Homoeostatic regulation of cytokines to retard liver fibrosis 3

CHAPTER   59   3. HSC-TARGETED DELIVERY OF HGF TRANSGENE ADMINISTERED VIA BILE DUCT INFUSION ENHANCES ITS LOCALIZATION AT FIBROTIC FOCI & AMELIORATES DMN-INDUCED LIVER FIBROSIS 3.1 AIMS & OBJECTIVES The key event of fibrosis progression is the process of activation of quiescent HSCs and portal fibroblasts into activated myofibroblasts, which occurs due to changes in soluble factors, ECM proteins and mechanical stiffness (27,147). Activated myofibroblasts secrete and deposit copious amounts of ECM proteins especially collagens which accumulate to form the fibrous tissue (33). Fibrotic foci are sites of active fibrosis within the affected organ (148) with an increased number of activated myofibroblasts that create a concentrated centre of pro-fibrotic cytokines such as TGF-β1 and accumulation of ECM proteins such as Collagen I. HSCs are one of the major sources of myofibroblasts and abundant at fibrotic foci. Recent therapeutics developed for liver fibrosis have targeted HSCs, providing enhanced delivery to the fibrotic foci, and they have largely focused on decreasing/controlling the high levels of TGF-β1 signaling or collagen production (106,149) but they not show effective hepatic regeneration. Anti-fibrotic therapies lacking cell specificity fail to target the fibrotic foci, and lead to adverse effects in healthy non-specific cells surrounding the foci, resulting in changes in their viability, differentiated state and metabolic function of the liver (150). Recent interest in the development of therapeutics targeted to fibrotic foci aims to reduce the doses of the therapeutics, the need for long-term therapeutic expression or engraftment efficiency. More importantly, targeted therapies can reduce the adverse side effects that might arise from effects of the non-specific uptake of the therapeutics by healthy cells   60   (151,152). This led us to investigate targeted HGF-based therapies, both to control the expansion of the fibrotic foci and to ameliorate the hepatocellular damage. HGF (66) has demonstrated anti-fibrotic effects in recent liver fibrosis studies via suppression of TGF-β1 and collagen III expression levels (73,78). Anti-fibrotic therapies with hepatocyte growth factor (79) have not been specifically targeted to the fibrotic foci, and we propose that doing so might increase their therapeutic potential. HSCs are one of the major sources of HGF in the liver, under normal and regenerative conditions (153), but sustained activation of HSCs during fibrosis significantly decreases HGF production and inhibits hepatocyte regeneration (154). Although activated HSCs have lower HGF expression, HSCs have higher metabolic activity and are actively proliferating in the fibrogenic state. Therefore we investigated whether targeting the HGF gene to HSCs will yield selective enrichment of the therapeutic in the fibrotic foci. We hypothesized that HSC-targeted delivery of HGF would decrease collagen accumulation and the number of activated HSCs at fibrotic foci and surrounding regions, compared with untargeted HGF therapy. We have used the retinol-storing function of HSCs as a mechanism for targeted delivery to HSC, as HSCs are the only cells in the liver with retinol-storing capability and with high expression levels of retinol binding proteins (106,152). We cloned the rat HGF gene into a pDsRed2 plasmid DNA vector, and encapsulated the gene construct in Vitamin A-coupled liposomes for specific targeting of HSCs. The antifibrotic potential of the Vitamin A-Liposome-HGF particles was tested in HSC-T6 (rat hepatic stellate cell line) monocultures, in co-cultures of HSC-T6 and hepatocytes in vitro, and in DMN-induced fibrotic rat livers. Since microvasculature disturbances in the fibrotic liver and excessive basement membrane deposition lead to constricted hepatic sinusoids and poor hepatic microcirculation and diffusion (155,156), we   61   delivered all transgene complexes through retrograde intrabiliary infusion, in order to increase the biodistribution to the fibrotic liver. 