A baculovirus cre 1oxp hybrid system for AAVS1 locus directed transgene delivery

A BACULOVIRUS-CRE/LOXP HYBRID SYSTEM FOR AAVS1 LOCUS-DIRECTED TRANSGENE DELIVERY CHRISHAN J. A. RAMACHANDRA NATIONAL UNIVERSITY OF SINGAPORE 2011 A Baculovirus-Cre/loxP Hybrid System for AAVS1 LocusDirected Transgene Delivery Chrishan J. A. Ramachandra (B.Sc. (Hons.), Queen Mary, University of London) A Thesis Submitted For the Degree of Doctor of Philosophy Department of Biological Sciences National University of Singapore 2011 Acknowledgments Foremost, I would like to express my sincere gratitude to my supervisor Associate Prof. Wang Shu for the continuous support and guidance throughout my candidature. His ready knowledge and encouragement whilst still allowing me to carry out my research in an independent manner made this study an enlightening and enjoyable process. I would like to thank my fellow graduate student Mohammad Shahbazi for his wonderful work ethic and thought provoking conversations which made long days in the lab a pleasant experience. I thank my fellow lab mates Timothy Kwang, Lam Dang Hoang and Yovita Ida Purwanti for all the fun and laughter we have had over the years. My sincere thanks to Dr. Seong Loong Lo and to all other members of the lab who have supported me on my research journey. I express my heartfelt gratitude to my fiancée Kathleen Fernando for her support and understanding at times when my only focus was on the screen in front of me. Last but not least I would like to acknowledge the Institute of Bioengineering and Nanotechnology for providing the opportunity to conduct my research in a renowned institute as well as the National University of Singapore for offering my Ph.D. candidature and research scholarship. i Publication The contents of this thesis are based upon the following publication. Ramachandra, C.J., et al., Efficient recombinase-mediated cassette exchange at the AAVS1 locus in human embryonic stem cells using baculoviral vectors. Nucleic Acids Res, 2011. 39(16): p. e107. ii Table of Contents Summary viii List of Tables . x List of Figures xi List of Abbreviations . xiii 1. An Introduction to Gene Therapy . 1.1 Genetic Modification Procedures . 1.1.1 Gene Augmentation . 1.1.2 Gene Knockdown . 1.1.3 Gene Editing 1.2 Viral Vectors and Transgene Delivery Systems . 1.2.1 Non-Viral Gene Delivery . 1.2.1.1 Physical Non-Viral Gene Delivery . 1.2.1.2 Chemical Non-Viral Gene Delivery 1.2.2 Viral Gene Delivery 1.3 Challenges Associated with Gene Therapy . 10 1.3.1 Insertional Mutagenesis . 10 1.3.2 Transgene Silencing 11 1.4 Transgene Delivery within a Pre-Defined Genomic Locus . 12 iii 1.4.1 Adeno-Associated Virus Integration Site-1 . 12 1.4.2 AAV2 Technology 13 1.4.3 Zinc-Finger Nucleases . 13 1.4.4 Transcription Activator-Like Effector Nucleases . 14 2. Aim of Study 16 3. Materials and Methodology . 20 3.1 Vector Construction and Baculovirus Propagation . 20 3.1.1 Plasmid Construction . 20 3.1.2 Recombinant Baculoviral Vector Construction 21 3.1.3 Baculovirus Propagation 22 3.2 Genetic Modification of Human Cell Lines . 23 3.2.1 HeLa Cells . 23 3.2.2 Human Embryonic Stem Cells 24 3.3 Detection of AAVS1 Modifications . 26 3.3.1 PCR Genotyping 26 3.3.2 Southern Blot Analysis . 26 3.4 Human Embryonic Stem Cell Differentiation 27 3.4.1 Embryoid Body Derivation 27 3.4.2 Neurosphere, Glial Cell and Neuron Derivation 27 iv 3.4.3 Mesenchymal Stem Cell Derivation 28 3.4.4 Dendritic Cell Derivation . 28 3.5 Characterization of Human Embryonic Stem Cells and Differentiated Cell Progenies 30 3.5.1 Immunostaining 30 3.5.2 RT-PCR Analysis . 31 3.5.3 Flow Cytometric Analysis . 31 3.6 BV-RMCE Functional Studies 32 3.6.1 In Vitro Tumor Killing Assay . 32 3.6.2 In Vitro Migration Assay . 32 4. Experimental Results 34 4.1 Homologous Recombination at the AAVS1 34 4.1.1 Generation of a loxP-HeLa Cell Line 34 4.1.2 Generation of a loxP-hESC Line 35 4.2 Cre Recombinase-Mediated Cassette Exchange Using Baculoviral Vectors . 42 4.2.1 Generation of Transgenic HeLa Cells . 42 4.2.2 Generation of Transgenic hESCs . 43 4.3 AAVS1-Directed Transgene Integration Results in Persistent Expression . 50 4.3.1 Expression Analysis in Transgenic HeLa Cells . 50 4.3.2 Expression Analysis in Transgenic hESCs . 50 v 4.4 AAVS1-Directed Transgene Integration Does Not Affect hESC Pluripotency . 54 4.4.1 Phenotype Comparison of Genetically Modified hESCs . 54 4.4.2 Confirmation of Pluripotency in Transgenic hESCs 54 4.5 Persistent Transgene Expression Maintained Following hESC Differentiation . 