in medaka but in dorsoventral patternining in zebrafish This striking finding provides direct evidence for functional conservation and divergence or pleiotropism of a patterning or pluripotency gene vii List of Figures and Tables Fig 1-1 Fig 1-2 Fig 1-3 Schematic diagram showing embryonic cell lineage and derivation of stem cells Models of core transcription networks containing Oct4, Sox2 and Nanog Nanog mRNA is confined to pluripotent/multipotent cells 19 Table 1-1 Summary of nanog expression pattern Fig 1-4 Fig 1-5 Fig 1-6 Fig 1-7 Fig 1-8 Fig 1-9 Fig 3-1 Fig 3-2 Fig 3-3 Fig 3-4 Fig 3-5 Fig 3-6 Fig 3-7 Fig 3-8 Fig 3-9 Fig 3-10 Fig 3-11 Fig 3-12 Fig 3-13 Fig 3-14 Regulation of Nanog by other transcription factors Alignment analysis of homeodomains from various homeoproteins Nanog domain structure The phylogeny of vertebrates Zebrafish fate maps Fig 3-15 Fig 3-16 Fig 3-17 Fig 3-18 Fig 3-19 Fig 3-20 Fig 3-21 Fig 3-22 Table 3-1 Fig 3-23 Fig 3-24 Fig 3-25 20 25 30 31 34 40 44 Transcriptional interactions patterning the dorsal-ventral axis PCR cloning of the Ong cDNA 71 Ong cDNA sequence with deduced anmino acid sequence 72 Alignment of homeodomains of Nanog with related Nkx and Vent family 73 Genomic organizations of nanog, vent and nkx2.5 74 Protein domain structure of Nanog 75 Phylogenetic tree of Nanog 76 Chromosomal location and synteny analysis of Ong 78 RT-PCR analysis of Ong 80 Ong mRNA expression in oocytes and oogonia of adult ovary 82 Ong RNA expression in adult testis 83 Ong RNA expression during early embryogenesis until gastrulation 85 Ong RNA expression in primordial germ cells 86 Ong protein presents in gonads and ES cells 88 Nanog protein expression and nuclear localization in medaka ES cells and 89 embryos Ong protein localization in oocytes 91 Ong protein is localized to vasa positive germ cells from male fry 92 Ong protein colocalizes with vasa in female germ cells 92 Ong expression is sufficient to prevent ES cell differentiation 95 Ong expression is sufficient for clonal expansion of ES cells in the 96 absence of growth factor bFGF ES cell differentiation is associated with loss of Ong expression 97 DNM analysis of Ong in early development by injection of OngDN2 100 DNM analysis of Ong in early development by injection of OngDN3 101 Dose-dependent phenotypes by OngMO knockdown 104 Examination of OngMO1 specificity 105 Classification of phenotypes caused by OngMO1 knockdown 107 Phenotype class IV caused by OngMO 108 viii Fig 3-26 Fig 3-27 Fig 3-28 Fig 4-1 Fig 4-2 Fig 4-3 Fig 4-4 Fig 4-5 Table 4-1 Fig 4-6 Fig 4-7 Table 4-2 Fig 4-8 Fig 4-9 Fig 4-10 Fig 4-11 Fig 4-12 Fig 4-13 Fig 5-1 Fig 5-2 Rescue of OngMO phenotype by mouse nanog mRNA Ong knockdown affects blastula cell fate Ong knockdown led to down-regulation of pou2 and up-regulation of ntl Zng cDNA sequence with deduced anmino acid sequence Spatial and temporal expression of Zng Zng