3.2 MATERIALS & METHODS 3.2.1 In Vitro Cultures For monoculture studies, HSC-T6 cells were seeded at 2x105 cells per 35mm collagen-coated dish and cultured for days in DMEM (Sigma) with 10% FBS to allow for activation. On the fourth day, the HSC-T6 monocultures were transfected with different liposome/DNA complexes. Co-cultures were established with hepatocytes and HSC-T6 cells at the ratio of 1:10 (i.e., for every hepatocyte, 10 hepatic stellate cells are seeded). Hepatic stellate cells were seeded days prior to the co-culture in DMEM with 10% FBS at the density of 2x105 cells per 35mm collagencoated dish to induce the activation process. Three days later, primary rat hepatocytes in an appropriate number according to the above ratio, were seeded in Williams E medium with serum (Primary rat hepatocytes were isolated from male Wistar rats by a 2-step collagenase perfusion method as described previously (133); the isolation procedure was approved by the IACUC of National University of Singapore). The monocultures and co-cultures were transfected with Vitamin A-coupled liposomes (VAL)/ Vitamin A-coupled liposomes with pDsRed2 alone (VALD)/ Vitamin Acoupled liposomes with pDsRed2-HGF (VALH) particles with 3µg plasmid DNA. Media was changed to DMEM with serum hrs after transfection. Cell culture supernatants were collected 24 hrs after treatment and the cells were lysed for RNA isolation.   62   3.2.2 Measurement Of Hepatocyte Proliferation The isolated hepatocytes were seeded at 2x105 cells per 35mm collagen-coated dish (IWAKI) in Williams E (Sigma) with 10% fetal bovine serum (FBS, Sigma). After hrs, media was changed to Williams E without serum. After overnight serum starvation, the cells were treated with filtered conditioned media from transfected HSC-T6 monocultures. Cells from the collagen-coated dishes were collected by treatment with 0.1% SDS and samples were lysed and centrifuged at 11,000g for 10 min. The supernatant was diluted 10x and the DNA quantity was assayed by incubation with equal amount of picogreen dsDNA dye for min. The fluorescence was measured at 520nm and a standard curve was used to calculate the number of cells from the observed DNA quantity. 3.2.3 Transgene Validation By Transfection In HEK-293T Cells HEK-293T cells were seeded at 5x105 cells per 35mm culture dish in DMEM with serum. One day later transfection was carried out with 1µg plasmid DNA using Lipofectamine LTX reagent according to the manufacturer’s protocol. Media was changed hrs after transfection and the samples were collected 24 hrs after transfection. Transfection efficiency as measured by the DsRed fluorescence was found to be nearly 8% in transfected cell cultures. 3.2.4 Transgene Construction And Encapsulation In Vitamin A-Coupled Liposomes. Rat mRNA was isolated from freshly isolated hepatocytes and the mRNA was converted to cDNA using a HGF gene specific primer (HGF reverse primer in Table 4). The HGF gene was isolated using highly specific primers (Table 4) in a PCR reaction using Phusion DNA polymerase at primer melting temperature 62°C. The PCR product was run on a 0.8% agarose gel. The band observed near the 2000bp   63   mark was extracted; purified, expanded using pJET1.2 cloning vector (Fermentas) and TOP10 cells (Invitrogen). The purified plasmid sequence was verified using HGF specific sequencing primers designed in-house using Oligo7 software (See Table 4;sequencing primers). Table 4. List of primer sequences used for HGF gene isolation and PCR Gene Name Sequencing primers HGF 823 Forward HGF 218 Reverse HGF 1614 Reverse β-actin Forward Reverse GAPDH Forward Reverse HGF Forward Reverse Collagen IV Forward Reverse Primer sequence 5' CCGAGGCCATGGTGCTAC 3' 5’ TCACTTTTTTGGTTTTAATCTTCAC 3’ 5' AAGAACCCAACTTTCCTTTATCAATG 3' 5’ ACCCACACTGTGCCCATCTA 3’ 5’ GCCACAGGATTCCATACCCA 3’ 5’ AGACAGCCGCATCTTCTTGT 3’ 5’ TGATGGCAACAATGTCCACT 3’ 5’ AGGTACCGAACTGCAAGCATG 3’ 5’ GATCCTATGGCTATTACAACTTGTATGTC 