58 4.5.1 Transgenic Neural Stem Cell Derivation and Terminal Differentiation 58 4.5.2 Transgenic Mesenchymal Stem Cell Derivation . 59 4.5.3 Transgenic Dendritic Cell Derivation 59 4.6 Glioma Gene Therapy Potential of BV-RMCE . 64 4.6.1 Generation of Transgenic hESCs . 64 4.6.2 Gap Junction-Mediated Bystander Killing Effect of Transgenic NSCs 65 4.6.3 Tumor Migratory Properties of Transgenic NSCs . 65 4.7 Zinc-Finger Nuclease-Mediated Homologous Recombination at the AAVS1 Using Baculoviral Vectors 70 4.7.1 Genetic Modification in the Absence of Drug Selection 71 4.7.2 Transgene Expression Analysis . 71 5. Discussion . 74 5.1 Gene Targeting by Homologous Recombination 74 5.1.1 Cell Type Influences Recombination Frequency 75 5.1.2 Targeting Construct Influences Recombination Frequency 76 5.2 Cre/loxP Recombinase System – A Versatile Tool for Genome Modification . 78 vi 5.2.1 Mutated loxP Sites Enhance Site-Specific Transgene Integration Efficiency 78 5.2.2 MOI of Transgene Donor Influences RMCE Efficiency in HeLa Cells . 79 5.2.3 Baculovirus Transduction Mediates Efficient RMCE in hESCs . 80 5.3 Therapeutic Gene Delivery by Baculoviral Vectors 82 5.3.1 Baculoviral Vectors Mediate Efficient Gene Delivery in hESCs 82 5.3.2 Baculovirus and Immunotoxicity . 83 5.4 BV-RMCE in Stem Cell Research 84 5.4.1 Generation of Transgenic Cells for Ex Vivo Gene Therapy and Regenerative Medicine . 84 5.4.2 Understanding Developmental Biology . 85 5.4.3 Screening of Drugs and Toxins for Therapeutic Applications . 86 5.4.4 Generation of iPS Cells for Regenerative Medicine 86 5.4.5 Generation of Transgenic iPS Cell-Derived Progenies for Ex Vivo Gene Therapy 87 5.4.6 Adeno-Associated Virus Infection of Transgenic Cells . 88 6. Conclusion . 90 Bibliography 92 Appendix 109 vii Summary Gene therapy is a promising application for the treatment of patients with inherited or acquired diseases. It can be performed either in vivo or ex vivo and the principle concept involved is the introduction of exogenous genetic material into a patient. In ex vivo gene therapy, therapeutic genes are delivered into transplantable cells where they must maintain persistent expression as failure to so would result in a loss of therapeutic benefits. Transgene integration within the host genome is the most common way to induce persistent expression, however, most if not all approaches taken to achieve this feat are plagued by technical issues and safety concerns, namely insertional mutagenesis and transgene silencing. Hence, it is imperative to find an approach that induces persistent transgene expression without compromising genomic stability. Furthermore, it is necessary to identify genomic sites that are resistant to epigenetic silencing phenomena and upon disruption would not be detrimental to the host cell. The adeno-associated integration site-1 locus (AAVS1) on human chromosome 19 is one such site and is therefore regarded as a safe harbour for the integration of therapeutic genes. This study focuses on targeting the AAVS1 in human embryonic stem cells (hESCs) and HeLa cells via a novel approach. First, through conventional homologous recombination a floxed neomycin resistance marker was introduced into this locus. It was then replaced (exchanged) with a gene of interest (EGFP or HSVtk) using two baculoviral vectors; one expressing Cre recombinase and the other the transgene donor. Through this baculoviral vector-mediated Cre recombinase-mediated cassette exchange (BV-RMCE) technique significantly high transgene integration efficiencies were achieved at the AAVS1, allowing for the generation of transgenic hESCs and HeLa cells. viii 42. Yao, S., et al., Retrovirus silencing, variegation, extinction, and memory are controlled by a dynamic interplay of multiple epigenetic modifications. Mol Ther, 2004. 10(1): p. 27-36. 43. Ellis, J., Silencing and variegation of gammaretrovirus and lentivirus vectors. Hum Gene Ther, 2005. 16(11): p. 1241-6. 44. Xia, X., et al., Transgenes delivered by lentiviral vector are suppressed in human embryonic stem cells in a promoter-dependent manner. Stem Cells Dev, 2007. 16(1): p. 167-76. 45. Smith, J.R., et al., Robust, persistent transgene expression in human embryonic stem cells is achieved with AAVS1-targeted integration. Stem Cells, 2008. 26(2): p. 496-504. 46. One of three successfully treated CGD patients in a Swiss-German gene therapy trial died due to his underlying disease: A position statement from the European Society of Gene Therapy (ESGT). J Gene Med, 2006. 