Function of BPGAPI in RAS mediated neuronal differentiation

FUNCTION OF BPGAP1 IN RAS-MEDIATED NEURONAL DIFFERENTIATION SHARMY JENNIFER JAMES NATIONAL UNIVERSITY OF SINGAPORE 2010 FUNCTION OF BPGAP1 IN RAS-MEDIATED NEURONAL DIFFERENTIATION SHARMY JENNIFER JAMES (M.Sc. (Biochemistry), University of Madras) A THESIS SUBMITTED FOR THE DEGREE OF DOCTOR OF PHILOSOPHY DEPARTMENT OF BIOLOGICAL SCIENCES NATIONAL UNIVERSITY OF SINGAPORE 2010 ACKNOWLEDGEMENT First and foremost I offer my sincerest gratitude to my supervisor, Associate Professor Low Boon Chuan who has supported me throughout my graduate studies and thesis writing with his constructive criticism, patience, and knowledge whilst allowing me the room to work in my own way. Special thanks go to Dr. Chew Li Li, Dr. Aarthi Ravichandran and Dr. Zhou Yi Ting for their invaluable advice and time. It is a pleasure to thank lab members past and present. I thank Dr. Jan Buschdorf, Dr. Soh Jim Kim Unice, Dr. Zhong Dandan, Dr. Zhu Shizhen, Leow Shu Ting, Pearl Toh Pei Chern, Tan Jee Hia Allan, Soh Fu Ling, Dr. Liu Lihui, Dr. Pan Qiurong Catherine, Chin Fei Li Jasmine, Chew Ti Weng, Lim Gim Keat Kenny, Dr. Anjali Bansal Gupta, Archna Ravi, Shelly Kaushik, Sun Jichao, Zhang Zhenghua, Akila Surendran, and Huang Lu who made my graduate studies truly memorable by not only providing a lively environment but also by being caring and helpful. I would like to acknowledge the National University of Singapore for awarding me the Graduate research scholarship and special thanks to my supervisor for the funding me after the expiry of the scholarship. My parents deserve special mention for their support, encouragement and prayers and above all for showing me the joy of intellectual pursuit ever since I was a child and Samuel James for being a supportive and caring sibling. Words fail to express the appreciation for my husband Suresh for his continual support, understanding and love. Appreciate my son David Isaac and unborn daughter Davina Isabel for bearing with me through stressful times. Without the encouragement and sacrifice of my family, it would have been impossible to finish this work. Last but not the least, I thank God for his Grace, may his name always be exalted, honored, and glorified. Sharmy Jennifer James i TABLE OF CONTENTS ACKNOWLEDGEMENTS TABLE OF CONTENTS SUMMARY LIST OF TABLES LIST OF FIGURES LIST OF ABBREVIATIONS Pages i ii xiii xv xvi xx INTRODUCTION 1.1. Small GTPases – The molecular switches of cell dynamics control 1.1.1. Ras subfamily of small GTPases K-Ras, N-Ras and H-Ras 1.2. Mechanism of regulation and Biochemistry of GTPases control on signaling pathway 1.2.1. Small GTPases – the binary regulatory switches of signaling 1.2.1.1. Regulation of GTPase activation- Role of GEFS 1.2.1.1.a. General Mechanism of GEFs 1.2.1.1.b. Conserved mechanisms in GEFS 1.2.1.1.c. GEFs in disease 1.2.1.2. Regulation of GTPase inactivation - Role of GAPS 1.2.1.2.a. Mechanism of GAPs 6 10 11 ii 1.2.1.2.b. Regulation of GAPS 12 1.2.1.2.d. GAPs and disease 16 1.2.12.c. Regulation of Ras GAPS 1.3. Post Translational Modification of small GTPases 1.3.1. Ras Small GTPases - Localization dependant functions 1.3.2. Domain Architecture and Membrane targeting of Ras proteins 1.3.3. Importance of the Hypervariable region 1.4. Plasma membrane signaling nanoclusters 1.5. Compartmentalized signaling of Ras Isoforms 1.5.1. Endosomal signaling 1.5.2. ER⁄ Golgi signaling 1.5.2.1. Acylation cycle regulates localization and activity of palmitoylated Ras isoforms 1.6. Importance of the H-Ras isoform 1.7. Ras-MAPK signaling pathway 1.7.1. Complex activation and inactivation of Raf by phosphorylation 1.7.2. Activation of MEK1 by Raf 1.7.3. Activation of ERK1/2 by MEK1 and downstream targets of ERKs 1.8. PC12 as a model to study neuronal differentiation 15 17 18 19 22 23 25 25 25 26 28 30 32 33 33 35 iii 1.9. BPGAP1 38 1.9.1. Functional Domains of BPGAP1 39 1.9.3. Multifunctional nature of BPGAP1 40 1.9.2. BPGAP1 acts on multiple signaling pathways 1.9.3.1. BPGAP1 couples morphological changes to 39 cell migration. 