RNA expression in adult tissues Zng mRNA is maternally supplied Zng RNA expression in early embryonic stages from MBT to 24 hpf Dose-dependent phenotypes caused by MO1 knockdown Phenotypes caused by Zng MO knockdown Zng knockdown leads to gastrulation defects 110 113 113 124 125 126 127 128 130 131 132 133 Phenotypic rescue by medaka and mouse nanog Eyeless phenotype can be rescued by Ong mRNA injection 134 Eyeless phenotype can be rescued by mouse nanog mRNA injection 135 Expression of vox, vent and ved by Zng MO1 knockdown 138 Expression of pou2 (oct4) and gsc by Zng MO1 knockdown 139 Mesodermal markers ntl and brachyury were misexpressed in Zng 140 morphants at 80% epiboly Expression of pax6.1 and pax2.1 in eye field was lost in morphants 141 Nanog regulates different set of genes to control pluripotency or 149 patterning Regulation of ventral zygotic genes by maternal factors and zygotic 150 wnt8/bmp2b ix Torres, J., Watt, F M., 2008 Nanog maintains pluripotency of mouse embryonic stem cells by inhibiting NFkappaB and cooperating with Stat3 Nat Cell Biol 10, 194-201 Vallier, L., Alexander, M., Pedersen, R A., 2005 Activin/Nodal and FGF pathways cooperate to maintain pluripotency of human embryonic stem cells J Cell Sci 118, 4495-509 Vallier, L., Mendjan, S., Brown, S., Chng, Z., Teo, A., Smithers, L E., Trotter, M W., Cho, C H., Martinez, A., Rugg-Gunn, P., Brons, G., Pedersen, R A., 2009 Activin/Nodal signalling maintains pluripotency by controlling Nanog expression Development Volodina, N., Denegre, J M., Mowry, K L., 2003 Apparent mitochondrial asymmetry in Xenopus eggs Dev Dyn 226, 654-62 Wakamatsu, Y., Ozato, K., Sasado, T., 1994 Establishment of a pluripotent cell line derived from a medaka (Oryzias latipes) blastula embryo Mol Mar Biol Biotechnol 3, 185-91 Wang, H., Dey, S K., 2006 Roadmap to embryo implantation: clues from mouse models Nat Rev Genet 7, 185-99 Wang, J., Levasseur, D N., Orkin, S H., 2008a Requirement of Nanog dimerization for stem cell self-renewal and pluripotency Proc Natl Acad Sci U S A Wang, J., Rao, S., Chu, J., Shen, X., Levasseur, D N., Theunissen, T W., Orkin, S H., 2006 A protein interaction network for pluripotency of embryonic stem cells Nature 444, 364-8 Wang, S H., Tsai, M S., Chiang, M F., Li, H., 2003 A novel NK-type homeobox gene, ENK (early embryo specific NK), preferentially expressed in embryonic stem cells Gene Expr Patterns 3, 99-103 Wang, Z., Ma, T., Chi, X., Pei, D., 2008b Aromatic residues in the C-terminal domain are required for Nanog to mediate LIF-independent self-renewal of mouse embryonic stem cells J Biol Chem 283, 4480-9 Wang, Z X., Kueh, J L., Teh, C H., Rossbach, M., Lim, L., Li, P., Wong, K Y., Lufkin, T., Robson, P., Stanton, L W., 2007 Zfp206 is a transcription factor that controls pluripotency of embryonic stem cells Stem Cells 25, 2173-82 Wang, Z X., Teh, C H., Chan, C