3’ 5’ GCAGGTGTGCGGTTTGTGAAG 5’ AGCTCCCCTGCCTTCAAGGTG 3’ 3’ The HGF gene and DsRed2-C1 (“DsRed2”) vector was restriction digested using KpnI and BamHI restriction enzymes (NEBL) and ligated using T4 DNA ligase (Promega) cloned into TOP10 competent cells for expansion. Again, the gene sequence was confirmed against the rat HGF gene sequence and this purified DsRed2-HGF vector was used for further experiments. Liposomes (Lipotrust SR™, Hokkaido System Sciences) were coated with Vitamin A (Retinol, Sigma) as in (106), and purified by dialysis with MWCO 500 membranes (Spectra/Por) for days. The VitaminA-coupled liposomes were lyophilized using FreeZone from Labconco. The   64   plasmid DNA was encapsulated with the liposomes at the N:P ratio of 1:11.5. The plasmid DNA:Liposome particle size was determined by particle size analyzer, as shown in Fig. 21. Apart from the particle size of the complexes, the surface charge also contributes equally to their effective uptake by the liver. Neutrally charged particles have the lowest uptake (157) whereas positive or negatively charged particles have a better uptake efficiency, Therefore, we analyzed the surface charge of these coated liposome-DNA complexes and found the zeta potential to be -37.1 ± 1.24 mV for VALH particles, -37.97 ± 0.33 mV for VALD particles as opposed to uncoated liposome-HGF complex, which had a surface charge of -29.33 ± 3.13. As negatively charged particles is known to have better ability to be taken up the liver, (158) we believed that these particles could be easily taken up by the liver if directed Liposome Diameter (nm) appropriately. 700 600 500 400 300 200 100 VALD VALH Figure 21: Liposome/DNA complex sizes. Particle size measurement of particles dissolved in deionized water as measured in particle size analyzer. n=3. 3.2.5 Protein Measurements By Western Blot For Western blots, liver tissue sections were homogenized; protein levels quantified and equal amounts of protein samples were separated on a 10% SDS PAGE in 1x Tris Glycine, and transferred onto a 0.22µm nitrocellulose membrane overnight in 1x Trisbuffered saline (TBS) with 10% methanol. The membrane was then treated with   65   blocking buffer (2% skimmed milk in 1x TBS with 0.01% Tween 20 (1x TBST)) for hour. Later the membrane was washed times in 1x TBST; treated with mouse αSMA antibody (Sigma; 1:200), mouse β-actin antibody (Sigma; 1:40000), or goat HGF antibody (Santacruz; 1:100) in 1x TBST for 2hrs; washed times in 1x TBST and treated with goat anti-mouse IgG-HRP (Santacruz; 1:10000 in blocking buffer) or mouse anti-goat antibody (Santacruz; 1:10000 in blocking buffer) for hour. The membrane was developed using SuperSignal West Pico Chemiluminescent solution (Thermo Scientific). 3.2.6 DMN-Induced Liver Disease Male Wistar rats (250g) were administered 1% N-nitroso dimethylamine (10mg/kg; Wako) intraperitoneally for consecutive days each week for weeks, to establish liver fibrosis. Fresh liver tissue samples were collected and frozen immediately in liquid nitrogen for further RNA and protein analysis. Simultaneously, liver tissue sections were fixed in 10% formaldehyde and processed for histopathology. Blood was collected from the heart by cardiac puncture and the separated blood serum was stored at -20°C till further processing. 3.2.7 Retrograde Intrabiliary Infusion. Fibrotic rats with DMN administration for consecutive weeks and not administered with DMN for the next seven days were anaesthetized with Ketamine/Xylazine before the procedure. The common bile duct was canulated and the area sutured with 5-o-silk sutures. The protocol for retrograde intrabiliary infusion was adapted from our previous work (159). Liposome with pDsRed2-HGF (Lip-HGF) or VALD or VALH (200µg plasmid DNA) were administered at a constant flow rate of 0.2ml/min with a syringe pump using a 32G needle (Hamilton) fitted through Ext-12 (DiLab) as shown in Figs. 29 A & 29B. After retrograde infusion, the bile duct was ligated for 10mins to   66   prevent immediate backflow. The abdominal wall of the operated rats was sutured with 3-o-prolene sutures and the rats were administered baytril and buprenorphine for days after surgery. All animal procedures were carried out under the premises of the IACUC protocol approved by the Biological Resource Centre, Biopolis. 