40 Translocation to Cell Periphery for Enhanced Cell Migration 43 endocytosis and ERK1/2 phosphorylation 44 1.9.3.2. BPGAP1 Interacts with Cortactin and Facilitates Its 1.9.3.3. BPGAP1 interacts with EEN to activate EGF receptor 1.9.3.4. Active Mek2 acts as a regulatory scaffold that promotes Pin1 binding to BPGAP1 to suppress BPGAP1- induced acute ERK activation and cell migration 1.9.3.5. BPGAP1 exerts its effects through the Ras MAPK pathway 1.10. LanCL1 1.10.1. LanCL1 highly conserved across different species 1.10.2. Structure of LanCL1 1.10.3. Known Interacting partners for LanCL1 1.10.3.1. LanCL1 binds Zinc 1.10.3.2. LanCL1 interacts with Eps8 1.10.3.3. Interaction with Glutathione (GSH) 47 49 52 53 55 57 57 57 60 iv 1.10.3.4. LanCL1 oligomerization 1.10.3.5. LanCL1 is a novel interacting Partner for BPGAP1 1.11. Objectives 61 62 64 MATERIALS AND METHODS 2.1. Generation of LanCL1 and H-Ras Constructs 2.1.1. Secondary structure analysis prior to designing primers for truncation and internal deletion mutants 66 66 2.1.2. Polymerase chain reaction (PCR) 66 2.1.4. Gel extraction 69 2.1.3. Agarose gel electrophoresis 2.1.5. Restriction enzyme digestion 2.1.6 Cloning and expression vectors 69 69 70 2.1.6.1. pXJ40 Flag, HA, and GFP-tagged mammalian expression 71 2.1.6.2. pGEX-4T-1 GST-tagged bacterial expression vector 71 vector 2.1.6.3. pSilencer 2.1 U6 hygro siRNA expression vector 2.16.4. mCherry-N1 mammalian expression vector 2.1.7. Ligation 72 72 73 v 2.1.8. Competent Cells 2.1.8.1. Escherichia coli strain DH5α 2.1.8.2. Preparation of competent cells 2.1.9. Transformation of ligated products into competent bacterial 73 73 73 cells using heat-shock method of transformation 74 of transformation 75 2.1.10. Re-transformation of plasmid DNA using KCM method 2.1.11. Plasmid extraction 2.1.12. Spectrophotometric quantitation of plasmid DNA 2.1.13. Sequencing of DNA constructs 2.1.14. Checking expression of cloned constructs using mammalian 75 76 76 (pXJ40 and pSilencer series) or bacterial (pGEX-4T- series) 77 siRNA knockdown 78 2.2. Generation of pSilencer constructs for shRNA-mediated 2.3. Expression and purification of GST-fusion proteins in bacteria 2.4 Cell culture 2.4.1. Cell lines and maintenance 2.4.1.1. 293T 2.4.1.2. PC12 2.4.2. Transfection of 293T cells 2.4.3. Transfection of PC12 cells 80 82 82 82 83 83 84 vi 2.5. EGF stimulation 2.5.1. Time-course EGF stimulation of 293T cells for endogenous 85 ERK1/2 detection 85 prior to immunoprecipitation 85 of neurite formation 86 2.5.2. Time-course EGF stimulation of 293T cells 2.5.3. Suboptimal EGF stimulation of PC12 cells for assessment 2.6. NGF stimulation 2.6.1. NGF stimulation for immunoprecipitation 2.6.2. NGF stimulation of PC12 cells for assessment of potentiation of neurite outgrowth with suboptimal NGF conc. of 5ng/ml 2.7. Co-immunoprecipitation, in vitro precipitation/pull down and semi-endogenous pull down experiments 2.7.1. Preparation of mammalian whole cell lysates 2.7.2. Bradford Assay for protein quantitation 2.7.3. Co-immunoprecipitation 2.7.4. Semi-endogenous immunoprecipitation experiments 2.7.5. Sodium Dodecyl Sulphate – Polyacrylamide Gel Electrophoresis (SDS-PAGE) 2.7.6. Western Blotting analysis 87 87 87 88 88 89 89 90 91 92 vii 2.8. Staining of coverslips for indirect immunoflorescence detection 2.9. In vivo RBD assay 2.9.1 RBD assay in knockdown of endogenous LanCL1 with 94 over expression of BPGAP1 and time course EGF stimulation 94 overexpression of LanCL1 and BPGAP1 95 2.9.2 RBD assay under suboptimal NGF stimulation with 2.10. pSilencer sh Screening for Knockdown of endogenous LanCL1 92 96 RESULTS 3.1. LanCL1 forms complex with BPGAP1 in cells 3.1.1. Molecular cloning of human LanCL1 cDNA 3.1.3. BPGAP1- LanCL1 complex formation is dependent 3.1.2 97 97 Open conformation may be required for LanCL1 association 100 on stimulation 103 3.1.3.1. Association of BPGAP1 and LanCL1 is acute upon EGF stimulation 3.1.3.2. LanCL1 interacts with BPGAP1 upon NGF stimulation 3.1.3.3. Over expression of LanCL1 enhances ERK1/2 phosphorylation upon EGF stimulation 3.2. Identification of BPGAP1 and LanCL1 interactions with Ras 103 104 107 109 viii Chapter References Marshall, C. J. (1995) Specificity of receptor tyrosine kinase signaling: Transient versus sustained extracellular signal-regulated kinase activation. Cell. 80, 179185. Matvey Gorovoy, Radu Neamu, Jiaxin Niu, Stephen Vogel, Dan Predescu, Jun Miyoshi, Yoshimi Takai, Vidisha Kini, Dolly Mehta, Asrar B. Malik, Tatyana VoynoYasenetskaya (2007) RhoGDI-1 Modulation of the Activity of Monomeric RhoGTPase RhoA Regulates