P125, a COPII INTERACTING PROTEIN 2

25 Chapter Materials and Methods 2.1 Materials 2.1.1 Antibodies Table 2.1. List of primary antibodies used. No. Antigen Host Source Company/Reference Actin Mouse Santa Cruz Santa Cruz, CA, USA β-tubulin Mouse Sigma St. Louis, MO, USA c-myc (9E10) Mouse Santa Cruz Santa Cruz, CA, USA c-myc Rabbit Upstate Biotechnology Millipore, Billerica,MA, USA Flag (M2) Mouse Sigma St. Louis, MO, USA Flag Rabbit Sigma St. Louis, MO, USA GFP Mouse Clontech Mountain View, CA,USA GFP Rabbit Roche Diagnostics Mainheim, Germany Giantin Rabbit Abcam Cambridge, UK 10 GM130 (Golgi matrix protein of 130kDa) Mouse BD Biosciences San Jose, CA, USA 11 Golgin 97 Rabbit Generated In House Lu et al., 2003 12 HA (12CA5) Mouse Santa Cruz Santa Cruz, CA, USA 13 HA Rabbit Upstate Biotechnology Millipore, Billerica,MA, USA 14 Rab8 Mouse BD Biosciences San Jose, CA, USA 15 Sec13 Mouse Abnova Taipei, Taiwan 16 Sec13 Rabbit Generated In House Tang et al., 1997 17 Sec23a Rabbit Abcam Cambridge, UK 18 Sec31a Mouse BD Biosciences San Jose, CA, USA 19 Sec31a Rabbit Generated In House Tang et al., 2000 20 Syntaxin Rabbit Synaptic Systems Goettingen, Germany 21 VSVG Mouse Sigma St. Louis, MO, USA 22 VSVG Rabbit Bethyl Laboratories Montgomery, TX,USA 26 Commonly used primary antibodies are listed in Table 2.1. Secondary antibodies used are as follows: goat anti-mouse and goat anti-rabbit HRP (horseradish peroxidase) conjugated antibodies were obtained from Jackson ImmunoResearch Laboratories (West Grove, PA, USA); protein A-HRP used for western blotting detection was from BD Biosciences; protein A/G-HRP was from Pierce (Rockford, IL, USA); Alexa Fluor® 488 goat anti-rabbit IgG (H+L), Alexa Fluor® 488 goat antimouse IgG (H+L), Alexa Fluor® 555 goat anti-rabbit IgG (H+L), Alexa Fluor® 555 goat anti-mouse IgG (H+L), Alexa Fluor® 647 goat anti-rabbit IgG (H+L) and Alexa Fluor® 647 goat anti-mouse IgG (H+L) were obtained from Molecular Probes (Invitrogen, Carlsbad, CA, USA). 2.1.2 Cell lines 293, 293T, A431, H460 and HeLa cells were obtained from American Type Culture Collection (Manassas, VA, USA). HeLa GT-GFP was a gift from Dr. Jack Rohrer (Friedrich Miescher Institut, Basel, Switzerland). HeLa ManII-GFP was a gift from Dr. Frederick Bard (Institute of Molecular Cell Biology, Singapore). The amphotropic Phoenix packaging cells (ampho) was a gift from Dr. Garry Nolan (Stanford University, USA). 293, 293T, A431, ampho and H460 cells were grown in Dulbecco’s Modified Eagles Medium (DMEM) supplemented with 10% fetal bovine serum (FBS) (Hyclone, Logan, UT, USA). All HeLa cell lines were cultured in DMEM-low glucose (1000 mg/mL D-Glucose) supplemented with 10% FBS and mM L-glutamine (Sigma). HeLa GT-GFP was cultured in the presence of 0.4 mg/ml G418 (Invitrogen). Cells were cultured at 37oC with 5% CO2 and 95% humidity. 27 2.1.3 Other Materials The green fluorescent protein (GFP) fusion reporter gene that expressed vesicular stomatitis virus G tsO45 protein (VSVG-tsO45-GFP) was a kind gift from Dr. Jennifer Lippincott-Schwartz (NIH, Bethesda, MA, USA). The yellow fluorescent protein (YFP) fusion reporter gene that expressed vesicular stomatitis virus G tsO45 protein (VSVG-tsO45-YFP) was a kind gift from Dr. Alexander Mironov (CMNS, Chieti, Italy). KIAA clones were kindly provided by the Kazusa DNA Research Institute (Chiba, Japan). Expressed sequence tag (EST) clone(s) was obtained from the I.M.A.G.E. consortium via Invitrogen. Brefeldin A (BFA) was purchased from Epicentre Biotechnologies (Madison, WI, USA). Nocodazole was acquired from Calbiochem (San Diego, CA, USA). 2.2 Plasmid constructs The sequences for the oligonucleotides used in this study are listed in Table 2.2. All oligonucleotides were obtained from Proligo (Sigma). All restriction enzymes were from New England Biolabs (Beverly, MA, USA). All PCRs (polymerase chain reaction) were performed with either Expand High Fidelity PCR system or Expand Long Range PCR system (Roche Diagnostics), using PTC225 Thermal Cycler (MJ Research, Waltham, MA, USA). PCR products and digested DNA material were subjected to agarose gel electrophoresis, followed by purification using QIAGEN gelpurification Kit (QIAGEN, Hilden, Germany). Purified DNA fragments were ligated into appropriate vectors using Rapid DNA Ligation Kit (Roche Diagnostics). The ligated products were transformed into DH5α E.coli chemically competent cells (Invitrogen) unless otherwise stated. All vectors and constructs were purified using QIAGEN Plasmid Maxi Kit (QIAGEN). 