Functional study of MicroRNA 125b in vertebrate development 1

FUNCTIONAL STUDY OF MICRORNA-125B IN VERTEBRATE DEVELOPMENT LE THI NGUYET MINH (Bachelor of Science (honours) National University of Singapore) A THESIS SUBMITTED FOR THE DEGREE OF DOCTOR OF PHILOSOPHY IN COMPUTATION AND SYSTEMS BIOLOGY (CSB) SINGAPORE-MIT ALLIANCE NATIONAL UNIVERSITY OF SINGAPORE 2009 ABSTRACT microRNAs are a class of small non-coding RNAs that regulate gene expression at the post-transcriptional level. This thesis aims to reveal the new functions of miR-125b, a brain-enriched microRNA in vertebrate development. First, we demonstrated the important role of miR-125b in differentiation of two human neural cell lines. We also found that a subset of miR-125b-repressed targets antagonize neuronal genes in several neurogenic pathways. Second, we demonstrated that miR-125b is indispensable for zebrafish embryogenesis, particularly for the survival of neural cells. We identified p53, a key tumor suppressor, as a bona fide target of miR-125b in both zebrafish and humans. miR-125b directly represses p53 and multiple genes in the p53 network while p53 in turn suppressed the expression of miR-125b. Together, our study provides a global view of miR-125b function in modulating gene expression to maintain the homeostasis of cell survival, death and differentiation during development. ii ACKNOWLEDGEMENT I would like to express my deepest gratitude to my supervisors, Prof. Lim Bing and Prof. Harvey Lodish, who have offered me the best training and guidance throughout my candidature. Their brilliant ideas and excellent advices have leaded me in the right direction to the completion and success of this project. Their incredible passion for science and admirable achievements in academic career has given me the greatest inspiration to exploit new opportunities and advance further in research. My special thanks are also due to Dr. Beiyan Zhou, Dr. Cathleen Teh, Dr. Henry Yang and Dr. Moonkyoung Um who have provided me with patient training and mentoring at different stages of my study. I am also very thankful to Huangming Xie, Shyh-Chang Ng, Poh Hui Chia and Dr. Pamela Rizk for their help and contribution to some major experiments in this project (more details are included at the end of chapter and 4). I wish to express many thanks to Prof. David Bartel, Prof. Frank McKeon, Prof. Vladimir Korzh and Dr. Gerald Udolph for providing me with a lot of advices and useful facilities. I am also indebted to Prof. Hew Choy Leong, who first offered me the opportunity to join Singapore-MIT Alliance, and over the years, has given me a great deal of good advice, encouragement and care. I would like to extend my sincere thanks to all my colleagues in Biopolis and at the Whitehead Institute, especially Boon Seng Soh, Wai Leong Tam, Philip Gaughwin, Chin Yan Lim, Senthil Raja Jayapal, Yen Sin Ang, Yvonne Tay, Yin Loon Lee, KarLai Poon, Hang Nguyen, Svitlana Korzh, Amanda Goh, Quo Lin, Andrew Thomson, Prakash Rao, Shilpa Hattangadi and Cheng Cheng Zhang for fruitful discussions. Thanks to Rani Ettikan, Michael Chin, Li Pin, Adrian Lim, Lingbo Zhang, and Jun- iii Liang Tay for their technical supports. I also thank the staffs at Biopolis High Content Screening facility, zebrafish facility, confocal microscopy facility and histology facility for providing good services and advices. Thanks to Dr. Jun Chen and Prof. Jinrong Peng for the p53M214K mutant zebrafish and camptothecin; Dr. Kian-Chung Lee and Prof. Sir David Lane for the anti-p53 antibody and the H1299 cells. I would like to acknowledge with much gratitude the excellent coursework, the generous fellowship and research funding from Singapore-MIT Alliance. I also acknowledge the funding from A*STAR that provides the wonderful research facilities and intellectual atmosphere at Genome Institute of Singapore (GIS). I am grateful to the Graduate student committee members and the administrative staffs at Singapore-MIT Alliance and at GIS. Lastly, my heartfelt thanks to my family, especially to my parents whose encouragement has always been much treasured; to my husband, whose tremendous supports are the most essential to all my success; to my baby who has given me the courage to go through the most difficult time during my candidature. iv CONTENTS Abstract ii Acknowledgements iii Contents v Summary viii List of tables x List of figures xi Chapter 1. Introduction 1.1. Introduction to microRNAs 1.1.1. Biogenesis of microRNAs 1.1.3. Targets of microRNAs 1.2. The role of microRNAs in development 1.2.1. microRNA functions in embryogenesis 1.2.2. microRNA functions in stem cell development 1.2.3. microRNA functions in neurogenesis 1.3. microRNAs in diseases 11 1.4. The expression and known functions of miR-125b 14 1.5. Motivation of the thesis 18 1.6. Objectives of the thesis 19 1.7. Project workflow 19 Chapter 2. Materials and Methods 22 2.1. Cell culture and differentiation condition 22 2.2. miRNA expression profiling 23 2.3. Northern