3.2.8 Gene Expression Analysis - RT-PCR mRNA was isolated from the cells/homogenized tissue using RNeasy mini kit (Qiagen), 1µg of mRNA from each sample set was converted to cDNA (Invitrogen, Superscript Reverse Transcriptase III) and real-time PCR reaction (Roche, Sybr Green Master mix) was carried out for HGF, α-SMA, Collagen I (Col I), Col IV, TGF-β1, TSP-1, PAI-1, TIMP-1, β-actin and GAPDH (primer sequences listed in Table in chapter and Table 4). The fold change in gene expression values were determined by the Del-Del CT relative quantitation method (138); the target CT values were normalized to the endogenous reference β-actin (for in vitro samples) and GAPDH (for in vivo samples), 3.2.9 Active TGF-β1 Measurement For cell culture supernatants, equal volumes of sample were assayed for active TGFβ1 ELISA (Promega TGF-β1 Emax Immunoassay (137)); according to the manufacturer’s protocol. For in vivo blood samples, protein levels were quantified using the Bradford assay (Biorad) and equal amounts were assayed for active TGF-β1 levels. 3.2.10 Liver Protein Levels Liver proteins such as alanine transaminase, aspartate aminotransferase, lactate dehydrogenase, and albumin in the blood serum were quantified with Vitros DT kits using Johnson & Johnson DT 60 analyzer.   67   3.2.11 Collagen Imaging – Non Linear Microscopy And Image Acquisition Deparaffinized, unstained liver tissue sections of 50µm thickness were imaged with second harmonic generation microscopy (SHG) using a modified Carl Zeiss LSM 510 system as described previously (160). Data was acquired using both Two photon excited fluorescence and SHG imaging modes. A total of four images (3x3 tile scans, 3072x3072 pixels and 3.2µs well time) were collected for each tissue specimen, and two specimens were extracted from each animal. The SHG images were analyzed using the direct segmentation method (Gaussian mixture model). The method is based on the assumption that the distribution of intensities is a mixture of several Gaussian distributions, each corresponding to a separate tissue class. In an SHG image, the intensity of pixels is modeled as the mixture of two Gaussian distributions, one representing collagen area with strong SHG signals and the other representing the background. 3.2.12 Immunohistochemistry Liver tissue sections of 5µm thickness were stained with Masson’s Trichrome stain to assess collagen deposition. The next serial section was stained with Haematoxylin & Eosin (H&E) to determine necrosis levels and Knodell score. 3.2.13 Immunofluorescence Serial sections from the liver tissue were deparaffinized with Xylene and ethanol gradient washes for 3mins each. Then the sections were permeabilized, treated with blocking buffer followed by treatments with primary antibodies for α-SMA (Sigma); TGF-β1 (Santacruz); Collagen I (Millipore), HGFα (Santacruz); DsRed2 (Santacruz); platelet endothelial cell adhesion molecule-1, PECAM-1 (Abcam); von Willebrand Factor, vWF (Santacruz); hyaluronic acid receptor, CD44 (Abcam). Later, the tissue sections were incubated with appropriate secondary antibodies (Santacruz) for 2hrs.   68   B C A Figure 28: Defenestration of LSECs and increased expression of capillarization markers in the hepatic sinusoids with DMN induction. DMN-induced fibrosis caused severe defenestration as seen in SEM images of hepatic sinusoids (A) and increase in the protein levels of capillarization markers in sinusoidal endothelial cells as observed in the confocal micrographs of the liver tissue sections (B & C); * p < 0.05 compared to week control rats. Scale bar: 100µm SEC defenestration was accompanied by increased expression of capillarization markers PECAM-1, vWF and CD44 (Figs. 28B & 28C). The extensive DMN-induced   78   perturbations of liver microvasculature would greatly reduce the exchange of substances between the blood and the space of Disse. As reduced access to the space of Disse might impair the efficacy portal vein infusion of therapeutics (164), we chose to circumvent the blocked sinusoids for our experiments, and used retrograde intrabiliary infusion to deliver the liposomes. 