8(12): p. 1435. 47. Tan, I., et al., Phosphorylation of a novel myosin binding subunit of protein phosphatase reveals a conserved mechanism in the regulation of actin cytoskeleton. J Biol Chem, 2001. 276(24): p. 21209-16. 48. Kotin, R.M., R.M. Linden, and K.I. Berns, Characterization of a preferred site on human chromosome 19q for integration of adeno-associated virus DNA by non-homologous recombination. EMBO J, 1992. 11(13): p. 5071-8. 49. Srivastava, A., E.W. Lusby, and K.I. Berns, Nucleotide sequence and organization of the adeno-associated virus genome. J Virol, 1983. 45(2): p. 555-64. 50. Kotin, R.M., et al., Site-specific integration by adeno-associated virus. Proc Natl Acad Sci U S A, 1990. 87(6): p. 2211-5. 96 51. Linden, R.M., E. Winocour, and K.I. Berns, The recombination signals for adeno-associated virus site-specific integration. Proc Natl Acad Sci U S A, 1996. 93(15): p. 7966-72. 52. Lamartina, S., et al., Characteristics of the adeno-associated virus preintegration site in human chromosome 19: open chromatin conformation and transcription-competent environment. J Virol, 2000. 74(16): p. 7671-7. 53. Ogata, T., T. Kozuka, and T. Kanda, Identification of an insulator in AAVS1, a preferred region for integration of adeno-associated virus DNA. J Virol, 2003. 77(16): p. 9000-7. 54. Philpott, N.J., J. Gomos, and E. Falck-Pedersen, Transgene expression after rep-mediated site-specific integration into chromosome 19. Hum Gene Ther, 2004. 15(1): p. 47-61. 55. DeKelver, R.C., et al., Functional genomics, proteomics, and regulatory DNA analysis in isogenic settings using zinc finger nuclease-driven transgenesis into a safe harbor locus in the human genome. Genome Res, 2010. 20(8): p. 1133-42. 56. Philpott, N.J., et al., A p5 integration efficiency element mediates Repdependent integration into AAVS1 at chromosome 19. Proc Natl Acad Sci U S A, 2002. 99(19): p. 12381-5. 57. Linden, R.M., et al., Site-specific integration by adeno-associated virus. Proc Natl Acad Sci U S A, 1996. 93(21): p. 11288-94. 58. Balague, C., M. Kalla, and W.W. Zhang, Adeno-associated virus Rep78 protein and terminal repeats enhance integration of DNA sequences into the cellular genome. J Virol, 1997. 71(4): p. 3299-306. 59. Howden, S.E., L. Voullaire, and J. Vadolas, The transient expression of mRNA coding for Rep protein from AAV facilitates targeted plasmid integration. J Gene Med, 2008. 10(1): p. 42-50. 97 60. Howden, S.E., et al., Site-specific, Rep-mediated integration of the intact beta-globin locus in the human erythroleukaemic cell line K562. Gene Ther, 2008. 15(20): p. 1372-83. 61. Zeng, J., et al., Baculoviral vector-mediated transient and stable transgene expression in human embryonic stem cells. Stem Cells, 2007. 25(4): p. 105561. 62. Ekker, S.C., Zinc finger-based knockout punches for zebrafish genes. Zebrafish, 2008. 5(2): p. 121-3. 63. Geurts, A.M., et al., Knockout rats via embryo microinjection of zinc-finger nucleases. Science, 2009. 325(5939): p. 433. 64. Shukla, V.K., et al., Precise genome modification in the crop species Zea mays using zinc-finger nucleases. Nature, 2009. 459(7245): p. 437-41. 65. Durai, S., et al., Zinc finger nucleases: custom-designed molecular scissors for genome engineering of plant and mammalian cells. Nucleic Acids Res, 2005. 33(18): p. 5978-90. 66. Hockemeyer, D., et al., Efficient targeting of expressed and silent genes in human ESCs and iPSCs using zinc-finger nucleases. Nat Biotechnol, 2009. 27(9): p. 851-7. 67. Cathomen, T. and J.K. Joung, Zinc-finger nucleases: the next generation emerges. Mol Ther, 2008. 16(7): p. 1200-7. 68. Boch, J. and U. Bonas, Xanthomonas AvrBs3 family-type III effectors: discovery and function. Annu Rev Phytopathol, 2010. 48: p. 419-36. 69. Miller, J.C., et al., A TALE nuclease architecture for efficient genome editing. Nat Biotechnol, 2011. 29(2): p. 143-8. 70. Move over ZFNs. Nat Biotechnol, 2012. 29(8): p. 681-4. 71. Hockemeyer, D., et al., Genetic engineering of human pluripotent cells using TALE nucleases. Nat Biotechnol, 2011. 29(8): p. 731-4. 98 72. Reubinoff, B.E., et al., Neural progenitors from human embryonic stem cells. Nat Biotechnol, 2001. 19(12): p. 1134-40. 73. Laflamme, M.A., et al., Cardiomyocytes derived from human embryonic stem cells in pro-survival factors enhance function of infarcted rat hearts. Nat Biotechnol, 2007. 25(9): p. 1015-24. 