blot analysis 24 2.4. Transfection and drug treatment 26 v 2.5. Immunostaining and high-content screening of cells 27 2.6. Immunostaining of zebrafish embryos 28 2.7. Image acquisition and microscope settings 29 2.8. Whole mount in situ hybridization 29 2.9. Microinjection in zebrafish embryos 30 2.10. Quantitative real-time PCR 30 2.11. Western blot assay 31 2.12. Terminal dUTP nick end labeling (TUNEL) assay 33 2.13. Gene expression microarray and data analysis 33 2.14. Motif analysis by MEME 34 2.15. Analysis of seed matches 34 2.16. Target prediction and Pathway analysis 35 2.17. Cloning and mutagenesis 35 2.18. Statistical analysis 36 Chapter 3. microRNA-125b promotes neuronal differentiation in human 37 cells by repressing multiple targets 3.1. Profiling miRNA expression in SH-SY5Y cells during differentiation 37 3.2. Ectopic expression of six miRNA candidates and their effects on neurite outgrowth 43 3.3. miR-125b is necessary and sufficient for neurite outgrowth and neuronal marker gene expression 44 3.4. miR-125b is upregulated during differentiation of ReNcell VM cells and miR-125b ectopic expression promotes neurite outgrowth in these cells 48 3.5. Profiling the downstream effectors of miR-125b 51 3.6. Identification of direct targets of miR-125b 54 3.7. Pathway analysis and validation of direct miR-125b targets 57 3.8. Discussion 67 vi Chapter 4. microRNA-125b is a novel regulator of p53 73 4.1. Loss of miR-125b leads to severe defects in zebrafish embryos 73 4.2. miR-125b binds to the 3’ UTR of human and zebrafish p53 mRNAs 76 4.3. Spatio-temporal expression of miR-125b during zebrafish Embryogenesis 80 4.4. miR-125b represses endogenous p53 and p53-induced apoptosis in human neuroblastoma cells 83 4.5. miR-125b represses endogenous p53 and apoptosis in primary human lung fibroblasts 86 4.6. Loss of miR-125b increases p53 and p53-dependent apoptosis in zebrafish 4.7. Synthetic miR-125b duplex rescues apoptosis in miR-125b morphants by restoring the normal level of p53 89 4.8. Stress-induced p53 and apoptosis are repressed by ectopic miR-125b 96 4.9. Conservation of miR-125b targets in the p53 network 98 4.10. Discussion 103 Chapter 5. Conclusion and future prospective 94 107 5.1. The function of miR-125b in differentiation of neuronal cells 107 5.2. The function of miR-125b in regulating p53 and p53 dependentapoptosis 5.3. A global view of miR-125b regulatory network of human cells 107 109 5.4. The implication of miR-125b in tumorigenesis 113 References 114 Biography 127 vii SUMMARY microRNAs are a class of small non-coding RNAs that regulate gene expression at the post-transcriptional level. Research on microRNAs has highlighted their importance in many biological processes, especially in development. miR-125b is a homolog of lin-4 which is important for developmental timing in C. elegans. The expression of miR-125b is upregulated during embryogenesis and enriched in the nervous system of vertebrate species. However, the functions and targets of miR-125b remain poorly understood. This thesis aims to reveal new functions of miR-125b in development with focus on two experimental systems: differentiation of human neural cells and zebrafish embryogenesis. We first obtained the expression profile of microRNAs during neuronal differentiation in the human neuroblastoma cell line SH-SY5Y. Six microRNAs were significantly upregulated during differentiation induced by all-transretinoic acid and brain-derived neurotrophic factor. We demonstrated that ectopic expression of either miR-124a or miR-125b increases the percentage of differentiated SH-SY5Y cells with neurite outgrowth. Subsequently, we focused our functional analysis on miR-125b and demonstrated the important role of this miRNA in both spontaneous and induced differentiation of SH-SH5Y cells. miR-125b is also upregulated during differentiation of human neural progenitor ReNcell VM cells, and miR-125b ectopic expression significantly promotes neurite outgrowth of these cells. To identify the targets of miR-125b regulation, we profiled the global changes in gene expression following miR-125b ectopic expression in SH-SY5Y cells. More than 50% of the downregulated mRNAs contain the seed match sequence of miR-125b. Transcripts with stronger seed matches are repressed with higher fold changes. 