3.3.5 Regression Of DMN-Induced Liver Fibrosis After VALH Treatment DMN-induced fibrotic rats, at the beginning of the 4th week, were administered a single 200µg dose of either liposome-pDsRed-HGF (Lip-HGF), VALD or VALH particles through retrograde intrabiliary infusion at a constant rate of 0.2 ml/min (Fig. 29) and samples were collected and days after therapeutic administration. Figure 29: Retrograde intrabiliary infusion of Liposome/DNA complexes into DMN-induced fibrotic rats. Anestheized rats were administered liposome/DNA complexes at a constant flow rate of 0.2ml/min using a syringe pump. 3.3.6 Localized Delivery Of HGF Transgene To Areas Expressing α-SMA To investigate whether the HGF transgene had been delivered selectively to fibrotic foci, we observed the relative localization of DsRed2/HGF with either α-SMA or   79   collagen, by double immunostaining. We found that as early as 24hrs, the DsRed2HGF protein was strongly co-localized with α-SMA in fibrotic foci (Fig. 30A & 30B). The transgene was also increased in collagen-rich areas (Fig. 30C). A B   80   C Figure 30: Increased co-localization of DsRed/HGF protein within the fibrotic foci. 24 hours after VALH treatment, the expression of the HGF (green signal) gene significantly increased within the myofibroblasts positive for α-SMA (red signal) demonstrating specific targeting of the activated HSCs and the fibrotic foci (A & B) Scale bar: 30 µm. Increased expression of DsRed2 (red signal) protein at the Collagen I (green signal)-rich fibrotic foci 24hours after VALH treatment (C). Scale bar: 100 µm *** p < 0.001 compared to Lip-HGF, ### p < 0.001 compared to VALD Although the same plasma DNA dose of HGF was given to each therapeutic cohort, the total tissue RNA levels of HGF were significantly higher in the VALH-treated rats compared to Lip-HGF treated rats, perhaps because the cells targeted by the Vitamin A-liposomes are metabolically active and may be more responsive to gene therapy (Fig. 31).   81   Figure 31: Increased expression of HGF gene when targeted specifically to HSCs via Vitamin A-coupled liposomes (VALH). Increased gene expression of HGF in VALH-treated rat liver but not statistically significant compared to Lip-HGF treatment (E). # p < 0.01 compared to VALD. 3.3.7 VALH Treatment Caused A Decline In Serum Markers Of Fibrosis To assess the changes in systemic liver disease markers, we tested blood serum proteins ALT, aspartate aminotransferase (AST) and lactate dehydrogenase (LDH). AST and LDH showed a significant decline consistently with VALH treatment, compared with untargeted Lip-HGF treated rats and VALD-treated rats (Table 5). ALT showed spontaneous regression in all cohorts. The levels of hyaluronic acid (HA), a marker for hepatic endothelial cell damage, showed significant improvement with both targeted and untargeted delivery of HGF. Table 5: Disease-related liver proteins in the blood serum CTRL ALT (U/L) DMN Lip-HGF 86.67 ± 51.5 ± 12.41 14.80 247.33 ± 167.75 ± 44.33 ± 1.33 149.67 ± AST (U/L) LDH   VALD VALH 53.5 ± 4.09 46.67 ± 3.67 123.5 ± 182 ± 5.93 14.85 19.36 4.48 148 ± 1.63 143 ± 8.96 291.5 ± 136.75 ± 14.43*,# 131.33 ± 82   (kU/L) HA 21.88 10.82 46.45 ± 27.61 ± 39.86 ± 29.58 5.73 16.57 26.2 ± 8.95 (ng/ml) 13.87** 18.54 ± 5.55# * - p < 0.05 compared to Lip-HGF, ** - p < 0.01 compared to Lip-HGF, # - p < 0.05 compared to VALD The blood serum levels of TGF-β, a fibrotic cytokine, showed a steady decline with VALH treatment in DMN-induced rat livers (Fig. 32; p = 0.08 between VALH and Lip-HGF groups). Figure 32: Levels of pro-fibrotic cytokine TGF-β1 after