M., Chu, C., Rossbach, M., Kunarso, G., Allapitchay, T B., Wong, K Y., Stanton, L W., 2008c The transcription 171 factor Zfp281 controls embryonic stem cell pluripotency by direct activation and repression of target genes Stem Cells 26, 2791-9 Weidinger, G., Thorpe, C J., Wuennenberg-Stapleton, K., Ngai, J., Moon, R T., 2005 The Sp1-related transcription factors sp5 and sp5-like act downstream of Wnt/beta-catenin signaling in mesoderm and neuroectoderm patterning Curr Biol 15, 489-500 Wells, J M., Melton, D A., 2000 Early mouse endoderm is patterned by soluble factors from adjacent germ layers Development 127, 1563-72 Wernig, M., Meissner, A., Foreman, R., Brambrink, T., Ku, M., Hochedlinger, K., Bernstein, B E., Jaenisch, R., 2007 In vitro reprogramming of fibroblasts into a pluripotent ES-cell-like state Nature 448, 318-24 Williams, R L., Hilton, D J., Pease, S., Willson, T A., Stewart, C L., Gearing, D P., Wagner, E F., Metcalf, D., Nicola, N A., Gough, N M., 1988 Myeloid leukaemia inhibitory factor maintains the developmental potential of embryonic stem cells Nature 336, 684-7 Wilmut, I., Schnieke, A E., McWhir, J., Kind, A J., Campbell, K H., 1997 Viable offspring derived from fetal and adult mammalian cells Nature 385, 810-3 Wilson, S I., Edlund, T., 2001 Neural induction: toward a unifying mechanism Nat Neurosci Suppl, 1161-8 Wittbrodt, J., Shima, A., Schartl, M., 2002 Medaka a model organism from the far East Nat Rev Genet 3, 53-64 Wodarz, A., Nusse, R., 1998 Mechanisms of Wnt signaling in development Annu Rev Cell Dev Biol 14, 59-88 Wu, D Y., Yao, Z., 2006 Functional analysis of two Sp1/Sp3 binding sites in murine Nanog gene promoter Cell Res 16, 319-22 Wu, Q., Chen, X., Zhang, J., Loh, Y H., Low, T Y., Zhang, W., Zhang, W., Sze, S K., Lim, B., Ng, H H., 2006 Sall4 interacts with Nanog and co-occupies Nanog genomic sites in embryonic stem cells J Biol Chem 281, 24090-4 Xiao, L., Yuan, X., Sharkis, S J., 2006 Activin A maintains self-renewal and regulates fibroblast growth factor, Wnt, and bone morphogenic protein pathways in human embryonic stem cells Stem Cells 24, 1476-86 Xu, H., Li, Z., Li, M., Wang, L., Hong, Y., 2009 Boule is present in fish and bisexually expressed in adult and embryonic germ cells of medaka PLoS ONE 4, e6097 172 Xu, R H., Peck, R M., Li, D S., Feng, X., Ludwig, T., Thomson, J A., 2005 Basic FGF and suppression of BMP signaling sustain undifferentiated proliferation of human ES cells Nat Methods 2, 185-90 Xu, R H., Sampsell-Barron, T L., Gu, F., Root, S., Peck, R M., Pan, G., Yu, J., Antosiewicz-Bourget, J., Tian, S., Stewart, R., Thomson, J A., 2008 NANOG is a direct target of TGFbeta/activin-mediated SMAD signaling in human ESCs Cell Stem Cell 3, 196-206 Yamaguchi, S., Kimura, H., Tada, M., Nakatsuji, N., Tada, T., 2005 Nanog expression in mouse germ cell development Gene Expr Patterns 5, 639-46 Yamaguchi, T P., Harpal, K., Henkemeyer, M., Rossant, J., 