Endothelial Barrier Function in Mouse Lungs. Circ Res. 101, 50-8. Mayer, H., Breuss, J., Ziegler, S., and Prohaska, R. (1998) Molecular characterization and tissue-specific expression of a murine putative G-proteincoupled receptor. Biochem. Biophys. Acta. 1399, 51-56. Mayer, H., Bauer, H., Breuss, J., Ziegler, S., and Prohaska, R. (2001) Characterization of rat LanCL1, a novel member of the Lanthionine synthetase Clike protein family, highly expressed in testis and brain. Gene 269, 73-80. Mayer, H., Bauer, H., and Prohaska, R. (2001) Organization and chromosomal localization of the human and mouse genes coding for LanC-like protein (LanCL1). Cytogenet. Cell Genet. 93, 100-104. Mayer, H., Pongratz, M., and Prohaska, R. (2001) Molecular cloning, characterization, and tissue-specific expression of human LANCL2, a novel member of the LanC-like protein family. DNA Sequence. 12, 161-16. Moskwa, P., Paclet, M., Dagher, M. and Ligeti, E. (2005) Autoinhibition of p50 Rho GTPase-activating protein (GAP) is released by prenylated small GTPases. J. Biol. Chem. 280, 6716-6720. Meister, A., and Anderson, M. E. (1983) Glutathione, Annu. ReV. Biochem. 52, 711760. 225 Chapter References Minoru Takebayashi, Teruo Hayashi,and Tsung-ping Su (2004) Sigma -1 Receptors Potentiate Epidermal Growth Factor Signaling Towards Neuritogenesis in PC12 Cells: Potential Relation to Lipid Raft Reconstitution. Synapse. 53 , 90-103. Mitin NY, Ramocki MB, Zullo AJ, Der CJ, Konieczny SF and Taparowsky EJ. (2004) Identification and characterization of rain, a novel Ras-interacting protein with unique subcellular localization. J Biol Chem. 279, 22353–22361. Murakoshi H, Iino R, Kobayashi T, Fujiwara T, Ohshima C, Yoshimura A & Kusumi A. (2004) Single-molecule imaging analysis of Ras activation in living cells. PROC. NATL. ACAD. SCI. . 101, 7317-7322. Nakano, H., Shindo, M., Sakon,S., Nishinaka, S., Mihara, M., Yagita, Okumura, K., (1998) Differential regulation of kappa B kinase alpha and beta by two upstream kinases, NF-kappaB-inducing kinase and mitogen activated protein kinase/ERK kinase-1, Proc. Natl. Acad. Sci. 95, 3537–3542. Nicolau DV, Burrage K, Parton RG & Hancock JF. (2006) Identifying optimal lipid raft characteristics required to promote nanoscale protein–protein interactions on the plasma membrane. Mol Cell Biol. 26, 313–323. Nien-Pei Tsai, Ya-Lun Lin, Yao-Chen Tsui, and Li-Na Wei. (2010) Dual action of epidermal growth factor: extracellular signal-stimulated nuclear–cytoplasmic export and coordinated translation of selected messenger RNA. J. Cell Biol. 188, 325–333. Nien-Pei Tsaia, Yao-Chen Tsuia, John E. Pintarb, Horace H. Loha, and Li-Na Weia. (2010) Kappa opioid receptor contributes to EGF-stimulated neurite extension in development. Proc. Natl. Acad. Sci. 107, 3216–3221. 226 Chapter References Niv H, Gutman O, Kloog Y & Henis Y .(2002) Activated K-ras and H-ras display different interactions with saturable nonraft sites at the surface of live cells. J Cell Biol. 157, 865–872. Noda, M., M. Ko, A. Ogura, D. Liu, T. Amano, T. Takano, and Y.Ikawa (1985) Sarcoma viruses carrying ras oncogenes induce differentiation-associated properties in a neuronal cell line. Nature. 318, 73-75. Omerovic J, Laude AJ & Prior IA (2007) Ras proteins: paradigms for compartmentalised and isoform-specific signalling. Cell Mol Life Sci. 64, 2575– 2589. Onken, B., Wiener, H., Philips, M. R. and Chang, E. C. (2006). Compartmentalized signaling of Ras in fission yeast. Proc. Natl. Acad. Sci. 103, 9045-9050. Panagiotis A. Konstantinopoulos, Michalis V. Karamouzis and Athanasios G. Papavassiliou. (2007) Post-translational modifications and regulation of the RAS superfamily of GTPases as anticancer targets. Nature. 6, 541-555. Pastore, A., Tozzi, G., Gaeta, L. M., Bertini, E., Serafin, V., Di, Cesare, S., Bonetto, V., Casoni, F., Carrozzo, R., Federici, G., and Piemonte, F. (2003) Actin glutathionylation increases in fibroblasts of patients with Freidreich’s ataxia. J. Biol. Chem. 278, 42588-42595 Paz A, Haklai R, Elad-Sfadia G, Ballan E & Kloog Y. (2001) Galectin-1 binds oncogenic H-ras to mediate Ras membrane anchorage and cell transformation. Oncogene. 20, 7486–7493. Plowman SJ, Ariotti N, Goodall A, Parton RG and Hancock J. F. (2008) Electrostatic interactions positively regulate K-ras nanocluster formation and function. Mol Cell Biol. 28, 4377–4385. 