treatment with VALH particles. Decline in active TGF-β1 levels in the blood serum of rats days after treatment. n=3 3.3.8 VALH Treatment Improved Structural Markers Of Fibrosis To observe whether VALH therapy improved the architectural disturbances of DMNinduced fibrosis, we observed collagen deposition levels by Masson’s trichrome staining. The necrosis levels were determined from H&E stained liver tissue sections. Seven days after treatment, VALH-treated rat livers, Fig. 33A showed reduced necrosis levels, both in the interior portions of the liver as well as at the liver capsule as seen in Masson Trichrome staining (Fig. 33B & 33C), but the reduction was not statistically significant.   83   A B Figure 33: VALH-treated rat livers showing signs of fibrosis regression and decreased levels of necrosis. Seven days after treatment, DMN-induced fibrotic rats showed a decline in the necrosis levels (A) and deposited collagen levels both at the portal and capsular regions with VALH treatment (B). Scale bar: 100 µm VALH-treated rat livers showed reduced collagen levels, both at the portal regions as well as the liver capsule, compared with VALD treated, but the differences were not statistically significant, most likely because collagen levels regressed spontaneously, regardless of therapy, after cessation of DMN treatment (Fig. 34).   84   Figure 34: Decreased collagen levels after VALH treatment. As observed by SHG imaging, collagen (green; SHG); hepatic parenchyma (red; TPEF). Scale bar: upper panel (100 µm), lower panel (50 µm) In parallel with the HA marker improvements, both cohorts with HGF transgene therapy showed normal fenestration in SECs (Fig. 35), regardless of liposomal targeting, while VALD and DMN cohorts showed a continued state of defenestration and microvascular disruption. Figure 35: Improved sinusoidal fenestrations after HGF treatment. Reappearance of fenestration in both the HGF treated groups; Lip-HGF and HGF compared to VALD treatment. Scale bar: µm 3.3.9 Enhanced Spatial Localization Of HGF Gene Within The Fibrotic Foci Causes Decline In HSC-Specific Markers Implicated In Fibrogenesis After testing structural components and blood serum components, we next investigated whether the VALH particles reached the HSC-rich fibrotic foci and decreased the levels of disease markers. In addition to the above-mentioned markers of disease, the VALH treatment effectively reduced the levels of α-SMA, even more than untargeted Lip-HGF treatment (Fig. 36) at the fibrotic foci both at the interior portal region as well as the capsular region. In order to investigate whether this was due to the specific targeting towards HSCs, we studied the expression levels of DsRed2/HGF near Collagen I/ α-SMA-high fibrotic foci at day after treatment with higher HGF expression accompanied by a reduction in α-SMA expression in the fibrotic foci of the VALH-treated rats (Fig. 36B & 36C).   85   A   86   Figure 36: Decreased activated HSCs (α-SMA levels) and increased HGF expression with targeted delivery. Images of immunostained liver tissue sections under confocal microscopy (A). Scale bar: left panels, 100 µm; right panels, 20 µm. Quantification of fluorescence intensity of HGF (B; green signal) and α-SMA (C; red signal) levels. * p < 0.05 compared to Lip-HGF, # p < 0.05, ## p < 0.01 compared to VALD. Fibrotic markers such as TGF-β1 and Collagen I decreased significantly in the fibrotic foci of the VALH-treated rats (Figs. 37 & 38). A CTRL DMN Lip-HGF VALD VALH Collagen I HGF Collagen I levels at the fibrotic foci (Quantification) B 250 *** 200 ### 150 100 50 CTRL DMN Lip-HGF VALD VALH Figure 37: Decrease in the Collagen I levels after VALH treatment. Intensity quantified from portal and capsular regions of immunostained liver tissue sections. Images of immunostained liver tissue sections under confocal microscopy (A; HGF: red signal) Scale bar: 30 µm. Quantification of fluorescence intensity of   87   Collagen I (B; green signal) levels. *** p < 0.001 compared to Lip-HGF, 