188 of downregulated transcripts are predicted by TargetScan 5.1. to be direct targets of miR-125b. Pathway analysis suggests that a subset of miR-125b-repressed targets viii antagonize neuronal genes in several neurogenic pathways, thereby mediating the positive effect of miR-125b on neuronal differentiation. We have further confirmed the binding of miR-125b to the microRNA response elements of nine selected mRNA targets and validated the binding specificity for three targets. Together, these data reveal for the first time the important role of miR-125b in human neuronal differentiation. Further more, we demonstrate that miR-125b is indispensable for zebrafish embryogenesis, particularly for the survival of neural cells during development. We identified p53, a key tumor suppressor, as a bona fide target of miR-125b in both zebrafish and humans. miR-125b-mediated downregulation of p53 is strictly dependent on the binding of miR-125b to a microRNA-response element in the 3’ UTR of p53 mRNA. Overexpression of miR-125b represses the endogenous level of p53 protein and suppresses apoptosis in human neuroblastoma cells and human lung fibroblast cells. By contrast, knockdown of miR-125b elevates the level of p53 protein and induces apoptosis in human lung fibroblasts and in the zebrafish brain. This phenotype can be rescued significantly by either an ablation of endogenous p53 function or ectopic expression of miR-125b in zebrafish. Interestingly, miR-125b is downregulated when zebrafish embryos are treated with gamma-irradiation or camptothecin, corresponding to the rapid increase in p53 protein in response to DNA damage. Ectopic expression of miR-125b suppresses the increase of p53 and stressinduced apoptosis. We also identified seven additional targets of miR-125b in the p53 network and map the connections of miR-125b to many other components of this network. Together, our study provides a global view of miR-125b function, as an integrated component of the cellular regulatory network, in modulating gene expression to maintain the homeostasis of cell survival, death and differentiation. ix LIST OF TABLES Table Sequences of Northern blot probes and morpholinos 25 Table Primer sequences 31 Table Differentially expressed genes in SH-SY5Y cells 40 Table The targets of miR-125b predicted TargetScan 5.1. 61 Table Target validation summary 66 Table Percentage of embryos with neural cell death 75 Table Putative miR-125b targets in the p53 pathway 100 x POLE -0.60012 -0.66918 0.151728 -0.25441 -0.74895 -0.58833 0.114049 -0.19141 0.724215 0.704971 0.064859 0.281925 -1.02102 -1.07589 0.100021 -0.4234 -0.6534 -0.72921 -0.24587 -0.57606 -1.18785 -1.48726 0.018497 -0.53518 1.225184 0.964823 -0.15064 0.166314 PVRL2 poliovirus receptor-related (herpesvirus entry mediator B) RAB22A, member RAS oncogene family -0.81407 -1.10341 -0.04696 -0.10008 RAB22A recombination activating gene -0.59769 -0.73443 0.237844 0.021087 RAG1 retina and anterior neural fold homeobox -0.70717 -0.97151 0.345257 -0.11977 RAX ret proto-oncogene -1.7224 -0.64507 -0.28978 -0.28161 RET -0.65651 -0.782 0.049888 -0.28494 RFXANK regulatory factor X-associated ankyrincontaining protein regulator of G-protein signaling 12 -0.61673 0.699812 0.491617 0.210958 RGS12 rhomboid, veinlet-like (Drosophila) -0.60728 -0.72441 -0.56187 -0.4537 RHBDL1 ribonuclease, RNase A family, 1.070257 0.649353 -0.24827 -0.57437 RNASE4 ribosomal protein L28 1.2101 0.772867 -0.35256 0.127607 RPL28 -0.79126 -0.75452 -0.00938 -0.1856 -1.12025 -0.70366 -0.02441 -0.20978 RSAD2 ribosomal protein S6 kinase, 90kDa, polypeptide radical S-adenosyl methionine domain containing sterile alpha and TIR motif containing -0.96741 -0.72924 0.313896 0.104124 SARM1 sideroflexin -1.02232 -1.36099 -0.15233 -0.50582 SFXN2 sphingosine-1-phosphate lyase -0.78421 -1.22355 0.125953 -0.36266 SGPL1 SH3-domain binding protein -0.86977 -0.79572 -0.04257 -0.39978 SH3BP4 solute carrier family 25 (mitochondrial carrier; ornithine transporter) member 15 solute carrier family 35, member A4 -0.77108 -0.89763 -0.08885 -0.54679 -0.66528 -0.87837 -0.05822 -0.14637 -0.74649 -0.95366 -0.21147 -0.36498 0.587646 0.821008 -0.41084 -0.19254 SMARCD2 solute carrier family (sodium-calcium exchanger), member SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member SNF1-like kinase -1.26472 -0.68851 -0.34474 -0.39599 SNF1LK sortilin 0.964981 0.926991 0.175356 0.574626 SORT1 -0.60875 -0.74997 0.439119 -0.35702 -0.89941 -0.88779 0.06678 -0.46175 1.05869 0.770434 0.157955 0.412139 STARD7 ST6-N-acetylgalactosaminide alpha-2,6sialyltransferase ST8 alpha-N-acetyl-neuraminide alpha-2,8sialyltransferase StAR-related lipid transfer (START) domain containing stanniocalcin -0.64262 -0.69812 0.028548 -0.45943 STC2 serine/threonine kinase 11 interacting protein 1.486653 1.819168 0.430093 0.507822 STK11IP syntaxin -0.64333 -0.788 -0.4341 -0.50977 STX3 suppressor of variegation 3-9 homolog (Drosophila) TAP binding protein (tapasin) -1.13444 -1.08536 -0.0018 -0.54744 -0.7346 -0.73026 -0.04464 -0.48318 TBC1 (tre-2/USP6, BUB2, cdc16) domain family, member -0.72722 -0.68684 0.074691 -0.24953 PPP1CA PPP1R9B PRIC285 PRKRA PSMD8 PTPRO RPS6KA1 SLC25A15 SLC35A4 SLC8A2 ST6GALNAC6 ST8SIA3 SUV39H1 TAPBP protein phosphatase 1, catalytic subunit, alpha isoform protein phosphatase 1, regulatory (inhibitor) subunit 9B peroxisomal proliferator-activated receptor A interacting complex 285 protein kinase, interferon-inducible double stranded RNA dependent activator proteasome (prosome, macropain) 26S subunit, non-ATPase, protein tyrosine phosphatase, receptor type, O 64 TBC1D1 TBC1 domain family, member 22B -0.68688 -0.70584 -0.38034 -0.5054 TBC1D22B thymine-DNA glycosylase -0.59602 -0.67204 -0.25414 -0.37425 TDG TEA domain family member -0.90135 -1.13965 -0.1628 -0.53988 TEAD2 THO complex homolog -0.76946 -1.00056 -0.05252 -0.44445 THOC6 Thy-1 cell surface antigen -1.09557 -0.78042 -0.39408 -0.55911 THY1 toll-interleukin receptor (TIR) domain containing adaptor protein transmembrane superfamily protein member -1.04605 -1.00186 -0.00671 -0.52067 -0.93354 -0.59322 -0.10303 -0.49453 -0.62461 -0.78876 -0.10302 -0.25593 TMED9 transmembrane emp24 protein transport domain containing transmembrane protein 101 -0.93177 -0.71938 -0.0967 -0.37638 TMEM101 transmembrane protein 16F -0.76799 -0.62577 0.159587 -0.09467 TMEM16F transmembrane protein 86A -0.97253 -0.7365 -0.36194 -0.545 TMEM86A transmembrane protein 87B -0.86152 -1.25695 0.124466 -0.39521 TMEM87B 0.770573 0.96019 -0.28412 0.382991 TNFRSF10B tumor necrosis factor receptor superfamily, member 10b tumor protein p53 inducible nuclear protein -0.77257 -0.72932 0.357957 -0.31308 TP53INP1 trafficking protein, kinesin binding -1.13843 -0.90069 0.10012 0.163224 TRAK1 tetraspanin -0.66971 -0.85124 -0.07337 -0.34831 TSPAN9 tuftelin -0.72393 -0.93517 -0.08147 -0.28628 TUFT1 ubiquitin-conjugating enzyme E2G -0.60945 -0.69395 0.229282 -0.27963 UBE2G1 ubiquitin-conjugating enzyme E2L -1.20992 -1.13162 0.032054 -0.4106 UBE2L3 ubinuclein -0.74138 -0.70091 -0.0077 -0.37622 UBN1 vasohibin -0.70269 -0.76529 -0.50778 -0.57865 VASH1 Wolf-Hirschhorn syndrome candidate -0.77427 -0.78682 -0.09396 -0.46623 WHSC1 zinc finger, BED-type containing -0.75497 -0.91048 -0.2709 -0.22438 ZBED1 zinc finger, BED-type containing -0.68171 -0.64574 -0.05057 -0.02507 ZBED4 zinc finger and BTB domain containing -0.94312 -0.63317 -0.05996 -0.53998 ZBTB4 zinc finger, FYVE domain containing 0.688312 0.693578 0.555928 0.277444 ZFYVE1 zinc finger protein 24 -0.731 -0.90031 -0.25297 -0.49995 ZNF24 zinc finger protein 343 -0.66306 -0.61236 0.242637 -0.28393 ZNF343 zinc finger protein 395 -0.85547 -0.97986 0.050168 -0.29517 ZNF395 zinc finger protein 618 -0.72911 -0.63685 -0.24564 -0.283 ZNF618 zinc finger protein 708 -0.75941 -1.08316 0.167038 0.180803 ZNF708 zinc finger protein 76 1.089647 0.666512 0.308534 0.431439 TIRAP TM9SF4 65 Table 5. Target validation summary Ten target genes were selected from the microarray data, target prediction, and pathway analysis. Their expression pattern after two-day overexpression of miR-125b in growth medium (GM) or in differentiation medium containing all-trans-retinoic acid (RA) was validated by real-time PCR (Fig. 9a). The predicted miRNA response elements (MREs) were validated for binding to miR-125b by luciferase reporter assays (Fig. 9b-c); in three cases the specificity of the response to miR-125b was validated by luciferase reporter assays in which the predicted miR- 125b target sites in the 3’UTRs were mutated (Fig. 9c). “NT” means “not tested”. miR125b targets STK11IP PSMD8 ITCH TBC1D1 TDG MKNK2 DGAT1 GAB2 SGPL1 Downregulated by 2-day overexpression of mir-125b in GM Yes Yes Yes Yes Yes Yes Yes Yes Yes in RA Yes Yes Yes Yes Yes Yes Yes Yes Yes Predicted MREs MREs validated by luciferase reporter assay Specificity of the miR- 125b target site in the 3’UTR validated by mutation and luciferase reporter assay GAGAATGATCTGGCCTCAGGGG TCTGGTGGGCATTGCTCAGGGT TTTGTCAATTTGAATTCAGGGAA CGGGAAGTGTGCTTCTCAGGGA TTGAAGTGCCTTGCATCAGGGAT CCAGCCCGCAGTATTTCAGGGAC TCTGTCCTGCACCCCTCAGGGA TCAAAGCACTTGACATCAGGGAC TGTTCCATTCCCCATCTCAGGGA Yes Yes Yes Yes Yes Yes Yes Yes Yes NT NT NT Yes NT NT Yes NT Yes 66 3.8. Discussion In our study, we utilized a simple in vitro model of human neuronal differentiation in which human neuroblastoma SH-SY5Y cells were differentiated into a homogenous population of cells with neuronal morphology. The advantages of this model over other in vitro systems for human neuronal differentiation include its robust differentiation capability (terminal differentiation is obtained within two weeks of induction) and the formation only of neurons and not other cell types such as glia (Encinas et al., 2000). In comparison to previous reports on miRNAs in human neural differentiation (Sempere et al., 2004; Lee et al., 2005; Zhao et al., 2006; Yoong et al., 2006) which mainly focused on profiling of miRNAs, we have advanced well beyond expression profiling and established a number of reliable assays to assess the biological function of specific miRNAs in neuronal differentiation of SH-SY5Y cells as well as of human neural progenitor ReNcell VM cells. We identified two miRNAs, miR-124a and miR-125b, which promote neurite outgrowth. We further demonstrated how upregulation of miR-125b during neurogenesis downregulates a set of direct mRNA targets. Since the proteins encoded by these mRNAs normally repress neurogenesis, our model (Fig. 8d) suggests how miR-125b induction causes enhanced expression of multiple neuron- important genes. miR-125b is expressed in many types of tissues but its highest expression is