28 2.2.1 Vectors The following vectors were obtained commercially: pGEX-4T1 was from GE Healthcare (Chalfont St Giles, UK), pET-41b(+) was from Novagen (Madison, WI, USA), pEGFP-N1 was from Clontech (Mountain View, CA, USA) and pCI-neo was from Promega (Madison, WI, USA). pDMycneo and pDHAneo vector, were modified from the pCIneo vector by inserting two Myc or two hemagluttinin (HA) epitope sequences inserted at the 5’ of the multiple cloning site respectively (Seet & Hong., 2001). pmCherry-N1 was obtained from Invitrogen. pFlag vector was modified from pXJ-41 vector (Xiao et.al., 1991), by replacing the entire multiple cloning site with a polylinker sequence containing two Flag epitopes followed by several enzyme restriction sites. The polylinker was cloned into the NotI and KpnI site of the original pXJ-41 vector. The schematic of the pFlag multiple cloning sites is shown in Figure 2.1 Figure 2.1. Multiple Cloning Site of the pFlag Vector 2.2.2 Expression constructs myc-p125AFL and HA-p125AFL – Oligonucleotides p125A-FL-F and p125A-FL-R (Table 2.2) were used to amplify the full length coding region of p125A, using I.M.A.G.E. Clone 6514739 as template. This I.M.A.G.E. Clone 6514739 contains the full length human p125A cDNA. The PCR fragment was gel-purified, digested with SalI and NotI, and then inserted into the corresponding sites in pDMycneo and pDHAneo respectively. 29 myc-p125ANT - Oligonucleotides p125A-FL-F and p125A-NT–R (Table 2.2) were used to amplify the N terminal 1-304 amino acids of p125A, using human p125A cDNA as the template. The PCR fragment was gel-purified, digested with SalI and NotI, and then inserted into the corresponding sites in pDMycneo. myc-p125ANT600 - Oligonucleotides p125A-FL-F and p125A-600-R (Table 2.2) were used to amplify the N terminal 1-600 amino acids of p125A, using human p125A cDNA as the template. The PCR fragment was gel-purified, digested with SalI and NotI, and then inserted into the corresponding sites in pDMycneo. myc-p125ANT650 - Oligonucleotides p125A-FL-F and p125A-650-R (Table 2.2) were used to amplify the N terminal 1-650 amino acids of p125A, using human p125A cDNA as the template. The PCR fragment was gel-purified, digested with SalI and NotI, and then inserted into the corresponding sites in pDMycneo. myc-p125A200-650 - Oligonucleotides p125A-200-F and p125A-650-R (Table 2.2) were used to amplify amino acids 200-650 of p125A, using human p125A cDNA as the template. The PCR fragment was gel-purified, digested with SalI and NotI, and then inserted into the corresponding sites in pDMycneo. myc-p125A260-600 - Oligonucleotides p125A-260-F and p125A-600-R (Table 2.2) were used to amplify amino acids 260-600 of p125A, using human p125A cDNA as the template. The PCR fragment was gel-purified, digested with SalI and NotI, and then inserted into the corresponding sites in pDMycneo. 30 myc-p125ACT - Oligonucleotides p125A-CT-F and p125A-FL-R (Table 2.2) were used to amplify the C terminal region (amino acids 305-1000) of p125A, using human p125A cDNA as the template. The PCR fragment was gel-purified, digested with SalI and NotI, and then inserted into the corresponding sites in pDMycneo. myc-p125ACT∆100 - Oligonucleotides p125A- CT100-F and p125A-FL-R (Table 2.2) were used to amplify amino acids 101-1000 of p125A, using human p125A cDNA as the template. The PCR fragment was gel-purified, digested with SalI and NotI, and then inserted into the corresponding sites in pDMycneo. myc-p125ACT∆200 - Oligonucleotides p125A- CT200-F and p125A-FL-R (Table 2.2) were used to amplify amino acids 201-1000 of p125A, using human p125A cDNA as the template. The PCR fragment was gel-purified, digested with SalI and NotI, and then inserted into the corresponding sites in pDMycneo. myc-p125BFL (KIAA0725) - Oligonucleotides p125B-FL-F and p125B-FL-R (Table 2.2) were used to amplify the coding region of p125B, using human p125B cDNA (KIAA0725) as the template. The PCR fragment was gel-purified and digested with XhoI, then blunt-ended using T4 polymerase. The PCR fragment was then subjected to a second restriction digest using XbaI. The fragment was then inserted into XbaI and SmaI (blunt) site in pDMycneo. Flag-Sec31AFL - Oligonucleotides Sec31a-FL-F and Sec31a-FL-R (Table 2.2) were used to amplify the coding region of Sec31a, using human Sec31a cDNA (KIAA0905) as the template. The PCR fragment was gel-purified, digested with BamHI and XhoI, and then inserted into the corresponding sites in pFlag. 31 Table 2.2. List of Primers Primer Sequence p125A-FL-F 5’-GGCGAGTCGACCGCCGAGAGAAAACCTAACGG-3’ p125A-FL-R 5’-CAGGTGCGGCCGCTTCAATGCTGGGGCTGTTCTGGAC-3’ p125A-NT–R 5’-CTCCGGCGGCCGCTTCAGGTTACAGCTTTTTTATATTCAGCCTC -3’ p125A-CT-F 5’-CCAGAGTCGACCGAGGCTGAATATAAAAAAGCTGTAACC-3’ p125A-600-R 5’-GACAGCGGCCGCTTCAATTCAAATCTTTTTGATTAGACAG-3’ p125A-650-R 5’-CAAGGCGGCCGCTTCACTGCTTCACAACTCCATTAGCAAC-3’ p125A-200-F 5’-CGGAGAGTCGACCCTGCAGCAGTGCCAAACACCAGGC-3’ p125A-260-F 5’-GTCCGAGTCGACCCTACTTCAAAACCAATATGAGCCTG-3’ p125A-CT100-F 5’-GTTGGAGTCGACCTTAACAACTGCAGCAACCTCAGTTG-3’ p125A-CT200-F 5’-CGGAGAGTCGACCCTGCAGCAGTGCCAAACACCAGGC-3’ p125B-FL-F 5’-GTACCTCTAGAGTCATCAGTGCAGTCACAACAGGAG-3’ p125B-FL-R 5’-CTCTCTTCACAGTTCTTGGTCGACCCTGC-3’ Sec31a-FL-F 5’-CTAGGGATCCAAGTTAAAGGAAGTAGATCGTACAGCC-3’ Sec31a-FL-R 5’-CATTCTCGAGGACACCCAGCTTATTGGCCTG-3’ Sec23a-FL-F 5’-CAACGGTCACGCGTGACAACCTATTTGGAATTCATTCAAC-3’ Sec23a-FL-R 5’-GAATCCCGCGGCCGCTCAAGCAGCACTGGACACAGCAAG-3’ GST-p125A-F 5’-GGTCCCATGGCCGTTCATTGGGATAGTTCTTTG-3’ GST-p125A-R 5’-GGTCCTCGAGTCACACAGAAGACACGCAAG-3’ Sec31a-GFP-F 5’-GTGCTCGAGGCCACCATGAAGTTAAAGGAAGTA-3’ Sec31a-GFP-R 5’-CGTCCGCGGGACACCCAGCTTATTGGC-3’ p125a-Cherry-F 5’-AAACTCGAGGCCACCATGGCCGAGAGAAAACCT-3’ p125a-Cherry-R 5’-TTTCCGCGGATGCTGGGGCTGTTCTGG-3’ The enzyme restriction sites are underlined. HA-Sec23AFL - Oligonucleotides Sec23a-FL-F and Sec23a-FL-R (Table 2.2) were used to amplify the coding region of Sec23a, using human Sec23a cDNA as the template. The PCR fragment was gel-purified, digested with MluI and NotI, and then inserted into the corresponding sites in pDHAneo. 32 GST-p125A - Oligonucleotides p125A-GST-F and p125A-GST-R (Table 2.2) were used to amplify the amino acids 500 to 758 of p125A, using human p125A cDNA as the template. The PCR fragment was gel-purified, digested with NcoI and XhoI and then inserted into the corresponding sites in pET-41b(+) for the expression of GST (Glutathione S-transferase)-p125A fusion protein. The ligated construct was transformed into competent BL21 DE3 Codon+ cells (Invitrogen) for protein expression. Sec31AFL-GFP - Oligonucleotides Sec31a-GFP-F and Sec31a-GFP-R (Table 2.2) were used to amplify the coding region of Sec31a, using human Sec31a cDNA (KIAA0905) as the template. The PCR fragment was gel-purified, digested with XhoI and SacII and then inserted into the corresponding sites in pEGFP-N1 p125AFL-Cherry - Oligonucleotides p125A-Cherry-F and p125A-Cherry-R (Table 2.2) were used to amplify the coding region of p125A, using human p125A cDNA as the template. The PCR fragment was gel-purified, digested with XhoI and SacII and then inserted into the corresponding sites in pmCherry-N1. 2.3 Expression of constructs in mammalian cells. The mammalian expression constructs were transfected into either HEK293 or HeLa cells using Effectene tranfection reagent (QIAGEN), according to manufacturer instructions. Expression was detected by immunoblot analysis, indirect immunofluoresence or live cell confocal microscopy 33 2.4 SDS-PAGE SDS (sodium dodecyl sulphate) polyacrylamide gel electrophoresis (SDS-PAGE) was performed by the Laemmli method (Laemmli, 1970). SDS polyacrylamide gels were made discontinuously with stacking gels (0.125 M Tris-HCl pH 6.8, 0.1% SDS and 4% acrylamide) and resolving gels (0.375 M Tris-HCl, pH 8.8, 0.1% SDS, 8.5% acrylamide). Protein samples were prepared in 2X Laemmli sample buffer (62.5 mM Tris-HCl pH 6.8, 25% glycerol [v/v], 2% SDS, 0.01% Bromophenol blue, 