1994 fgfr-1 is required for embryonic growth and mesodermal patterning during mouse gastrulation Genes Dev 8, 3032-44 Yan, Q J., Chen, X M., Zhang, Y M., Xie, Y., Shi, S Z., Fu, B., Hong, Q., Xu, G S., Zhang, X G., Zhu, H Y., Wu, D., Lu, Y., Zhang, Y H., 2005 NANOG changes in mouse kidneys with age Rejuvenation Res 8, 248-53 Yasuda, S Y., Tsuneyoshi, N., Sumi, T., Hasegawa, K., Tada, T., Nakatsuji, N., Suemori, H., 2006 NANOG maintains self-renewal of primate ES cells in the absence of a feeder layer Genes Cells 11, 1115-23 Yeom, Y I., Fuhrmann, G., Ovitt, C E., Brehm, A., Ohbo, K., Gross, M., Hubner, K., Scholer, H R., 1996 Germline regulatory element of Oct-4 specific for the totipotent cycle of embryonal cells Development 122, 881-94 Yi, F., Pereira, L., Merrill, B J., 2008 Tcf3 functions as a steady-state limiter of transcriptional programs of mouse embryonic stem cell self-renewal Stem Cells 26, 1951-60 Ying, Q L., Nichols, J., Chambers, I., Smith, A., 2003 BMP induction of Id proteins suppresses differentiation and sustains embryonic stem cell self-renewal in collaboration with STAT3 Cell 115, 281-92 Yu, J., Thomson, J A., 2008 Pluripotent stem cell lines Genes Dev 22, 1987-97 Yu, J., Vodyanik, M A., Smuga-Otto, K., Antosiewicz-Bourget, J., Frane, J L., Tian, S., Nie, J., Jonsdottir, G A., Ruotti, V., Stewart, R., Slukvin, II, Thomson, J A., 2007 Induced pluripotent stem cell lines derived from human somatic cells Science 318, 1917-20 Zhang, J., Tam, W L., Tong, G Q., Wu, Q., Chan, H Y., Soh, B S., Lou, Y., Yang, J., Ma, Y., Chai, L., Ng, H H., Lufkin, T., Robson, P., Lim, B., 2006 Sall4 173 modulates embryonic stem cell pluripotency and early embryonic development by the transcriptional regulation of Pou5f1 Nat Cell Biol 8, 1114-23 Zhang, L., Rayner, S., Katoku-Kikyo, N., Romanova, L., Kikyo, N., 2007 Successful co-immunoprecipitation of Oct4 and Nanog using cross-linking Biochem Biophys Res Commun 361, 611-4 Zhao, J., Cao, Y., Zhao, C., Postlethwait, J., Meng, A., 2003 An SP1-like transcription factor Spr2 acts downstream of Fgf signaling to mediate mesoderm induction EMBO J 22, 6078-88 174 Appendix Alignment of Nanog homologues Appendix Identity value is given to the end of each sequence 175 Appendix Primer List name sequence ongF CTCCACATGTCCCCCCTTATC ongR AGGATAGAATAGTCACATCAC ongb1 CGCGGATCCATGGCGGAGTGGAAAACTCAGGTC ongx1 ACCGCTCGAGTCATTGGACAGCATTGTGCAAAATG oeomesF ATGCAGTTGGAGAACATCCTTC oeomesR TAGGCAAAGGCAGAGTCTG ovoxF ATGGTCAAATACTTTTCAGTAGACTG ovoxR TCAGAAGAAATGTTGGTAGTGGA osox32F ATGCGTTTCAGCCACGACC osox32R TTATGACACTGAATTTGTTTCTTTGTTG ontlF: CTGCCTACCAGAACGAAGAGA ontlR: TTCGATCAGTAGAAGGCACGT oactinF CCACACATTTCTCGCTCACTC oactinR TTAAGTATGCTCAACCACTGG ooct4F: GTAGGTCACCTGACAGGATGATG ooct4R CTGATTGCACTCTGACAGCAAGT zngstart2 GAGCGCTTCAATCAGCATCC zngexon2R GTTAAGTTCCGTTCTCCACTGTC zngB1 TGTCGGATCCATGGCGGACTGGAAGATGC zngsal1 