227 Chapter References Pol A, Calvo M & Enrich C. (1998) Isolated endosomes from quiescent rat liver contain the signal transduction machinery. Differential distribution of activated Raf1 and Mek in the endocytic compartment. FEBS Lett. 441, 34-8. Pouyssegur J., Volmat V., Lenormand P., (2002) Fidelity and spatio-temporal control in MAP kinase (ERKs) signaling. Biochem. Pharm. 64 755–763. Potenza N, Vecchione C, Notte A, De Rienzo A, Rosica A, Bauer L, Affuso A, De Felice M, Russo T, Poulet R, Cifelli G, De Vita G, Lembo G, Di Lauro R. (2005) Replacement of K‑Ras with H‑Ras supports normal embryonic development despite inducing cardiovascular pathology in adult mice. EMBO Rep. 6, 432–437 Prior IA, Harding A, Yan J, Sluimer J, Parton RG and Hancock JF. (2001). GTPdependent segregation of H-ras from lipid rafts is required for biological activity. Nat Cell Biol. 3, 368–375. Prior, I. A., C. Muncke, R. G. Parton, and J. F. Hancock. (2003) Direct visualization of Ras proteins in spatially distinct cell surface microdomains. J. Cell Biol. 160,165–170. Prior IA, Parton RG & Hancock JF (2003) Observing cell surface signalling domains using electron microscopy. Sci. STKE, 177, 19. P W Mesner, T R Winters, and S H Green (1992) Nerve growth factor withdrawalinduced cell death in neuronal PC12 cells resembles that in sympathetic neurons. J Cell Biol. 119, 1669-1680. Radhika, V. & Dhanasekaran, N. (2001) Transforming G proteins. Oncogene. 20, 1607–1614. Raman, M. , Chen, W. , Cobb, M. H. (2007) Differential regulation and properties of MAPKs. Oncogene. 26, 3100-3112. 228 Chapter References Rajalingam K, Schreck R, Rapp UR, Albert S. (2001) Ras oncogenes and their downstream targets. Biochim Biophys Acta. 1773, 1177-95. Reid, T. S., Terry, K. L., Casey, P. J. & Beese L. S. (2004) Crystallographic analysis of CAAX prenyltransferases complexed with substrates defines rules of protein substrate selectivity. J. Mol. Biol. 343, 417–433. Rittinger, K., Walker, P.A., Eccleston, J.F., Smerdon, S.J., and Gamblin, S.J. (1997) Structure at 1.65 A of RhoA and its GTPase-activating protein in complex with a transition-state analogue. Nature. 389, 758–762. Rocks O, Peyker A, Kahms M, Verveer PJ, Koerner C, Lumbierres M, Kuhlmann J, Waldmann H, Wittinghofer A & Bastiaens PI. (2005) An acylation cycle regulates localization and activity of palmitoylated Ras isoforms. Science. 307, 1746–1752. Ronit Haviv and Reuven Stein (1999) Nerve growth factor inhibits apoptosis induced by tumor necrosis factor in PC12 cells. Journal of Neuroscience Research . 55, 269–277. Rosenberg A, Noble EP (1989) EGF-induced neuritogenesis and correlated synthesis of plasma membrane gangliosides in cultured embryonic chick CNS neurons. J Neurosci Res. 24, 531–536. Roy S, Plowman S, Rotblat B, Prior IA, Muncke C, Grainger S, Parton RG, Henis Y, Kloog Y & Hancock JF. (2005) Individual palmitoyl residues serve distinct roles in H-ras trafficking, microlocalization and signaling. Mol Cell Biol. 25, 6722–6733. Sandrine Roy, Bruce Wyse, and John F. Hancock (2002) H-Ras Signaling and KRas Signaling Are Differentially Dependent on Endocytosis. Molecular and Cellular Biology. 2, 5128 - 5140. 229 Chapter References Sandrine Roy, Sarah Plowman, Barak Rotblat, Ian A. Prior, Cornelia Muncke, Sarah Grainger, Robert G. Parton, Yoav I. Henis, Yoel Kloog,and John F. Hancock. (2005) Individual Palmitoyl Residues Serve Distinct Roles in H-Ras Trafficking, Microlocalization, and Signaling. Molecular and Cellular biology. 25, 6722-6733. Sasagawa S, Ozaki Y, Fujita K, Kuroda S. (2005) Prediction and validation of the distinct dynamics of transient and sustained ERK activation. Nat Cell Biol. 7, 365373. Sassone-Corsi, P., C. J. Der, and I. M. Verma. (1989) ras- induced neuronal differentiation of PC12 cells : possible involvement of fos and jun. Mol. Cell. Biol. 9, 3174-3183. Schenck A., Goto-Silva L., Collinet C., Rhinn M., Giner A., Habermann B., Brand M. and Zerial M. (2008) The endosomal protein Appl1 mediates Akt substrate specificity and cell survival in vertebrate development. Cell. 133, 486–497. Schimmelpfeng, J., K. -F. Weibezahn and H. Dertinger. (2004) Quantification of NGF-dependent neuronal differentiation of PC-12 cells by means of neurofilament-L mRNA expression and neuronal outgrowth. Journal of Neuroscience Methods. 