5% βmercaptoethanol [v/v]) and then analyzed by electrophoresis in 1X SDS running buffer (20 mM Tris Base, 200 mM glycine, 0.1% SDS) at constant 200 volts, using the Bio-Rad Mini-PROTEAN system (Bio-Rad, Hercules, CA, USA). SDS-PAGE gels were either stained with Coomassie blue or transferred onto membrane for immunoblot detection. For Coomassie blue staining, SDS-PAGE gels were stained in Coomassie blue staining buffer buffer (50% methanol, 10% acetic acid, 0.25% Coomassie Brilliant Blue R-250 [Bio-Rad]) at room temperature for 30 and then destained with destaining buffer (50% methanol, 10% acetic acid). The destained gel was washed in water to remove organic solvents before drying. 2.5 Western Blot Polyvinylidene difluoride (PVDF) membrane (Millipore) was first soaked in methanol before use. The SDS-PAGE gel was transferred onto the PVDF membrane in 1X Transfer Buffer (20 mM Tris Base, 200 mM glycine and 20% Methanol), with a constant voltage of 100 volts for hours at 4oC using Bio-Rad Mini Trans-Blot system. The membrane was then incubated in blocking buffer (5% skim milk and 5% FBS in PBS [Phosphate buffered Saline] containing 0.1% Tween 20) for 30 at room temperature followed by incubation with primary antibody in blocking buffer for hour at room temperature. The membrane was then washed times with 34 intervals using PBST (PBS with 0.1% Tween-20) and then incubated with HRPconjugated secondary antibody diluted with blocking buffer for hour at room temperature. After washing times with intervals using PBST, the membrane was developed with SuperSignal West PicoTM Chemiluminescent Substrate, (Pierce). The chemiluminescences signals were detected by exposing the blots to Hyperfilm (GE Healthcare) and the films were developed using Kodax X-ray film developer (Kodak, Rochester, NY, USA). If necessary, the membrane was stripped using RestoreTM Western Blot Stripping Buffer (Pierce) for 30 at room temperature with agitation and washed thoroughly with PBST before subjected to another round of blocking and antibody incubation. 2.6 Purification of GST-fusion proteins. A ml bacterial starter culture was inoculated in LB with the appropriate antibiotics and allowed to grow overnight at 37oC with agitation. The starter culture was diluted with fresh media to litre and allowed to grow to an OD600 of 0.8 before induction with Isopropyl β-D-1-thiogalactopyranoside (IPTG) at a final concentration of mM overnight at room temperature. The cells were pelleted and resuspended in 50 ml GST lysis buffer (PBS containing 50 mM Tris-HCl pH 8.0, mg/ml lysozyme, mM dithiotritol [DTT], mM phenylmethylsulfonyl fluoride [PMSF], 0.5 mM MgCl2, 0.1% Triton X-100 and Complete Protease Inhibitors ([Roche Diagnostics]). The cells were sonicated times for 30 seconds at 4oC, alternating with 30 seconds rest on ice. The lysate was then cleared by centrifugation and the supernatant was incubated with Gluthathione Sepharose 4B beads (GE Healthcare) pre-equilibrated with GST buffer (PBS containing 50 mM Tris-HCl pH8.0, 0.5 mM MgCl2) for hours at 4oC. After washing the beads extensively with GST buffer, the GST fusion proteins were eluted with 10 mM reduced glutathione in GST buffer and stored in aliquots at -20ºC. 35 2.7 Preparation of polyclonal antibodies 500 µg of GST-fusion protein was emulsified with Freund’s complete adjuvant (Pierce) and injected subcutaneously into two local New Zealand White rabbits. Booster injections with the same amount of antigen in Freund’s incomplete adjuvant (Pierce) were administered every weeks. The rabbits were bled 10 days after the second and subsequent boosters. For affinity purification, the antiserum was first diluted with an equal volume of PBS and then incubated for hours at 4°C with GST coupled to cyanogen bromide activated Sepharose 4B (CNBR) beads (GE Healthcare) to remove antibodies against GST. The flow-through was then incubated overnight at 4°C with beads coupled with the respective GST-fusion protein. The beads were washed extensively with PBS. Specific antibodies were eluted with Immunopure IgG elution buffer (Pierce) and dialyzed in PBS. 2.8 Preparation of mammalian cell lysate Cells on tissue