74. Idelson, M., et al., Directed differentiation of human embryonic stem cells into functional retinal pigment epithelium cells. Cell Stem Cell, 2009. 5(4): p. 396408. 75. Slukvin, II, et al., Directed differentiation of human embryonic stem cells into functional dendritic cells through the myeloid pathway. J Immunol, 2006. 176(5): p. 2924-32. 76. D'Amour, K.A., et al., Efficient differentiation of human embryonic stem cells to definitive endoderm. Nat Biotechnol, 2005. 23(12): p. 1534-41. 77. Hwang, N.S., et al., In vivo commitment and functional tissue regeneration using human embryonic stem cell-derived mesenchymal cells. Proc Natl Acad Sci U S A, 2008. 105(52): p. 20641-6. 78. Keirstead, H.S., et al., Human embryonic stem cell-derived oligodendrocyte progenitor cell transplants remyelinate and restore locomotion after spinal cord injury. J Neurosci, 2005. 25(19): p. 4694-705. 79. Caspi, O., et al., Transplantation of human embryonic stem cell-derived cardiomyocytes improves myocardial performance in infarcted rat hearts. J Am Coll Cardiol, 2007. 50(19): p. 1884-93. 80. Wang, D., et al., Transplantation of human embryonic stem cell-derived alveolar epithelial type II cells abrogates acute lung injury in mice. Mol Ther, 2010. 18(3): p. 625-34. 81. Lamba, D.A., J. Gust, and T.A. Reh, Transplantation of human embryonic stem cell-derived photoreceptors restores some visual function in Crxdeficient mice. Cell Stem Cell, 2009. 4(1): p. 73-9. 99 82. Sauer, B. and N. Henderson, Site-specific DNA recombination in mammalian cells by the Cre recombinase of bacteriophage P1. Proc Natl Acad Sci U S A, 1988. 85(14): p. 5166-70. 83. Gu, H., Y.R. Zou, and K. Rajewsky, Independent control of immunoglobulin switch recombination at individual switch regions evidenced through CreloxP-mediated gene targeting. Cell, 1993. 73(6): p. 1155-64. 84. Araki, K., M. Araki, and K. Yamamura, Targeted integration of DNA using mutant lox sites in embryonic stem cells. Nucleic Acids Res, 1997. 25(4): p. 868-72. 85. Lakso, M., et al., Targeted oncogene activation by site-specific recombination in transgenic mice. Proc Natl Acad Sci U S A, 1992. 89(14): p. 6232-6. 86. Rossant, J. and A. Nagy, Genome engineering: the new mouse genetics. Nat Med, 1995. 1(6): p. 592-4. 87. Cheshenko, N., et al., A novel system for the production of fully deleted adenovirus vectors that does not require helper adenovirus. Gene Ther, 2001. 8(11): p. 846-54. 88. Condreay, J.P., et al., Transient and stable gene expression in mammalian cells transduced with a recombinant baculovirus vector. Proc Natl Acad Sci U S A, 1999. 96(1): p. 127-32. 89. Merrihew, R.V., et al., Chromosomal integration of transduced recombinant baculovirus DNA in mammalian cells. J Virol, 2001. 75(2): p. 903-9. 90. Chen, C.Y., et al., Biosafety assessment of human mesenchymal stem cells engineered by hybrid baculovirus vectors. Mol Pharm, 2011. 8(5): p. 1505-14. 91. Balani, P., et al., High mobility group box2 promoter-controlled suicide gene expression enables targeted glioblastoma treatment. Mol Ther, 2009. 17(6): p. 1003-11. 100 92. Huang, W., et al., Suppression of gastric cancer growth by baculovirus vectormediated transfer of normal epithelial cell specific-1 gene. World J Gastroenterol, 2008. 14(38): p. 5810-5. 93. Luo, W.Y., et al., Baculovirus vectors for antiangiogenesis-based cancer gene therapy. Cancer Gene Ther, 2011. 18(9): p. 637-45. 94. Suzuki, T., et al., Baculovirus activates murine dendritic cells and induces non-specific NK cell and T cell immune responses. Cell Immunol, 2010. 262(1): p. 35-43. 95. Chuang, C.K., et al., Baculovirus as a new gene delivery vector for stem cell engineering and bone tissue engineering. Gene Ther, 2007. 14(19): p. 141724. 96. Strauss, R., et al., Baculovirus-based vaccination vectors allow for efficient induction of immune responses against plasmodium falciparum circumsporozoite protein. Mol Ther, 2007. 15(1): p. 193-202. 97. Hofmann, C. and M. Strauss, Baculovirus-mediated gene transfer in the presence of human serum or blood facilitated by inhibition of the complement system. Gene Ther, 1998. 5(4): p. 531-6. 98. Huser, A., M. Rudolph, and C. Hofmann, Incorporation of decay-accelerating factor into the baculovirus envelope generates complement-resistant gene transfer vectors. Nat Biotechnol, 2001. 19(5): p. 451-5. 99. Fillat, C., et al., Suicide gene therapy mediated by the Herpes Simplex virus thymidine kinase gene/Ganciclovir system: fifteen years of application. Curr Gene Ther, 2003. 