in the brain, especially in mature neurons but not astrocytes (Sempere et al., 2004; Wienholds et al., 2005; Smirnova et al., 2005). miR-125b is upregulated during mouse neurogenesis (Smirnova et al., 2005), during neural differentiation of mouse embryonic stem cells (Krichevsky et al., 2006), and upon RA treatment of embryonic carcinoma cells (Sempere et al., 2004) and of neuroblastoma SK-N-BE cells (Laneve et al., 2007). Adding to these studies, our data demonstrates that miR-125b is not only 67 a marker of differentiation but also a regulator of neuronal differentiation in SHSY5Y cells. In our functional assays, we examined the effect of miR-125b ectopic expression on differentiation over a short time frame of four days and found that only a fraction of the cells differentiated. Importantly, the percentage of “differentiated cells” varies depending on the criteria used for quantification. In the neurite outgrowth assay, we considered only the differentiated cells with apparent neurite outgrowth. Because we used very stringent parameters that allow us to identify only the most mature neurons - ȕIII-tubulin positive cells with neurites longer than 30 μm - the percentage of the selected cells was rather small, 1-6% (Fig. 5b). Reducing the stringency by considering a lower minimum neurite length would increase the percentage of selected cells but the neurite identification then becomes less accurate since cell edges can be mistaken as short neurites. In our immunostaning assay, where differentiation was determined based on the expression of neuronal protein markers Map2ab, neurofilament and Syt5, we observed a higher percentage of differentiated cells, 516% (Fig. 5d). Hence, the cells appeared to upregulate these markers earlier than the onset of neurite outgrowth. Because we were concerned with the abnormal karyotype and tumor origin of SHSY5Y cells, we examined the expression and the function of miR-125b in a more physiologically relevant cell type, human neural progenitor RVM cells. Like primary neural stem cells, RVM cells have a normal karyotype and are able to differentiate into both neurons and glial cells (Donato et al., 2007). We showed that, as in SHSY5Y cells, miR-125b expression was gradually upregulated during differentiation of RVM cells. miR-125b ectopic expression significantly enhanced neurite outgrowth of 68 RVM cells in both growth medium and differentiation medium. On the other hand, we also noted several differences in the effects of miR-125b on SH-SY5Y and RVM cells. miR-125b ectopic expression exhibited a stronger effect on the average neurite length in RVM cells than in SH-SY5Y cells in growth medium but the reverse was observed in differentiation medium. Hence, in RVM cells, miR-125b alone is sufficient to promote the extension of neurite length but in SH-SY5Y cells, it requires the addition of retinoic acid (RA). Furthermore, knockdown of miR-125b in SHSY5Y cells significantly reduced the extension of neurites induced by RA however, the same effect was not observed when miR-125b was knocked down in RVM cells undergoing differentiation. Since the two cell lines were differentiated by two different methods, the differences in the effects of miR-125b may be more apparent than real, but it does appear as if the role of miR-125b in neurite outgrowth is more necessary for RA-induced differentiation of SH-SY5Y cells than it is for differentiation of RVM cells upon withdrawal of EGF and bFGF. Additionally, the phenotype may also be determined by the intrinsic differences between the two cell lines; as they express different mRNAs, the genes directly and indirectly affected by mir-125b regulation are likely to be different. The physiological functions of mir125b in vivo may also depend on different extrinsic and intrinsic factors that are regulated in a temporal and spatial manner. In chapter 4, we showed that knockdown of miR-125b leads to severe defects in zebrafish brain development, including the malformation of axonal tracts in midbrain and hindbrain, suggesting that miR-125b is required for neuronal differentiation in vivo. It would be interesting to further study the cell-specific function of mir-125b in vivo. To understand the mechanism mediating miR-125b function, we conducted a global profiling to identify miR-125b-responsive genes. We chose to perform this 69 experiment primarily in SH-SY5Y cells because these cells are more responsive to the modulation of miR-125b levels in comparison to RVM cells. Using microarrays, we identified 388 genes repressed by miR-125b ectopic expression and predicted by TargetScan 5.1. that 188 of these genes are the direct targets of miR-125b. Moreover, we found that 51 (~27%) out of the 188 selected targets were downregulated by RAor BDNF-induced neuronal differentiation by • 1.5 fold (Table 4). The inverse expression pattern of these genes in comparison to the endogenous expression of miR125b implies that they are targeted by miR-125b during differentiation. Although