culture dishes were lysed in lysis buffer (20 mM Tris-HCl, pH 7.5, 150 mM NaCl, % Triton X-100, mM PMSF and complete EDTA-free protease inhibitor mixture [Roche Diagnostics]). The lysate was incubated on ice for 30 and cleared by centrifugation at 13000 rpm for 30 at 4oC. 2.9 GST pulldown assay. Cell lysate was prepared as described in section 2.8. The lysate was incubated with 20ug of GST-fusion protein in the presence of Gluthathione Sepharose 4B beads (GE Healthcare) with rotation for hours at 4oC. The beads were washed times with cold lysis buffer and times with cold PBS. Excess PBS was removed and the proteins were then eluted in 2X Laemmli sample buffer, resolved by SDS-PAGE and transferred to PVDF membrane (Millipore) for subsequent immunodetection. 36 2.10 Immunoprecipitation Cell lysate was prepared as described in section 2.8. Immunoprecipitation was carried out at 4°C with µg of antibody in the presence of either Protein A or Protein G Sepharose Fast Flow (GE Healthcare) for hours at 4oC with rotation. The sepharose was then washed times with cell lysis buffer and twice with cold PBS. Bound proteins were eluted with 2X Laemmli sample buffer, resolved by SDS-PAGE and transferred to PVDF membrane (Millipore) for subsequent immunodetection. 2.11 Indirect Immunofluorescence (IF) microscopy Cells grown on coverslips (Fisher Scientific, Pittsburgh, PA, USA) were washed times with PBS supplemented with mM CaCl2 and mM MgCl2 (PBSCM). The cells were then fixed with 4% paraformaldehyde in PBSCM for 20 at room temperature. The fixed cells were washed times at intervals using PBSCM and then permeabilized with 0.1% Saponin (Sigma) in PBSCM for 20 at room temperature. The cells were then immunolabeled with appropriate primary antibodies diluted in fluorescence dilution buffer (FDB) (PBSCM with 5% FBS, 2% bovine serum albumin [BSA]) for hour at room temperature. The coverslips were then washed times with 0.1% Saponin PBSCM at intervals. Secondary antibodies were diluted appropriately in FDB and incubated at room temperature for hour. The coverslips were washed again with 0.1% Saponin PBSCM for times at intervals and then twice with PBSCM. The coverslips were mounted on microscopic slide with Vectashield mounting medium containing DAPI (4',6-diamidino-2-phenylindole) (Vector Laboratories, Burlingame, CA, USA). Confocal microscopy was performed 37 with either Zeiss AxioplanII microscope (Oberkochen, Germany) equipped with Zeiss confocal scanning optics or Olympus Fluoview 1000 confocal microscope (Center Valley, PA, USA). 2.12 Live cell confocal microscopy Cells were cultured on glass bottom culture dishes (MatTek, MA, USA) and were transfected with plasmid constructs of interest. The cells were then imaged using the Olympus Fluoview 1000 confocal microscope (Center Valley, PA, USA). 2.13 Preparation of rat liver cytosol Rats were starved overnight. Livers obtained were rinsed once in ice cold PBS, and then with ice cold 25/125 (25 mM Hepes-KOH, pH 7.2, 125 mM KOAC) buffer. Homogenization was carried out in volumes (ml/g) of 25/125 buffer using a manual Teflon homogenizer. The homogenate was centrifuged at 3000 rpm in a GSA rotor (Sorvall, MA, USA) for 10 at 4oC. The supernatants were filtered through cheese cloths and further centrifuged at 40000 rpm in a SW41 rotor (Beckman Coulter, Fullerton, CA, USA) for hours at 4oC. The top lipid layer was discarded and the cytosol was flash frozen in liquid nitrogen for further analysis. 2.14 Gel filtration analysis HeLa cytosol was fractionated using the Superose™ HR 10/30 column (GE Healthcare), using the ÄKTA™ Purifier 10 FPLC system (GE Healthcare). Fractionation was performed in 25/125 buffer containing mM PMSF at 4oC. Flow rate was 0.3 ml/min and fractions of 0.6 ml each were collected. The fractions were precipitated with trichloroacetic acid (TCA), resolved by SDS-PAGE and transferred to PVDF membrane (Millipore) for subsequent immunodetection. 