30, 299-306. Schmidt, A. and Hall, A. (2002) Guanine nucleotide exchange factors for RhoGTPases: turning on the switch. Genes Dev. 16, 1587-1609. Serth J, A Lautwein, M Frech, A Wittinghofer, and A Pingoud. (1991) The inhibition of the GTPase activating protein Ha-ras interaction by acidic lipids is due to physical association of the C-terminal domain of the GTPase activating protein with micellar structures. EMBO J. 10, 1325–1330 Shang X, Zhou YT, Low BC. (2003) Concerted regulation of cell dynamics by BNIP-2 and Cdc42GAP homology/Sec14p-like, proline-rich, and GTPase- 230 Chapter References activating protein domains of a novel Rho GTPase-activating protein, BPGAP1. J Biol Chem. 278, 45903-14. Soh UJ, Low BC. (2008) BNIP2 extra long inhibits RhoA and cellular transformation by Lbc RhoGEF via its BCH domain. J Cell Sci. 121, 1739-49. Sordella R, Jiang W, Chen GC, Curto M, Settleman J. (2003) Modulation of Rho GTPase signaling regulates a switch between adipogenesis and myogenesis. Cell. 113, 147–158. Soyeon Park, and C. David James (2003) Lanthionine Synthetase Components Clike Increases Cellular Sensitivity to Adriamycin by Decreasing the Expression of P-Glycoprotein through a Transcription-mediated Mechanism. Cancer Res. 63, 723-7. Steelman,L . S., S.C. Pohnert, J.G. Shelton, R.A. Franklin, F.E. Bertrand, J.A. McCubrey (2004) JAK/STAT, Raf/MEK/ERK, PI3K/Akt and BCR-ABL in cell cycle progression and leukemogenesis. Leukemia. 18, 189–218. Stock JB, Ninfa AJ, Stock AM (1989) Protein phosphorylation and regulation of adaptive responses in bacteria. Microbiol. Rev. 53, 450–90. Sugimoto, Y., M. Noda, H. Kitayama, and Y. Ikawa (1988) Possible involvement of two signaling pathways in induction of neuron-associated properties by v-Ha-ras gene inPC12 cells. J. Biol.Chem. 263, 12102-12108. Takaya Satoh, Shun Nakamura, and Yoshito Kaziro. (1987) Induction of Neurite Formation in PC12 Cells by Microinjection of Proto-Oncogenic Ha-ras Protein Preincubated with Guanosine-5 '-O-(3-Thiotriphosphate). Molecular and Cellular Biology. 7, 4553-4556. 231 Chapter References Tian T, Harding A, Inder K, Plowman S, Parton RG and Hancock JF. (2007) Plasma membrane nanoswitches generate high-fidelity Ras signal transduction. Nat Cell Biol. 9, 905–914. Torii S, Kusakabe M, Yamamoto T, Maekawa M and Nishida E. (2004) Sef is a spatial regulator for Ras ⁄MAP kinase signaling. Dev Cell. 7, 33–44. Toshiya Manabe, Atsu Aiba, Atsushi Yamada, Taeko Ichise, Hiroyuki Sakagami, Hisatake Kondo, and Motoya Katsuki (2000). Regulation of long-term potentiation by H-Ras through NMDA receptor phosphorylation. J Neurosci. 20, 2504-2511. Tsai MH, CL Yu, FS Wei, and DW Stacey (1989). The effect of GTPase activating protein upon ras is inhibited by mitogenically responsive lipids. Science. 243, 522–526. Umanoff, H., Edelmann, W., Pellicer, A. and Kucherlapati, R. (1995) The murine N‑ras gene is not essential for growth and development. Proc. Natl. Acad. Sci. 92, 1709–1713. Van Rossum, A.G., De Graaf, J.H., Schuuring-Scholtes, E., Kluin, P.M., Fang, Y.X., Zhan, X., Moolenaar, W.H., and Schuuring, E. (2003) Alternative splicing of the actin-binding domain of human cortactin affects cell migration. J. Biol. Chem. 278, 45672–45679. Vaudry D .,1 P. J. S. Stork,2 P. Lazarovici,3 L. E. Eiden. (2002) Signaling Pathways for PC12 Cell. Differentiation: Making the Right Connections. Science. 296, 248249. Vossler M ., H. Yao, R. York, M.-G. Pan, C. Rim and P. Stork. (1997) cAMP Activates MAP Kinase and Elk-1 through a B-Ra f- and Rap1-Dependent Pathway. Cell. 89, 73-82. 232 Chapter References Wang, J., Boja, E. S., Tan, W., Tekle, E., Fales, H. M., English, S., Mieyal, J. J., and Chock, P. B. (2001) Reversible glutathionylation regulates actin polymerization in A431 cells. J. Biol.Chem. 276, 47763-47766. Wenchi Zhang, Liang Wang, Yijin Liu1,Jiwei Xu1, Guangyu Zhu3, Huaixing Cang1, Xuemei Li1, Mark Bartlam4, Kenneth Hensley, Guangpu Li, Zihe Rao,and Xuejun C. Zhang (2009) Structure of human lanthionine synthetase C-like protein and its interaction with Eps8 and glutathione. Genes & Dev. 23: 1387-1392. Weed, S.A., Du, Y., and Parsons, J.T. (1998) Translocation of cortactin to the cell periphery is mediated by the small GTPase Rac1. J. Cell Sci. 111, 2433– 2443. Yao R, Cooper GM. (1995) Requirement for phosphatidylinositol-3 kinase in the prevention of apoptosis by nerve growth factor. Science. 