3(1): p. 13-26. 100. Aboody, K.S., et al., Neural stem cells display extensive tropism for pathology in adult brain: evidence from intracranial gliomas. Proc Natl Acad Sci U S A, 2000. 97(23): p. 12846-51. 101 101. Ahmed, A.U., N.G. Alexiades, and M.S. Lesniak, The use of neural stem cells in cancer gene therapy: predicting the path to the clinic. Curr Opin Mol Ther, 2010. 12(5): p. 546-52. 102. Thompson, S., et al., Germ line transmission and expression of a corrected HPRT gene produced by gene targeting in embryonic stem cells. Cell, 1989. 56(2): p. 313-21. 103. Koller, B.H., et al., Germ-line transmission of a planned alteration made in a hypoxanthine phosphoribosyltransferase gene by homologous recombination in embryonic stem cells. Proc Natl Acad Sci U S A, 1989. 86(22): p. 8927-31. 104. Thomas, K.R. and M.R. Capecchi, Site-directed mutagenesis by gene targeting in mouse embryo-derived stem cells. Cell, 1987. 51(3): p. 503-12. 105. Smithies, O., et al., Insertion of DNA sequences into the human chromosomal beta-globin locus by homologous recombination. Nature, 1985. 317(6034): p. 230-4. 106. Farese, R.V., Jr., L.M. Flynn, and S.G. Young, Modification of the apolipoprotein B gene in HepG2 cells by gene targeting. J Clin Invest, 1992. 90(1): p. 256-61. 107. Manjunath, N., et al., Targeted disruption of CD43 gene enhances T lymphocyte adhesion. J Immunol, 1993. 151(3): p. 1528-34. 108. Zhen, L., et al., Gene targeting of X chromosome-linked chronic granulomatous disease locus in a human myeloid leukemia cell line and rescue by expression of recombinant gp91phox. Proc Natl Acad Sci U S A, 1993. 90(21): p. 9832-6. 109. Shirasawa, S., et al., Altered growth of human colon cancer cell lines disrupted at activated Ki-ras. Science, 1993. 260(5104): p. 85-8. 110. Waldman, T., K.W. Kinzler, and B. Vogelstein, p21 is necessary for the p53mediated G1 arrest in human cancer cells. Cancer Res, 1995. 55(22): p. 5187-90. 102 111. Montrose-Rafizadeh, C., et al., Gene targeting of a CFTR allele in HT29 human epithelial cells. J Cell Physiol, 1997. 170(3): p. 299-308. 112. Itzhaki, J.E. and A.C. Porter, Targeted disruption of a human interferoninducible gene detected by secretion of human growth hormone. Nucleic Acids Res, 1991. 19(14): p. 3835-42. 113. Jasin, M., et al., Gene targeting at the human CD4 locus by epitope addition. Genes Dev, 1990. 4(2): p. 157-66. 114. Itzhaki, J.E., et al., Targeted breakage of a human chromosome mediated by cloned human telomeric DNA. Nat Genet, 1992. 2(4): p. 283-7. 115. Itzhaki, J.E., C.S. Gilbert, and A.C. Porter, Construction by gene targeting in human cells of a "conditional' CDC2 mutant that rereplicates its DNA. Nat Genet, 1997. 15(3): p. 258-65. 116. Williams, S.R., et al., Rapid detection of homologous recombinants in nontransformed human cells. Proc Natl Acad Sci U S A, 1994. 91(25): p. 11943-7. 117. Brown, J.P., W. Wei, and J.M. Sedivy, Bypass of senescence after disruption of p21CIP1/WAF1 gene in normal diploid human fibroblasts. Science, 1997. 277(5327): p. 831-4. 118. Zwaka, T.P. and J.A. Thomson, Homologous recombination in human embryonic stem cells. Nat Biotechnol, 2003. 21(3): p. 319-21. 119. Irion, S., et al., Identification and targeting of the ROSA26 locus in human embryonic stem cells. Nat Biotechnol, 2007. 25(12): p. 1477-82. 120. Di Domenico, A.I., et al., Sequential genetic modification of the hprt locus in human ESCs combining gene targeting and recombinase-mediated cassette exchange. Cloning Stem Cells, 2008. 10(2): p. 217-30. 121. Ruby, K.M. and B. Zheng, Gene targeting in a HUES line of human embryonic stem cells via electroporation. Stem Cells, 2009. 27(7): p. 1496506. 103 122. Xue, H., et al., A targeted neuroglial reporter line generated by homologous recombination in human embryonic stem cells. Stem Cells, 2009. 27(8): p. 1836-46. 123. Sakurai, K., et al., Efficient integration of transgenes into a defined locus in human embryonic stem cells. Nucleic Acids Res, 2010. 38(7): p. e96. 124. Lombardo, A., et al., Gene editing in human stem cells using zinc finger nucleases and integrase-defective lentiviral vector delivery. Nat Biotechnol, 2007. 25(11): p. 1298-306. 125. Suzuki, K., et al., Highly efficient transient gene expression and gene targeting in primate embryonic stem cells with helper-dependent adenoviral vectors. Proc Natl Acad Sci U S A, 2008. 105(37): p. 13781-6. 126. Nakayama, M., Homologous recombination in human iPS and ES cells for use in gene correction therapy. Drug Discov Today, 2010. 