38 2.15 Preparation of cytosol and membrane fractions from cell lines HeLa or HEK293 cells were harvested and homogenised in cytosol buffer (20 mM Tris-HCl, pH 7.5, 150 mM NaCl, mM PMSF and complete EDTA-free protease inhibitor mixture [Roche Diagnostics]). The cell suspension was passed through a 29G needle 10 times on ice. The cell lysate was briefly centrifuged at 2000 rpm for at 4oC. The clarified lysate was then subjected to centrifugation at 85000 rpm using the TLA120.1 rotor (Beckman Coulter) for hour at 4oC. Cytosol was collected and the membrane pellet was washed once with cytosol buffer and then centrifuged at 85000 rpm for 30 at 4oC once more using the TLA120.1 rotor (Beckman Coulter). The membrane pellet was resuspended in cell lysis buffer and centrifuged again at 85000 rpm using the TLA120.1 rotor (Beckman) for hour at 4oC for the third time. The solubilised membrane protein fraction was then collected. The proteins were resolved by SDS-PAGE and transferred to PVDF membrane (Millipore) for subsequent immunodetection. 2.16 shRNA-mediated gene silencing. 2.16.1 Cloning of shRNA sequences into pSuper.retro.puro. The sequences of the shRNA (short hairpin RNA) against human p125A and Sec31A were cloned into retroviral vector, pSuper.retro.puro vector (Oligoengine) as described in the manufacturer’s instructions. The sequences used for cloning into pSuper.retro.puro are listed in Table 2.3. The 19 nt sequence specific for p125A is obtained from Shimoi et al., (2005) and the Sec31A specific sequence is obtained from Ambion, Inc. (Austin, TX, USA), catalogue number 16708. The 5’ ends of each primer were phosphorylated. The primers were annealed and cloned into BglII 39 and XhoI of pSuper.retro.puro vector. The ligated constructs were transformed into One Shot® Stbl3™ chemically competent E. coli cells (Invitrogen). Table 2.3. shRNA sequences cloned into pSuper.retro.puro vector shRNA Sequence Sec31A-PSRP-F 5’- GATCCCCGGAACATCTGCTCAGCAATTTCAAGAGAATTGCTGAGCAGATGTTCCTTTTTC -3’ Sec31A-PSRP-R 5’- TCGAGAAAAAGGAACATCTGCTCAGCAATTCTCTTGAAATTGCTGAGCAGATGTTCCGGG -3’ p125A-PSRP-F 5’- GATCCCCGTTGACCATTTGGTGTTTGTTCAAGAGACAAACACCAAATGGTCAACTTTTTC -3’ p125A-PSRP-R 5’- TCGAGAAAAAGTTGACCATTTGGTGTTTGTCTCTTGAACAAACACCAAATGGTCAACGGG -3’ The 19 nt siRNA sequence in sense and antisense is bolded and underlined. 2.16.2 Retrovirus Generation and Infection The amphotropic Phoenix packaging cells (Nolan Laboratory, Stanford) were transfected with the indicated retroviral vectors using Effectene tranfection reagent (QIAGEN) according to the manufacturer’s instructions. After 48 h, the retroviral supernatants were collected, and filtered through a 0.45 μm filter (Millipore), and added onto the H460 cells in the presence of μg/ml of polybrene (Sigma) for 6-8 hr. Infection was performed three times. After infection, the cells were selected with puromycin (1 μg/ml) for a week before being analyzed for protein expression by immunoblotting. 2.17 Gene silencing using RNAi 2.17.1 Sequences of siRNAs used All siRNA duplexes are ON-TARGETplus SMARTpool obtained from Dharmacon Research Inc (Lafayette, CO, USA). siRNA target sequences are listed in Table 2.4. 40 Table 2.4. Target sequences of ON-TARGETplus SMARTpool siRNA No. Gene p125A (NM_007190) Catalogue No. L-012370-01 Target Sequences GGACACAGAUAGUCGAUUU CAGCCACAAUUCUCGGAUA GUGUGUGACUUACGCUUUA GCACCGAAGAUUAGAGUUU Sec13 (NM_183352) l-012351-00 CAUGUGAGCUGGUCCAUCA GGUCGUGUGUUCAUUUGGA CCAUCUCCCUGCUGACUUA GUAAUUAACACUGUGGAUA Sec31A (NM_16211) L-014166-01 ACACAGUGGUGCUUCGAUA CUUCAAACGCUUACCCUAA GUCAAGAGCAUUUACACUA CGUUUGAGAAUGUCAGAAU ON-TARGETplus D-001810-010 UGGUUUACAUGUCGACUAA siCONTROL UGGUUUACAUGUUGUGUGA Non-targeting Pool UGGUUUACAUGUUUUCUGA UGGUUUACAUGUUUUCCUA 2.17.2 siRNA transfection siRNA duplexes were transfected into HeLa cells using OligofectamineTM transfection reagent (Invitrogen) according to manufacturer protocol. For efficient knock-down, the cells were transfected twice with a 24 hour interval. All experiments were performed 72 hours after the first siRNA transfection. 