the actual number of endogenous targets is subjected to a further validation of our predictions but we expect the complex function of miR-125b to be mediated by multiple mRNA targets. Previous profiling studies of miRNA targets by microarrays and proteomics demonstrate that miRNAs usually downregulate several hundred genes; the targets are mostly repressed at both mRNA and protein levels although a number of them are regulated only at the protein level (Selbach et al., 2008; Baek et al., 2008). Our microarray data in SH-SY5Y cells was able to identify only the targets regulated by miR-125b through mRNA degradation and/or deadenylation. In the second part of our study, we found that p53 is a bona-fide target of miR-125b; modulation of miR-125b largely affects p53 protein level but did not show any significant change in the transcript level of p53 in SH-SY5Y cells (Chapter 4). Beside p53, it is possible that our microarray analysis also missed other targets that are regulated only by translational inhibition. We next asked how miR-125b mediates neuronal differentiation by suppressing the 188 predicted targets. Ingenuity Pathway Analysis (IPA) suggests that a subset of these targets is connected to the neuronal genes that were indirectly upregulated by miR-125b gain-of-function. We propose a simple model to explain how miR-125b 70 enhances differentiation. In constructing the model, we assumed that the direct targets of miR-125b inhibit pathways that promote the expression of neuronal genes. Hence, from the network connecting the predicted downregulated direct mRNA targets and the upregulated indirect neuronal effectors, we selected the pathways relevant to neurogenesis and the direct targets with known inhibitory effects or known binding to the components of these pathways. The model focused on nine predicted direct targets of miR-125b, and we validated these both by real-time PCR analysis of mRNA expression after ectopic expression of miR-125b and by a luciferase reporter assay (Table 5). IPA also reveals that many genes in the model pathways are regulated by RA in the same manner as by miR-125b. This relationship, and the fact that RA upregulates miR-125b during differentiation, suggests that miR-125b mediates RAinduced differentiation in SH-SY5Y cells. Our proposed model of the miR-125bnetwork supports this hypothesis, since the ERK signaling pathway featured prominently in our model is also known to mediate RA-induced differentiation in SHSY5Y cells (Miloso et al., 2004). Indeed, the model also predicts that miR-125b exerts a positive feedback on RXRA, the receptor for RA. In addition, IPA shows that the predicted targets of miR-125b are also connected to the repressed indirect effectors (genes downregulated four days after the transfection of 125b-DP), mainly with positive regulatory effects. These networks are involved in metabolism, proliferation, and apoptosis; thus in part miR-125b may enhance differentiation by reducing cell metabolism and proliferation. Experimentally, we did not find any significant effect of miR-125b gain-of-function on proliferation (using Ki67 staining, data not shown). Laneve et al also found that the effect of miR-125b alone has very little effect on proliferation although ectopic expression of miR-125b together with miR-125a and miR-9 inhibit cell cycling in neuroblastoma cells (Laneve 71 et al., 2007). Hence, the withdrawal of SH-SY5Y cells from the cell cycle during differentiation may require a synergistic effect between miR-125b and other miRNAs. NOTE: The optimization of SH-SY5Y differentiation condition (Fig. 1a) was done with help from Moonkyoung Um and Huangming Xie (Whitehead Institute). The microarray and Northern blot analysis of miRNA expression (Fig. and Fig. 3) were done together with Huangming Xie (equal contribution) with help from Beiyan Zhou (Whitehead Institute). Differentiation of RVM cells (Fig. 6a) were done by Poh Hui Chia (Institute of Medical Biology, Singapore) who also helped on the transfection of RVM cells (Fig. 6c). Computational analysis of miR-125b downstream targets (Fig. 7a-c and Fig. 8a-b) was performed with help from Henry Yang (Singapore Immunology Network). The luciferase reporter assay in Fig. 9c was done with help from Pamela Rizk (Institute of Medical Biology, Singapore). Other data in this chapter was obtained and analyzed by myself. 