15(5-6): p. 198202. 127. Miyagawa, K., et al., A role for RAD54B in homologous recombination in human cells. EMBO J, 2002. 21(1-2): p. 175-80. 128. Yanez, R.J. and A.C. Porter, Gene targeting is enhanced in human cells overexpressing hRAD51. Gene Ther, 1999. 6(7): p. 1282-90. 129. Richardson, C., RAD51, genomic stability, and tumorigenesis. Cancer Lett, 2005. 218(2): p. 127-39. 130. Klein, H.L., The consequences of Rad51 overexpression for normal and tumor cells. DNA Repair (Amst), 2008. 7(5): p. 686-93. 131. Lu, Z.H., et al., Long targeting arms not increase the efficiency of homologous recombination in the beta-globin locus of murine embryonic stem cells. Blood, 2003. 102(4): p. 1531-3. 132. Hoess, R.H. and K. Abremski, Mechanism of strand cleavage and exchange in the Cre-lox site-specific recombination system. J Mol Biol, 1985. 181(3): p. 351-62. 104 133. Baer, A. and J. Bode, Coping with kinetic and thermodynamic barriers: RMCE, an efficient strategy for the targeted integration of transgenes. Curr Opin Biotechnol, 2001. 12(5): p. 473-80. 134. Gu, H., et al., Deletion of a DNA polymerase beta gene segment in T cells using cell type-specific gene targeting. Science, 1994. 265(5168): p. 103-6. 135. Lee, G. and I. Saito, Role of nucleotide sequences of loxP spacer region in Cre-mediated recombination. Gene, 1998. 216(1): p. 55-65. 136. Kolb, A.F., Selection-marker-free modification of the murine beta-casein gene using a lox2272 [correction of lox2722] site. Anal Biochem, 2001. 290(2): p. 260-71. 137. Nolden, L., et al., Site-specific recombination in human embryonic stem cells induced by cell-permeant Cre recombinase. Nat Methods, 2006. 3(6): p. 4617. 138. Du, Z.W., et al., Cre recombination-mediated cassette exchange for building versatile transgenic human embryonic stem cells lines. Stem Cells, 2009. 27(5): p. 1032-41. 139. Sorrell, D.A., et al., Recombinase mediated cassette exchange into genomic targets using an adenovirus vector. Nucleic Acids Res, 2010. 38(11): p. e123. 140. Gropp, M., et al., Stable genetic modification of human embryonic stem cells by lentiviral vectors. Mol Ther, 2003. 7(2): p. 281-7. 141. Ma, Y., et al., High-level sustained transgene expression in human embryonic stem cells using lentiviral vectors. Stem Cells, 2003. 21(1): p. 111-7. 142. Smith-Arica, J.R., et al., Infection efficiency of human and mouse embryonic stem cells using adenoviral and adeno-associated viral vectors. Cloning Stem Cells, 2003. 5(1): p. 51-62. 143. Cao, F., et al., Comparison of gene-transfer efficiency in human embryonic stem cells. Mol Imaging Biol. 12(1): p. 15-24. 105 144. Du, J., et al., The combined use of viral transcriptional and posttranscriptional regulatory elements to improve baculovirus-mediated transient gene expression in human embryonic stem cells. J Biosci Bioeng, 2010. 109(1): p. 1-8. 145. Manno, C.S., et al., Successful transduction of liver in hemophilia by AAVFactor IX and limitations imposed by the host immune response. Nat Med, 2006. 12(3): p. 342-7. 146. Mingozzi, F., et al., AAV-1-mediated gene transfer to skeletal muscle in humans results in dose-dependent activation of capsid-specific T cells. Blood, 2009. 114(10): p. 2077-86. 147. Raper, S.E., et al., Fatal systemic inflammatory response syndrome in a ornithine transcarbamylase deficient patient following adenoviral gene transfer. Mol Genet Metab, 2003. 80(1-2): p. 148-58. 148. Ho, Y.C., et al., Highly efficient baculovirus-mediated gene transfer into rat chondrocytes. Biotechnol Bioeng, 2004. 88(5): p. 643-51. 149. Heimpel, A.M. and L.K. Buchanan, Human feeding tests using a nuclearpolyhedrosis virus of Heliothis zea. J Invertebr Pathol, 1967. 9(1): p. 55-7. 150. Evans, M.J. and M.H. Kaufman, Establishment in culture of pluripotential cells from mouse embryos. Nature, 1981. 292(5819): p. 154-6. 151. Martin, G.R., Isolation of a pluripotent cell line from early mouse embryos cultured in medium conditioned by teratocarcinoma stem cells. Proc Natl Acad Sci U S A, 1981. 78(12): p. 7634-8. 152. Thomson, J.A., et al., Embryonic stem cell lines derived from human blastocysts. Science, 1998. 282(5391): p. 1145-7. 153. Takahashi, K., et al., Induction of pluripotent stem cells from adult human fibroblasts by defined factors. Cell, 2007. 131(5): p. 861-72. 106 154. Takahashi, K. and S. Yamanaka, Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors. Cell, 2006. 126(4): p. 663-76. 