267, 2003-6. Yeung, K. , P. Janosch, B. McFerran, D. W. Rose, H. Mischak, J. M. Sedivy, and W. Kolch. 2000. Mechanism of suppression of the Raf/MEK/extracellular signalregulated kinase pathway by the Raf kinase inhibitor protein. Mol. Cell. Biol. 20, 3079-3085. Yoko Aoki, Tetsuya Niihori, Yoko Narumi, Shigeo Kure, Yoichi Matsubara (2008) The RAS/MAPK syndromes: novel roles of the RAS pathway in human genetic disorders. Human Mutation. 29, 992–1006. York R, Yao H, Dillon T, Ellig C, Eckert S, McCleskey E, Stork P. (1998) Rap1 mediates sustained MAP kinase activation induced by nerve growth factor. Nature. 392, 622-6. Yoshimi Takai, Takuya Sasaki, and Takashi Matozaki. (2001) Small GTP-Binding Proteins. Physiological Reviews. 81, 153-208. 233 Chapter References Zhang, F. L. & Casey, P. J. (1996) Protein prenylation : molecular mechanisms and functional consequences. Annu. Rev. Biochem. 65, 241–269 . Zhou Y. T., Soh UJ, Shang X, Guy GR, Low BC. (2002) The BNIP-2 and Cdc42GAP homology/Sec14p-like domain of BNIP-S alpha is a novel apoptosis-inducing sequence. J Biol Chem. 277, 7483-92. Zhou Y. T., Guy GR, Low BC. (2005) BNIP-2 induces cell elongation and membrane protrusions by interacting with Cdc42 via a unique Cdc42-binding motif within its BNIP-2 and Cdc42GAP homology domain. Exp Cell Res. 303, 26374. Zhou Y. T., guy, G. R. and Low, B.C. (2006) BNIP-Sα induces cell rounding and apoptosis by displacing p50RhoGAP and facilitating RhoA activation via its unique motifs in the BNIP-2 and Cdc42GAP homology domain. Oncogene. 25, 2393-2408. 234 Appendices Appendix I Nucleotide sequence of human p40 cDNA corresponding to LanCL1 obtained from EMBL that was used to design primers for cloning of human LanCL1 cDNA.The nucleotide sequence accession number is Y11395 (EMBL). LancL1 sequencing results Appendix I CLUSTAL W (1.83) multiple sequence alignment (forward primer) ori SJ2 ------------------------------------ATGGCTCAAAGGGCCTTCCCGAAT CTGAAGAGGACNTGATTGCGGAAACATATGNCATCCATGGCTCAAAGGGCCTTCCCGAAT ************************ ori SJ2 CCTTATGCTGATTATAACAAATCCCTGGCCGAAGGCTACTTTGATGCTGCCGGGAGGCTG CCTTATGCTGATTATAACAAATCCCTGGCCGAAGGCTACTTTGATGCTGCCGGGAGGCTG ************************************************************ ori SJ2 ACTCCTGAGTTCTCACAACGCTTGACCAATAAGATTCGGGAGCTTCTTCAGCAAATGGAG ACTCCTGAGTTCTCACAACGCTTGACCAATAAGATTCGGGAGCTTCTTCAGCAAATGGAG ************************************************************ ori SJ2 AGAGGCCTGAAATCAGCAGACCCTCGGGATGGCACCGGTTACACTGGCTGGGCAGGTATT AGAGGCCTGAAATCAGCAGACCCTCGGGATGGCACCGGTTACACTGGCTGGGCAGGTATT ************************************************************ ori SJ2 GCTGTGCTTTACTTACATCTTTATGATGTATTTGGGGACCCTGCCTACCTACAGTTAGCA GCTGTGCTTTACTTACATCTTTATGATGTATTTGGGGACCCTGCCTACCTACAGTTAGCA ************************************************************ ori SJ2 CATGGCTATGTAAAGCAAAGTCTGAACTGCTTAACCAAGCGCTCCATCACCTTCCTTTGT CATGGCTATGTAAAGCAAAGTCTGAACTGCTTAACCAAGCGCTCCATCACCTTCCTTTGT ************************************************************ ori SJ2 GGGGATGCAGGCCCCCTGGCAGTGGCCGCTGTGCTATATCACAAGATGAACAATGAGAAG GGGGATGCAGGCCCCCTGGCAGTGGCCGCTGTGCTATATCACAAGATGAACAATGAGAAG ************************************************************ ori SJ2 CAGGCAGAAGATTGCATCACACGGCTAATTCACCTAAATAAGATTGATCCTCATGCTCCA CAGGCAGAAGATTGCATCACACGGCTAATTCACCTAAATAAGATTGATCCTCATGCTCCA ************************************************************ ori SJ2 AATGAAATGCTCTATGGGCGAATAGGCTACATCTATGCTCTTCTTTTTGTCAATAAGAAC AATGAAATGCTCTATGGGCGAATAGGCTACATCTATGCTCTTCTTTTTGTCAATAAGAAC ************************************************************ ori SJ2 TTTGGAGTGGAAAAGATTCCTCAAAGCCATATTCAGCAGATTTGTGAAACAATTTTAACC TTTGGAGTGGAAAAGATTCCTCAAAGCCATATTCAGCAGATTTGTGAAACAATTTTAACC ************************************************************ ori SJ2 TCTGGAGAAAAC TCTGGAGAAAAC ************ CLUSTAL W (1.83) multiple sequence alignment(internal forwards primer) ori seqsj3 TGCTCTATGGGCGAATAGGCTACATCTAT TGCTCTATGGGCGAATAGGCTACATCTAT ***************************** ori seqsj3 GCTCTTCTTTTTGTCAATAAGAACTTTGGAGTGGAAAAGATTCCTCAAAGCCATATTCAG GCTCTTCTTTTTGTCAATAAGAACTTTGGAGTGGAAAAGATTCCTCAAAGCCATATTCAG ************************************************************ ori seqsj3 CAGATTTGTGAAACAATTTTAACCTCTGGAGAAAACCTAGCTAGGAAGAGAAACTTCACG CAGATTTGTGAAACAATTTTAACCTCTGGAGAAAACCTAGCTAGGAAGAGAAACTTCACG ************************************************************ ori seqsj3 GCAAAGTCTCCACTGATGTATGAATGGTACCAGGAATATTATGTAGGGGCTGCTCATGGC GCAAAGTCTCCACTGATGTATGAATGGTACCAGGAATATTATGTAGGGGCTGCTCATGGC ************************************************************ ori seqsj3 CTGGCTGGAATTTATTACTACCTGATGCAGCCCAGCCTTCAAGTGAGCCAAGGGAAGTTA CTGGCTGGAATTTATTACTACCTGATGCAGCCCAGCCTTCAAGTGAGCCAAGGGAAGTTA ************************************************************ Appendix I ori seqsj3 CATAGTTTGGTCAAGCCCAGTGTAGACTACGTCTGCCAGCTGAAATTCCCTTCTGGCAAT CATAGTTTGGTCAAGCCCAGTGTAGACTACGTCTGCCAGCTGAAATTCCCTTCTGGCAAT ************************************************************ ori seqsj3 TACCCTCCATGTATAGGTGATAATCGAGATCTGCTTGTCCATTGGTGCCATGGCGCCCCT TACCCTCCATGTATAGGTGATAATCGAGATCTGCTTGTCCATTGGTGCCATGGCGCCCCT ************************************************************ ori seqsj3 GGGGTAATCTACATGCTCATCCAGGCCTATAAGGTATTCAGAGAGGAAAAGTATCTCTGT GGGGTAATCTACATGCTCATCCAGGCCTATAAGGTATTCAGAGAGGAAAAGTATCTCTGT ************************************************************ ori seqsj3 GATGCCTATCAGTGTGCTGATGTGATCTGGCAATATGGGTTGCTGAAGAAGGGATATGGG GATGCCTATCAGTGTGCTGATGTGATCTGGCAATATGGGTTGCTGAAGAAGGGATATGGG ************************************************************ ori seqsj3 CTGTGCCACGGTTCTGCAGGGAATGCCTATGCCTTCCTGACACTCTACAACCTCACACAG CTGTGCCACGGTTCTGCAGGGAATGCCTATGCCTTCCTGACACTCTACAACCTCACACAG ************************************************************ ori seqsj3 GACATGAAGTACCTGTATAGGGCCTGTAAGTTTGCTGAATGGTGCTTAGAGTATGGAGAA GACATGAAGTACCTGTATAGGGCCTGTAAGTTTGCTGAATGGTGCTTAGAGTATGGAGAA ************************************************************ ori seqsj3 CATGG CATGG CLUSTAL W (1.83) multiple sequence alignment(internal3’ end forward primer) ori seqsj4 TAGGGCCTGTAAGTTTGCTGAATGGTGCTTAGAGTATGGAGAACATGGATGCA TAGGGCCTGTAAGTTTGCTGAATGGTGCTTAGAGTATGGAGAACATGGATGCA ***************************************************** ori seqsj4 GAACACCAGACACCCCTTTCTCTCTCTTTGAAGGAATGGCTGGAACAATATATTTCCTGG GAACACCAGACACCCCTTTCTCTCTCTTTGAAGGAATGGCTGGAACAATATATTTCCTGG ************************************************************ ori seqsj4 CTGACCTGCTAGTCCCCACAAAAGCCAGGTTCCCTGCATTTGAACTCTGA---------CTGACCTGCTAGTCCCCACAAAAGCCAGGTTCCCTGCATTTGAACTCTGACTCGAGGCGG ************************************************** ori seqsj4 -----------------------------------------------------------CCGCCCCGGGCTGCAGGAGCTCGGTACCAGATCTTATTAAAGCAGAACTTGTTTATTGCA The clustal W alignment of the LanCL1 clone. The sequencing was carried out using three Forward primers and three reverse primers at various positions to ensure complete sequencing . The results obtained with forward primers are depicted here. Green colour indicates vector backbone, overlapping regions between sequences have been highlighted in RED to show continuity. Appendix II The secondary structure of LancL1 (This structure was based on the protein sequence CAA72205 predicted with the NPS@ (Network Protein Sequence @nalysis) consensus secondary structure prediction web server (http://www.npsa-pbil.ibcp.fr) that incorporated 10 secondary structure prediction methods. The blue highlighted region indicates the amino acids deleted in the 3 mutant . Appendix III GFP-Vector DIC 12 hr hr NGF ng /ml hr hr mCherry-vector mCherry and GFP Vectors unable to potentiate neurite outgrowth at suboptimal NGF stimulation. PC12 cells were seeded on poly D-Lysine coated 6-well culture plates for 24 hours before they were co-transfected with pmCherry and GFP Vectors using Lipofectamine 2000 as described in “Materials and Methods”. Prior to live imaging using Olympus live imaging system, the cells were stimulated with suboptimal concentrations of 5ng/ml NGF. Representative fluorescent and phase contrast images captured on the live imaging system using manual focus fuction at times points 1, 4, and 12 hours for cells coexpressing pmCherry and GFP-vector are shown. Fluorescent images (First and second columns; panels to 4) and phase contrast images (third column; panels to4). Yellow arrows indicate neurite positions. [...]