0.001 compared to VALD. A CTRL DMN Lip-HGF VALD ### p < VALH TGF-β1 TGF-b1 HGF ** 200 TGF- β levels (Image Quantification) B ## 150 100 50 CTRL DMN Lip-HGF VALD VALH Figure 38: Decrease in the TGF-β1 levels after VALH treatment. Intensity quantified from portal and capsular regions of immunostained liver tissue sections. Images of immunostained liver tissue sections under confocal microscopy (A; HGF: red signal) Scale bar: 30 µm. Quantification of fluorescence intensity of TGF-β1 (B; yellow signal) levels. ** p < 0.01 compared to Lip-HGF, ## p < 0.01 compared to VALD Thus VALH treatment effectively targets the fibrotic foci and regress liver fibrosis by controlling the levels of myofibroblast activation. 3.4 DISCUSSION During fibrosis progression, the liver shows varied regional susceptibility to injury and toxins, due to architectural complexities, protein gradients, and oxygen levels (165-167). Indeed different liver diseases have different spatial distributions of fibrosis and different architectural patterns (27). Regardless of different etiologies of   88   liver fibrosis, HSCs become activated, proliferative, and migrate to fibrotic regions and become highly abundant in the fibrotic foci. Targeting HSCs is therefore a strategy to deliver therapeutics specifically to fibrotic foci thereby enhancing the local availability of the therapeutic at the disease sites (149,151,152,168). Localized targeting may be particularly important in liver fibrosis because of low diffusion to the fibrotic foci due to high collagen deposition and poor microcirculation (156). We used vitamin A-coupled liposomes to specifically target HSCs (106), and found that specific targeting increased localized delivery of the HGF transgene at the fibrotic foci (Fig. 30). In addition to their abundance at fibrotic foci and targeting advantages, activated HSCs exhibit prodigious metabolic activity and protein production. Although HSCs have been used as targets for treating liver fibrosis, the immense cellular activity of fibrogenic HSCs has not yet been harnessed to facilitate disease resolution via hepatic regeneration. Previous therapies have targeted HSCs to block their fibrogenic functions, such as matrix production (106,169,170); but we have targeted HSCs to induce the production of HGF and hepatic regeneration. HGF-based therapies and hepatocyte regeneration has been pursued in previous therapeutic studies (73,78), to counteract the loss in the regenerative capability of hepatocytes in a fibrotic microenvironment (73,78,171). Our approach targeted HGF to the fibrotic foci where regenerative capacity could be lacking. HSCs are already capable of producing HGF (Fig. 23D), and we augment that production by specifically targeting our delivery to HSCs. Another important aspect of our approach is the utilization of the anti-fibrotic effects of HGF. We have shown that transfection of fibrotic cell cultures (HSC-T6 monoculture and hepatic coculture) with the VALH particles increased the expression of functional HGF and   89   showed significant decreases in the expression of fibrotic markers at both the gene and protein levels (Fig. 23 & 24). In DMN-induced fibrotic rats, we observed extensive hepatocyte damage and high levels of α-SMA and collagen producing myofibroblasts (Fig. 25 & 27) and also severe disruption of the hepatic sinusoids (due to loss of endothelial fenestration and increased SEC capillarization; Fig. 28). The changes in the hepatic sinusoids during fibrosis might lead to obstruction of the sinusoids and increased portal hypertension (164). It has been previously shown that when compared to portal vein infusion, retrograde intrabiliary infusion has several advantages such as reducing contact with Kupffer cells, increased delivery to the liver and significant increases in the transgene expression (172,173). Therefore in order to circumvent the damaged hepatic microvasculature and increase the delivery efficacy to the liver, we administered the therapeutic complexes through