72 CHAPTER – MICRORNA-125B IS A NOVEL NEGATIVE REGULATOR OF P53 4.1. Loss of miR-125b leads to severe defects in zebrafish embryos To probe for the function of miR-125b in zebrafish, we synthesized four different morpholinos against miR-125b (Fig. 10a): one (m125bMO) targeting the mature guide strand, and three (lp125bMOs) targeting the precursors. In zebrafish, mature miR-125b is derived from three different precursor isoforms with sequence differences in the loop region (Fig. 10a); lp125bMOs were designed to bind to each of these loops. According to Kloosterman et al., binding of the morpholinos to the loop regions of miRNA precursors is able to block processing of the miRNAs, hence downregulating the mature miRNA level (Kloosterman et al., 2007). Near-complete knockdown of mature miR-125b was observed with m125bMO and also with a combination of the three lp125bMOs (Fig. 10b). Individual lp125bMOs also suppressed the expression of miR-125b albeit incompletely (Fig. 10b). As a control, injection of a morpholino (misMO) with five mismatches different from m125bMO did not cause in any significant change in miR-125b expression (Fig. 10b). Severe developmental defects were observed in the miR-125b morphants where the most apparent phenotype was the accumulation of dead cells in the brain (Fig. 10c). This phenotype was observed by 24 hpf in almost all embryos microinjected with m125bMO or with lp125bMO1/2/3 (Fig. 10c and Table 6). Other morphological defects upon miR-125b knockdown include smaller eyes, a missing midbrainhindbrain boundary (MHB), and deformities in the somites. These data are consistent with the expression pattern of miR-125b and demonstrate its importance in zebrafish development. 73 Figure 10 - Loss of miR-125b in zebrafish embryos (a) Design of morpholinos targeting either the guide strand of mature miR-125b (m125b) or the loop regions of pre-mir-125b (lp125b). Three different lp125b morpholinos (lp125bMO1/2/3) were designed for the three isoforms of pre-mir-125b. (b) Quantitative RT-PCR elucidating the effects of miR-125b morpholinos on the endogenous level of zebrafish miR-125b at 24 hpf. One-cell stage embryos were injected with m125bMO or lp125bMO1/2/3 (individually or together). A morpholino (misMO) with five nucleotides different from m125bMO was used as control. Total RNA was obtained from the embryos at 24 hpf. All the expression values were normalized to 18S RNA levels and presented as average percentage ± s.e.m. (n • 4) relative to the expression values in uninjected controls (marked by the dashed line). Two-tail T-test results are indicated by ** P < 0.01, relative to the uninjected control. (c) Loss-of-function morphology at 24 hpf: morphants typically exhibit severe cell death in the brain (brackets), absence of the midbrain-hindbrain boundary (*), smaller eyes (blue arrows) and deformed somites (green arrows). Each control/morphant embryo is shown with a lateral view of the whole body and a magnified view of the head. The total number of embryos (n) in each treatment and the percentage of embryos having the same phenotype as in the representative picture are indicated below each image. 74 Table - Percentage of embryos with neural cell death Neural cell death was observed in 24-hpf live embryos as the accumulation of dark cells in the brain (example shown in Fig. 10c). The embryos were counted in a double-blind manner. Negative control MO + - - - - - 125b-DP (fmole) - 37.5 - - 12.5 37.5 m125bMO - - + - - - lp125bMO1/2/3 - - - + + + Total survived embryos 91 95 85 112 90 121 Embryos with neural cell death 0% 0% 95% 98% 54% 6% 75 4.2. miR-125b binds to the 3’ UTR of human and zebrafish p53 mRNAs As neural cell death was the most apparent phenotype in zebrafish embryos injected with miR-125b morpholinos, we looked for putative targets of miR-125b that are associated with apoptosis. We found many of them from the predictions by TargetScan 3.1. (Lewis et al., 2005) and miRBase Target version (Griffiths-Jones et al., 2006) but only one gene, the tumour suppressor 53 gene (tp53), as a common target of miR-125b in humans and zebrafish (Fig. 11a). The putative MREs of miR125b were also found in the 3' UTRs of p53 mRNAs in other vertebrates (Fig. 12a). This suggests that p53 is likely to be an important target of miR-125b. Moreover, excessive p53 activity, caused by the loss of Mdm2, also causes neural cell death in zebrafish embryos at the same stage where we observed this phenotype in miR-125b morphants (Langheinrich et al., 2002). This information suggests that tp53 may be a target that mediates miR-125b function in zebrafish development. We validated the binding of miR-125b to the 3' UTR of human and zebrafish p53 using a luciferase reporter assay (Fig. 11a-b). Ectopic expression of miR-125b by transfection of miR-125b duplex into HEK-293T cells suppresses by ~60% (P < 0.01) the activity of a Renilla luciferase construct containing the miR-125b MREs of human or zebrafish p53 at its 3’ end (Fig. 11b). Similarly, the activity of a luciferase construct containing the entire 3' UTR of human or zebrafish p53 was suppressed ~40-50% (P < 0.01) by ectopic miR-125b (Fig. 11b). Suppression of luciferase activity was abolished when the miR-125b-MREs were deleted from the p53 3’UTR, and when a 3-base mismatch mutation was introduced into the seed region (Fig. 11b). These data indicate that the predicted MREs are critical for the direct and specific binding of miR-125b to the p53 mRNA. 76 To confirm the binding of miR-125b to human and zebrafish p53 in vitro, we ectopically expressed the full-length human/zebrafish p53 cDNA in p53-null H1299 cells. Consistent with the luciferase reporter assays, overexpression of miR-125b in H1299 cells significantly repressed both human and zebrafish wild-type p53 protein (30-40%, P [...]