... preventing GAPs from stimulating the hydrolysis of GTP or by affecting GAP action, thereby maintaining Ras constitutively in the active GTP-bound conformation Besides Ras mutations, prolonged activation of Ras in carcinogenesis may also occur from inactivation of RAS GAPs (Panagiotis A et al., 2007) The catalysis of phosphoryl transfer by GAPs consists of 1) the proper orientation of the attacking water... in the rat genome in 1981 and were subsequently found in the mouse and human genomes (Rajalingam et al., 2007) N -Ras was then cloned from neuroblastoma and Leukemia cell lines in early 1980s There are four mammalian Ras proteins, encoded by three ras genes: H -Ras, NRas, K -Ras4 A and K -Ras4 B The three isoforms of Ras, H-, N- and K -Ras, are all ubiquitously expressed in mammalian cells 1.2 Mechanism of. .. catalyze the dissociation of the nucleotide from the G protein by modifying the nucleotide-binding site such that the nucleotide affinity is decreased, causing the release and subsequent replacing of the nucleotide In general, the affinity of the G 6 Chapter 1 Introduction protein for GTP and GDP is similar, and the GEF does not favor rebinding of GDP or GTP Thus the resulting increase in GTP-bound over GDP-bound... phosphate binding loop (P loop) interact with the phosphates and a coordinating magnesium ion Both phosphates and the magnesium ion are essential for the high-affinity binding of the nucleotide to the G protein (I R Vetter and A Wittinghofer, 2001) GEF binding induces conformational changes in the switch regions and the P loop, while leaving the remainder of the structure largely unperturbed For instance,... proteins Figure 1.1: Dendogram of the Ras superfamily of small GTPases Subfamilies are indicated by colored arcs RAS (pink), RAB/RAN (BLUE), ARF (Yellow), G (orange) and RHO (green) (Adapted from Coliceli, 2004) 2 Chapter 1 Introduction 1.1.1 Ras subfamily of small GTPases K -Ras , N -Ras and H -Ras The Ras subfamily of small GTPases encompasses 36 genes, coding for 39 Ras proteins The great fascination of. .. Activated Protein Kinase MEK MAPK/ERK kinase NO NGF-induced neuronal outgrowth NF-L neuro filament NGF Nerve Growth Factor OD Optical Density PAGE Polyacrylamide gel electrophoresis PBS Phosphate buffered saline P13-K Phosphoinositide 3’-kinase PKB Protein kinase B PVDf Polyvinylidene difluoride Rac1 Ras related C3 Botulinum Toxin Substrate 1 RasGRF-1 Ras protein-specific guanine nucleotide-releasing factor... proteins, comprised of multiple functional domains (Bos et al 2007) Moreover, the regulation of these proteins may be further complicated by the fact that some GEFs contain more than one GEF catalytic domain, or they contain a combination of GAP and GEF domains within a single protein (7) Performing context-dependent functions GEF activity may be determined by various regulatory inputs that impinge on a particular... GEFs 9 Chapter 1 Introduction 1.21.2 Regulation of GTPase inactivation - Role of GAPS GTPase-activating proteins (GAPs) are the key regulators of GTPase cycling, stimulating the weak intrinsic GTP-hydrolysis activity of the GTPases and inactivating them GAP activity is regulated by several mechanisms, including protein–protein interactions, phospholipid interactions, phosphorylation, subcellular translocation...3.2.1 BPGAP1 interacts with Ras a key activator of EGF signaling pathway 3.2.2 LanCL1 is H -Ras specific 3.2.2.1 LanCL1 interacts preferentially with constitutive active H-RasG12V 3.2.2.2 Specificity of LanCL1 for H -Ras may depend on differential localization of Ras isoforms 3.3 Delineating the binding regions on lanCL1 for BPGAP1 and H -Ras 3.3.1 BPGAP1 has multiple binding sites on LanCL1 3.3.2... genomes, with their diverse combinatorial arrangement of functional domains, highlights the complexity of their regulation This regulation includes proteinprotein or protein-lipid interactions, binding of second messengers, and posttranslational modifications (Bos et al., 2007) 1.2.1.1.a General Mechanism of GEFs The affinity of most small G proteins for GDP/GTP is in the lower nanomolar to picomolar . FUNCTION OF BPGAP1 IN RAS- MEDIATED NEURONAL DIFFERENTIATION SHARMY JENNIFER JAMES NATIONAL UNIVERSITY OF SINGAPORE 2010 FUNCTION OF BPGAP1 IN RAS- MEDIATED NEURONAL DIFFERENTIATION. H -Ras specific 112 with constitutive active H-RasG12V 115 3.2.2.2. Specificity of LanCL1 for H -Ras may depend on differential localization of Ras isoforms 115 3.3. Delineating the binding. Rho-GTPase-activating protein (RhoGAP) domain at the C-terminus and together with the N-terminal BCH domain and the Proline-rich region in between that targets cortactin, endhophilin, Mek2 and Pin1, these