155. Yu, J., et al., Induced pluripotent stem cell lines derived from human somatic cells. Science, 2007. 318(5858): p. 1917-20. 156. Wernig, M., et al., Neurons derived from reprogrammed fibroblasts functionally integrate into the fetal brain and improve symptoms of rats with Parkinson's disease. Proc Natl Acad Sci U S A, 2008. 105(15): p. 5856-61. 157. Hanna, J., et al., Treatment of sickle cell anemia mouse model with iPS cells generated from autologous skin. Science, 2007. 318(5858): p. 1920-3. 158. Nakagawa, M., et al., Generation of induced pluripotent stem cells without Myc from mouse and human fibroblasts. Nat Biotechnol, 2008. 26(1): p. 1016. 159. Zhou, W. and C.R. Freed, Adenoviral gene delivery can reprogram human fibroblasts to induced pluripotent stem cells. Stem Cells, 2009. 27(11): p. 2667-74. 160. Okita, K., et al., Generation of mouse induced pluripotent stem cells without viral vectors. Science, 2008. 322(5903): p. 949-53. 161. Woltjen, K., et al., piggyBac transposition reprograms fibroblasts to induced pluripotent stem cells. Nature, 2009. 458(7239): p. 766-70. 162. Judson, R.L., et al., Embryonic stem cell-specific microRNAs promote induced pluripotency. Nat Biotechnol, 2009. 27(5): p. 459-61. 163. Zhou, H., et al., Generation of induced pluripotent stem cells using recombinant proteins. Cell Stem Cell, 2009. 4(5): p. 381-4. 164. Kim, D., et al., Generation of human induced pluripotent stem cells by direct delivery of reprogramming proteins. Cell Stem Cell, 2009. 4(6): p. 472-6. 107 165. Warren, L., et al., Highly efficient reprogramming to pluripotency and directed differentiation of human cells with synthetic modified mRNA. Cell Stem Cell, 2010. 7(5): p. 618-30. 166. Huangfu, D., et al., Induction of pluripotent stem cells by defined factors is greatly improved by small-molecule compounds. Nat Biotechnol, 2008. 26(7): p. 795-7. 167. Kim, K., et al., Epigenetic memory in induced pluripotent stem cells. Nature, 2010. 467(7313): p. 285-90. 168. Huser, D., et al., Integration preferences of wildtype AAV-2 for consensus rep-binding sites at numerous loci in the human genome. PLoS Pathog, 2010. 6(7): p. e1000985. 108 Appendix List of primers used in current study loxP mutation to generate lox2722 Forward: CCGGAACCCTTAATATAACTTCGTATAAAGTATCCTATACGAAGT TATTAG Reverse: CTAATAACTTCGTATAGGATACTTTATACGAAGTTATATTAAGGGT TCCGG Left homologous arm Forward: TGCTCTACTTAACCCAAAGAAAGTG Reverse: TAGAAAGGTGAAGAGCCAAAGTTAG Right homologous arm Forward: TTTACCTGTGAGATAAGGCCAGTAG Reverse: AAAGAAAGACAATCCTAGGAAGCAG Homologous recombination (neo) detection Forward: ACTTCCTGACTAGGGGAGGAGTAGAAGGTG Reverse: GTTGGTAGGGGTTTGAGTTCTCATCCTGTG Homologous recombination (EGFP) detection Forward: CTCAAGCCTCAGACAGTGGTTCAAAGTTTT Reverse: GTTGGTAGGGGTTTGAGTTCTCATCCTGTG Homologous recombination (EGFP) detection (BV-ZFN technology) Forward: GCGACGTAAACGGCCACAAGTTCAG Reverse: GGAACGGGGCTCAGTCTG Site-specific integration (EGFP) detection Forward: AAAGAAAGACAATCCTAGGAAGCAGGGTCA Reverse: CTCAAGCCTCAGACAGTGGTTCAAAGTTTT 109 Site-specific integration (HSVtk) detection Forward: AAAGAAAGACAATCCTAGGAAGCAGGGTCA Reverse: CACGTCTTTATCCTGGATTACGACCAATCG Probe for homologous recombination (neo) detection Forward: AGGTGGGCTCTGGTGTGCTGTGTGT Reverse: CACTCCCCATTTCAACCAAAGAGGG Probe for site-specific integration (EGFP) detection Forward: TTACTTGTACAGCTCGTCCATGCCG Reverse: TACGGCAAGCTGACCCTGAAGTTCA Actin detection Forward: CAGCAAGCAGGAGTATGACG Reverse: AGTGGGGTGGCTTTTAGGAT AFP detection Forward: AGAACCTGTCACAAGCTGTG Reverse: GACAGCAAGCTGAGGATGTC Brachyury detection Forward: CAACCACCGCTGGAAGTAC Reverse: CCGCTATGAACTGGGTCTC Nanog detection Forward: GCGCGGTCTTGGCTCACTGC Reverse: GCCTCCCAATCCCAAACAATACGA Nestin detection Forward: GAAACAGCCATAGAGGGCAAA Reverse: TGGTTTTCCAGAGTCTTCAGTGA 110 NeuroD detection Forward: GAGACTATCACTGCTCAGGA Reverse: GATAAGCCCTTGCAAAGCGT Oct-3/4 detection Forward: CTTGCTGCAGAAGTGGGTGGAGGAA Reverse: CTGCAGTGTGGGTTTCGGGCA Pax6 detection Forward: AACAGACACAGCCCTCACAAACA Reverse: CGGGAACTTGAACTGGAACTGAC SOX1 detection Forward: CAATGCGGGGAGGAGAAGTC Reverse: CTCCTCTGGACCAAACTGTG SOX2 detection Forward: TGGACAGTTACGCGCACAT Reverse: CGAGTAGGACATGCTGTAGGT EGFP detection Forward: AGCCGCTACCCCGACCACAT Reverse: CGTCGCCGATGGGGGTGTTC HSVtk detection Forward: CACGTTATACAGGTCGCCGT Reverse: TACTTGCCAATACGGTGCGG 111 [...]