AAAGTCGACTCACAGCAAAGTTATTCCTTTAGTTGC zactin-F GTTTTCCCCTCCATTGTTG zactin-R GGTGTTGAAGGTCTCGAACA mNg B1 CGCGGATCCATGAGTGTGGGTCTTCCTGGTC mNgx1 ACCGCTCGAGTCATATTTCACCTGGTGGAGTCAC zoct4F ATGCTTCAGGATCCAAGTCTGA zoct4R TAATTTGGGACAGTCCAGGC zpax6.1F GAGGGAGAGTCCAATATTCGAC zpax6.1R GCATAGTTCCAACAGCCTTTGTA zbrachyuryF TGTCGGATCCTCTTGGATGATAG zBrachyuryR CTATAAGGATGGTGGTGCCAC zntlF ATGTCTGCCTCAAGTCCCGAC zntlR GAGAGTCGTCCCTGCAACTG zpax2.1F ATGGATATTCACTGCAAAGC zpax2.1R CTAGTGGCGGTCATAGGCAG zgscF ATGCCCGCTGGGATGTTTAG zgscR TCAGCTGTCAGAATCCACGTC use RT-PCR Size (bp) 591 expression, probe, 1263 RT-PCR 1586 RT-PCR 735 RT-PCR 918 RT-PCR 985 RT-PCR 317 RT-PCR 660 RT-PCR 609 expression, probe, 1155 RT-PCR 300 expression, probe, 915 probe 418 probe 418 probe 1298 probe 1046 probe 1176 probe 723 176 Appendix Primer List zvedF ATGAAGGGTCAGTTCTCCATC zvedR TCAGTGTGTGCTGTAATACTG zvoxF ATGGTGAAGAACTTTTCCGTG zvoxR TCAGTAGTAATGATGTCTGGG zventF ATGATACCCAGCAAGTTCTC zventR TTAGAAGTAGCAGCGTGTGAAC probe 837 probe 729 probe 513 o, medaka; z, zebrafish; m, mouse Underline indicates restriction enzyme site 177 Appendix Medaka stage map, from Takashi IWAMATSU (2004) 178 Appendix Zebrafish stage map 179 Appendix Zebrafish stage map 180 Appendix Plasmid map From http://www.imagenes-bio.de/info/vectors/pCS2plus_pic.shtml HindIII (29) SP6 promoter Bam HI (80) CMV Eco RI (139) mouseNanog Sal I (4005) f1 origin T7 pCS2mNanog 4991 bp Xho I (1004) SV40 polyA Not I (1243) 181 Appendix Plasmid map SP6 Bam HI (80) CMV Ong Eco RI (1211) pCS2ong Xho I (1349) 5336 bp poly A Not I (1588) CMV promoter Xho I (1) Eco 255I (647) Nanog Eco RI (1164) Fse1 pCVongCVpf 7794 bp CMV promoter Kana/neo pf2 Bam HI (3831) Not I (3850) 182 Appendix Plasmid map Bam HI (80) OngDN1 Xho I (893) pCS2ongDN1 4880 bp poly A Not I (1132) Bam HI (80) OngDN2 pCS2ongDN2 5177 bp Xho I (1190) poly A Not I (1429) 183 Bam HI (80) Nanog partial Eco RI (1211) pCS2ongDN3 5924 bp GFP Xho I (1937) poly A Not I (2176) CMV Apa LI (4776) Nco I (514) HindIII (749) DraI (4335) Apa BI (796) DraI (4316) Pst I (831) Ava I (894) Xma I (894) pCVpf2 Sma I (896) 5106 bp Sal I (953) DraI (3624) Sac II (1059) Apa LI (3530) Apa BI (1417) PF Bam HI (2178) Apa BI (3033) Apa LI (3033) Not I (2197) DraI (2401) ClaI (2435) Bam HI (2442) 8888 Appendix Plasmid map 185 ... at the identification, expression and function of nanog in the medaka and zebrafish as excellent models for analyzing pluripotency and patterning The medaka and zebrafish nanog termed Ong and. .. patternining in zebrafish This striking finding provides direct evidence for functional conservation and divergence or pleiotropism of a patterning or pluripotency gene vii List of Figures and Tables... zebrafish Pou2, Zng becomes another determinant for dorsoventral patterning in early embryogenesis In conclusion, nanog plays an essential role in pluripotency maintenance in medaka but in dorsoventral