... miR -12 5b function in the mouse Swiss-3T3 cells 10 1 Figure 24 miR -12 5b connections to the p53 network 10 2 Figure 12 Figure 13 Figure 14 Figure 15 Figure 16 Figure 17 Figure 18 53 79 82 84 85 87 88 91 xi CHAPTER 1 – INTRODUCTION 1. 1 Introduction to microRNAs microRNAs (miRNAs) represent an emerging class of ~22 nucleotide non-coding RNAs that play important roles in post-transcriptional regulation of. .. suggesting a role of miR -12 5b in differentiation In contrast, miR -12 5b is downregulated in splenocytes of mice injected with lipopolysacharide or in the lung of mice exposed to cigarette smoke, suggesting a role of miR -12 5b in the innate immune response and stress responses (Tili et al., 2007; Izzotti et al., 2009) Of note, the expression pattern of miR -12 5a and miR -12 5b are not identical miR -12 5b is often... different doses of miR -12 5b and to etoposide treatments Loss of miR -12 5b elevates p53 and triggers p53-dependent apoptosis in zebrafish embryos Developmental onset of apoptosis in miR -12 5b morphants 92 Figure 20 Rescue of miR -12 5b morphants by the loss of p53 93 Figure 21 Synthetic miR -12 5b rescues apoptosis in miR -12 5b morphants 95 Figure 22 - Overexpression of miR -12 5b rescues stress-induced apoptosis... Figure 6 47 50 Figure 7 Expression and function of miR -12 5b in ReNcell VM cells during differentiation Profiling the downstream effectors of miR -12 5b Figure 8 Figure 9 Figure 10 Motif and pathway analysis Target validation Loss of miR -12 5b in zebrafish embryos 56 60 74 Figure 11 78 Figure 19 miR -12 5b binds to the 3’ UTR of zebrafish and human p53 mRNAs miR -12 5b miRNA response elements (MREs) and luciferase... identify miR -12 5b downstream targets in these cells 1. 6.2 To investigate the function and the targets of miR -12 5b in vivo, using zebrafish as a model 1. 7 Project workflow According to the objectives for the project, we performed functional analysis of miR125b both in vitro and in vivo First, we demonstrated the important role of miR -12 5b this miRNA in both spontaneous and induced differentiation of SH-SH5Y... Selection of nine miR -12 5b putative targets that may antagonize known neurogenic pathways Characterization of miR -12 5b expression and functions in neuronal differentiation of the neural progenitor RVM cells by qRT-PCR and neurite outgrowth assay Knockdown of miR -12 5b in zebrafish embryos by morpholinos Prediction of p53 as a target of miR -12 5b in humans and zebrafish Validation of miR -12 5b binding to... role in neuronal differentiation of human cells; (ii) this function may be conserved in other vertebrate species; (iii) the function of miR -12 5b may be mediated by multiple targets or pathways Therefore, we are interested in understanding the functions and the mechanism of action of miR125b 1. 6 Objectives of the thesis 1. 6 .1 To demonstrate the function of miR -12 5b in neuronal differentiation of human... miR -12 5b sequence, other regions of mir -12 5b precursors are not highly conserved Some species have multiple copies of pre-mir125b with variations in their sequences and encoded by different loci e.g humans and mouse express two copies of pre-mir -12 5b; zebrafish expresses three copies of pre- 14 mir -12 5b (miRBase Release 13 , 2009) In several species including human and mouse, both strands of pre-mir -12 5b. .. miR -12 5b also reduces the proliferation of the human neuroblastoma SK-N-BE cells by suppressing truncated tropomyosin kinase C (Laneve et al., 2007) The most well known target of miR -12 5b in mammalian cells is lin-28, that is also targeted by lin-4 in C elegans (Wu and Belasco, 2005) Lin-28 mRNA contains two binding sites for miR -12 5b in its 3’ UTR (Wu and Belasco, 2005) The protein level of lin-28... TargetScan 5 .1 to be the direct targets of miR -12 5b Pathway analysis suggests that a subset of miR -12 5brepressed targets antagonize neuronal genes in several neurogenic pathways, thereby mediating the positive effect of miR -12 5b on neuronal differentiation We have further validated the binding of miR -12 5b to the microRNA response elements of nine selected mRNA targets and confirmed the binding specificity . Introduction to microRNAs 1 1. 1 .1. Biogenesis of microRNAs 2 1. 1.3. Targets of microRNAs 3 1. 2. The role of microRNAs in development 6 1. 2 .1. microRNA functions in embryogenesis 6 1. 2.2. microRNA. functions in stem cell development 8 1. 2.3. microRNA functions in neurogenesis 9 1. 3. microRNAs in diseases 11 1. 4. The expression and known functions of miR -12 5b 14 1. 5. Motivation of the. 10 7 5 .1. The function of miR -12 5b in differentiation of neuronal cells 10 7 5.2. The function of miR -12 5b in regulating p53 and p53 dependent- apoptosis 10 7 5.3. A global view of miR -12 5b