2.18 Pulse-Chase metabolic labeling. Equal number of H460 cells was cultured overnight in a 6-well dish. The cells were then cultured in DMEM without L-methionine for 30 and then pulsed with 20 41 μCi of 35S-Methionine (Perkin Elmer) for 30 min. Cells were washed for five times with methionine free media (DMEM without L-methionine) and then chased with DMEM containing 10 mM L-methionine. The medium was collected at 30, 60, 120 and 240 min. After 240 of chase, the cells were washed with PBS for five times and collected. The cells were lysed with ml of 1X SDS sample buffer. Both the medium and cell lysate collected were analyzed by SDS-PAGE followed by autoradiography. 2.19 VSVG-tsO45 morphological and biochemical transport assay siRNA treated HeLa cells were transfected with VSVG-tsO45-EYFP plasmid 48 hours after the first siRNA transfection. Immediately after VSVG-tsO45-EYFP plasmid transfection, the cells were incubated at 40oC for to accumulate this temperature sensitive form of VSVG-YFP fusion protein in the ER. After 24 hours of incubation at 40oC, the cells were transferred to the permissive temperature at 32oC, upon which the cells were incubated with a final concentration of 100 μg/ml cyclohexamide to inhibit synthesis of new VSVG-YFP proteins. For the morphological transport assay, the cells were incubated further at 32oC for various times before being fixed and processed for indirect immunofluorescence microscopy. For biochemical transport assay, the cells were incubated further at 32oC for various times before being harvested. Cell lysate was harvested with lysis buffer (0.5% SDS, 1% β-mercaptoethanol) (50 μl per 35mm dish) and heated at 100oC for 10 min. Lysate was adjusted to 1X EndoH buffer (50 mM Citric acid, pH 5.5) in 70 μl. Half the lysate was treated with 2.5 Units of EndoH (Sigma) overnight at 37oC. The proteins were resolved by SDS-PAGE and transferred to PVDF (Millipore) for subsequent immunodetection. 42 2.20 Nocodazole treatment HeLa GT-GFP grown on coverslips was treated with 10 μg/ml final concentration of Nocodazole (Calbiochem, Darmstadt, Germany) for hour at 37oC. The cells were then fixed with paraformaldehyde and subjected to confocal microscopy. 2.21 BFA treatment and Golgi reassembly assay HeLa GT-GFP (either grown on coverslips or glass bottom tissue culture dishes) were treated with μg/ml final concentration of BFA (Epicentre Biotechnologies) for 30 at 37oC. The cells were rinsed times with warm growth media (37oC) to remove any traces of BFA. The cells were then incubated in growth media at 37oC in the presence of 100 μg/ml cyclohexamide to inhibit synthesis of new GT-GFP fusion proteins. The cells were then fixed and processed for indirect immunofluorescence microscopy after various time points. For Live imaging, the cells were imaged immediately after BFA washout using the Olympus Fluoview 1000 system. 2.22 p125A depletion from HeLa Cytosol Cytosol was obtained from 293 cells transfected with HA-p125AFL as described in section 2.15. 100 μg of cytosol was subjected to a total of three immunoprecipitations (IP). 25 μl of anti-HA agarose beads (Sigma) were used for each IP. 10% of the cytosol was collected after each IP and subjected to TCA precipitation. The proteins were then resolved by SDS-PAGE and transferred to PVDF (Millipore) for subsequent immunodetection. 2.23 Trichloroacetic Acid (TCA) Precipitation TCA was added to a final concentration of 10% (v/v). The sample was incubated at 20oC for hour and then centrifuged at 13,000 rpm for 30 at 4oC. The pellet was 43 washed with ice cold acetone and centrifuged at 13,000 rpm for 10 at 4oC. The wash step was performed times. The pellet was air dried and resuspended with 25 μl of 10mM NaOH and 25 μl 2X SDS sample buffer. [...]... GGACACAGAUAGUCGAUUU CAGCCACAAUUCUCGGAUA GUGUGUGACUUACGCUUUA GCACCGAAGAUUAGAGUUU 2 Sec13 (NM_1833 52) l-0 123 51-00 CAUGUGAGCUGGUCCAUCA GGUCGUGUGUUCAUUUGGA CCAUCUCCCUGCUGACUUA GUAAUUAACACUGUGGAUA 3 Sec3 1A (NM_1 621 1) L-014166-01 ACACAGUGGUGCUUCGAUA CUUCAAACGCUUACCCUAA GUCAAGAGCAUUUACACUA CGUUUGAGAAUGUCAGAAU 4 ON-TARGETplus D-001810-010 UGGUUUACAUGUCGACUAA siCONTROL UGGUUUACAUGUUGUGUGA Non-targeting Pool UGGUUUACAUGUUUUCUGA... p 12 5A- PSRP-F 5’- GATCCCCGTTGACCATTTGGTGTTTGTTCAAGAGACAAACACCAAATGGTCAACTTTTTC -3’ p 12 5A- PSRP-R 5’- TCGAGAAAAAGTTGACCATTTGGTGTTTGTCTCTTGAACAAACACCAAATGGTCAACGGG -3’ The 19 nt siRNA sequence in sense and antisense is bolded and underlined 2. 