... site-1 locus (AAVS1) is regarded as a safe harbour for the integration of therapeutic genes and also as a transcription-competent environment [52-55] By conducting research on AAV2 technology, ZFNs and TALENs, efforts have been made to overcome insertional mutagenesis and transgene silencing When utilising AAV2 technology, AAVS1- directed transgene integration has been achieved in hESCs albeit at a very... clearly determined, its protein products are said to be involved in regulating the actin cytoskeleton through a myosin phosphatase activity [47] Studies have revealed that the AAVS1 also serves as a specific integration site for AAV serotype 2 (AAV2), a human parvovirus that contains a single-stranded linear DNA genome [48, 49] Unable to replicate in the absence of a helper virus, AAV2 enters a latent... LMO2 was attributed to the long terminal repeats (LTRs) found in both retroviral and lentiviral vectors as they contain enhancers and promoters capable of activating proto-oncogenes The activation of proto-oncogenes as a result of retroviral and lentiviral vector integration has also been reported in patients treated for X-CGD and β-thalassaemia-based anaemia respectively [32, 35] 10 1.3.2 Transgene. .. proteins as a result of acetylation, methylation, phosphorylation and ubiquitination Histones play a pivotal role in the packaging and structural organization of eukaryotic DNA and due to such modifications, genomic regions that were euchromatin (loosely packed – easy to transcribe) are transformed into heterochromatin (tightly packed – difficult to transcribe) Upon the death of a patient who was treated for. .. translational repression mechanism [6] Short hairpin RNAs (shRNAs), a type of RNA molecule that mimics the mechanism of miRNAs can also induce post-transcriptional silencing Studies have revealed that miR-2 6a consists of anti-proliferation and apoptotic properties and is thus down-regulated in certain tumors [7] Therefore, by systemic administration of an adeno-associated viral (AAV) vector expressing miR-2 6a, ... compared with retroviral and lentiviral vectors, adenoviral and AAV vectors hardly undergo random integration as they are almost entirely episomal in nature The same holds true for plasmids delivered by non-viral systems In relatively quiescent tissues (liver, brain, heart, muscle) episomal existence has no disadvantage In rapidly dividing cells (HPCs) however, these vectors are eliminated, and as a. .. resulting baculovirus- AAV hybrid system induced persistent transgene expression [61] The occurrence of AAVS1- directed integration however was not confirmed in this study A plasmid transfection-based AAV2 technology was later successful in achieving persistent transgene expression in hESCs, although the AAVS1- directed integration efficiency was as low as 4.16% [45] 1.4.3 Zinc-Finger Nucleases ZFNs are significant... namely short interfering RNAs (siRNAs) and micro RNAs (miRNAs) siRNAs and miRNAs defer from one another in that the former molecule’s sequence is directly complementary to that of its target mRNA and thus induces silencing via a cleavage-dependent pathway miRNAs however contain mismatches in their sequences and thus target a range of mRNAs where they induce silencing by either a cleavage or translational... DNA that can be delivered Transient gene expression and the ability to stimulate any pre-existing immunity are the major disadvantages associated with AAV vectors 9 1.3 Challenges Associated with Gene Therapy It can be inferred from the previous section that a 100% perfect gene delivery approach is currently not in existence and whilst some approaches consist of unique flaws, a majority of them are associated... the treatment of osteosarcoma lung metastases [28] Although considered less cytotoxic and immunogenic than lipoplexes, cationic polymers too form aggregates with serum thus hindering their use in therapeutic applications Inorganic nano-particles are prepared typically from metals or inorganic salts and can therefore be coated with other substances to facilitate gene uptake Like cationic lipids and polymers, . A BACULOVIRUS- CRE/ LOXP HYBRID SYSTEM FOR AAVS1 LOCUS- DIRECTED TRANSGENE DELIVERY CHRISHAN J. A. RAMACHANDRA NATIONAL UNIVERSITY OF SINGAPORE 2011 A Baculovirus- Cre/ loxP. made long days in the lab a pleasant experience. I thank my fellow lab mates Timothy Kwang, Lam Dang Hoang and Yovita Ida Purwanti for all the fun and laughter we have had over the years. My. significantly high transgene integration efficiencies were achieved at the AAVS1, allowing for the generation of transgenic hESCs and HeLa cells. ix To ensure that the AAVS1- integrated transgene