16 .2 Retrovirus Generation and Infection The amphotropic Phoenix packaging cells (Nolan Laboratory, Stanford) were transfected with the indicated retroviral vectors using... 39 and XhoI of pSuper.retro.puro vector The ligated constructs were transformed into One Shot® Stbl3™ chemically competent E coli cells (Invitrogen) Table 2. 3 shRNA sequences cloned into pSuper.retro.puro vector shRNA Sequence Sec3 1A- PSRP-F 5’- GATCCCCGGAACATCTGCTCAGCAATTTCAAGAGAATTGCTGAGCAGATGTTCCTTTTTC -3’ Sec3 1A- PSRP-R 5’- TCGAGAAAAAGGAACATCTGCTCAGCAATTCTCTTGAAATTGCTGAGCAGATGTTCCGGG -3’ p 12 5A- PSRP-F... for protein expression by immunoblotting 2. 17 Gene silencing using RNAi 2. 17.1 Sequences of siRNAs used All siRNA duplexes are ON-TARGETplus SMARTpool obtained from Dharmacon Research Inc (Lafayette, CO, USA) siRNA target sequences are listed in Table 2. 4 40 Table 2. 4 Target sequences of ON-TARGETplus SMARTpool siRNA No 1 Gene p 12 5A (NM_007190) Catalogue No L-0 123 70-01 Target Sequences GGACACAGAUAGUCGAUUU... immunodetection 2. 23 Trichloroacetic Acid (TCA) Precipitation TCA was added to a final concentration of 10% (v/v) The sample was incubated at 20 oC for 1 hour and then centrifuged at 13,000 rpm for 30 min at 4oC The pellet was 43 washed with ice cold acetone and centrifuged at 13,000 rpm for 10 min at 4oC The wash step was performed 3 times The pellet was air dried and resuspended with 25 μl of 10mM NaOH and 25 ... centrifuged at 3000 rpm in a GSA rotor (Sorvall, MA, USA) for 10 min at 4oC The supernatants were filtered through cheese cloths and further centrifuged at 40000 rpm in a SW41 rotor (Beckman Coulter, Fullerton, CA, USA) for 2 hours at 4oC The top lipid layer was discarded and the cytosol was flash frozen in liquid nitrogen for further analysis 2. 14 Gel filtration analysis HeLa cytosol was fractionated using... depletion from HeLa Cytosol Cytosol was obtained from 29 3 cells transfected with HA-p 125 AFL as described in section 2. 15 100 μg of cytosol was subjected to a total of three immunoprecipitations (IP) 25 μl of anti-HA agarose beads (Sigma) were used for each IP 10% of the cytosol was collected after each IP and subjected to TCA precipitation The proteins were then resolved by SDS-PAGE and transferred to PVDF... UGGUUUACAUGUUUUCUGA UGGUUUACAUGUUUUCCUA 2. 17 .2 siRNA transfection siRNA duplexes were transfected into HeLa cells using OligofectamineTM transfection reagent (Invitrogen) according to manufacturer protocol For efficient knock-down, the cells were transfected twice with a 24 hour interval All experiments were performed 72 hours after the first siRNA transfection 2. 18 Pulse-Chase metabolic labeling Equal number... lysate was prepared as described in section 2. 8 The lysate was incubated with 20 ug of GST-fusion protein in the presence of Gluthathione Sepharose 4B beads (GE Healthcare) with rotation for 2 hours at 4oC The beads were washed 5 times with cold lysis buffer and 2 times with cold PBS Excess PBS was removed and the proteins were then eluted in 2X Laemmli sample buffer, resolved by SDS-PAGE and transferred... column (GE Healthcare), using the ÄKTA™ Purifier 10 FPLC system (GE Healthcare) Fractionation was performed in 25 / 125 buffer containing 1 mM PMSF at 4oC Flow rate was 0.3 ml/min and fractions of 0.6 ml each were collected The fractions were precipitated with trichloroacetic acid (TCA), resolved by SDS-PAGE and transferred to PVDF membrane (Millipore) for subsequent immunodetection 38 2. 15 Preparation of . 5’-CCAGAGTCGACCGAGGCTGAATATAAAAAAGCTGTAACC-3’ p 12 5A- 600-R 5’-GACAGCGGCCGCTTCAATTCAAATCTTTTTGATTAGACAG-3’ p 12 5A- 650-R 5’-CAAGGCGGCCGCTTCACTGCTTCACAACTCCATTAGCAAC-3’ p 12 5A- 20 0-F 5’-CGGAGAGTCGACCCTGCAGCAGTGCCAAACACCAGGC-3’. TCGAGAAAAAGGAACATCTGCTCAGCAATTCTCTTGAAATTGCTGAGCAGATGTTCCGGG -3’ p 12 5A- PSRP-F 5’- GATCCCCGTTGACCATTTGGTGTTTGTTCAAGAGACAAACACCAAATGGTCAACTTTTTC -3’ p 12 5A- PSRP-R 5’- TCGAGAAAAAGTTGACCATTTGGTGTTTGTCTCTTGAACAAACACCAAATGGTCAACGGG. 5’-CGGAGAGTCGACCCTGCAGCAGTGCCAAACACCAGGC-3’ p 12 5A- 26 0-F 5’-GTCCGAGTCGACCCTACTTCAAAACCAATATGAGCCTG-3’ p 12 5A- CT100-F 5’-GTTGGAGTCGACCTTAACAACTGCAGCAACCTCAGTTG-3’ p 12 5A- CT200-F 5’-CGGAGAGTCGACCCTGCAGCAGTGCCAAACACCAGGC-3’