retrograde intrabiliary infusion. VitaminA-Liposome-HGF (VALH) treatment in DMN-induced fibrotic rats caused an increase in HGF transgene expression (Fig. 32) and a clear decline in the fibrotic markers as compared to the other treatment groups (Table 5, Fig. 33-35). VALH targeting caused the expression levels of the delivered transgene to be greatly increased in the fibrotic foci, relative to other treatments. This was accompanied by a reduction in the protein levels of fibrotic markers α-SMA, TGF-β1, and Collagen I (Fig. 36-38). VALH treatment thus effectively increased local expression of HGF at the fibrotic foci and reduced the levels of fibrotic markers. In summary, this study demonstrates that when the therapeutic gene is targeted to a highly active cell type, and is localized in the fibrotic foci, the gene may have stronger expression as well as better accessibility to reduce the expansion of the fibrosis and thereby control the disease.   90   CHAPTER   91   4. CONCLUSION The development of treatments for liver fibrosis has been hindered by the low efficacy of therapeutic strategies in clinical trials that were originally proven to be effective in experimental animal models. This issue can be convincingly addressed when we obtain further insight into the underlying mechanisms governing fibrosis regression as well as develop new modalities that specifically targets cells in the liver incriminated in the disease pathology. The current work has brought to light a novel mechanism of regulation of active TGF-β1 by HGF. We now understand that the anti-fibrotic effects of HGF on HSC activation are primarily due to a decrease in TGF-β1 activation. The mechanism of action of HGF in the inhibition of TGF-β1 activation is two-fold as it individually affects two proteins, plasmin and TSP-1, both involved in the activation process. HGF increases the bioavailability of plasmin, which leads to an inhibition of active TGF−β1. HGF also leads to a strong inhibition of the TSP-1 dependent activation of TGF to levels comparable to the inhibition by TSP-1 inhibitor, LSKL. This insight into the mechanisms of the anti-fibrotic effects of HGF provides a better understanding of the intricate regulation of cytokines and growth factors during fibrosis and how the restoration of homeostasis can lead to reversal of liver fibrosis. With this novel understanding of the effects of HGF on in vitro fibrogenesis, we further developed it into a therapeutic modality in the treatment of liver fibrosis in DMN-induced fibrotic rats. Since HGF protein has a very short half-life and the liver is a well studied organ for in vivo gene transfer, we developed a gene delivery technology to overcome the biggest hurdle in hepatic gene transfer, i.e.,   92   inefficient delivery of therapeutics to target cells in the liver. Existing untargeted modalities for hepatic gene transfers still have unresolved issues such as immunological barriers, non-specificity of vectors, requirement of high doses that may be toxic to humans, and in the case of HGF therapy, enhancing the risk of hepatocarcinogenesis in humans (81). The current therapeutic strategy employs Vitamin A-coupled liposome carriers to deliver pDsRed2-HGF construct specifically to the fibrotic foci within the diseased liver. Firstly, the novel pDsRed2-HGF construct allows for visualization of the transgene within the fibrotic liver. Secondly, modifying the surface of the liposome carriers with Vitamin A renders absolute specificity to HSCs that have retinol binding receptors in abundance. A previous report on the intravenous delivery of Vitamin Acoupled liposomes to deliver siRNA to the HSCs in the fibrotic liver still encountered non-specific uptake by the hepatic macrophages owing to the scavenging property of Kupffer cells when they encounter foreign particles in the portal circulation. Therefore in the current approach, we delivered the Vitamin ALiposome-HGF particles (VALH) through the retrograde intrabiliary infusion to lower the scavenging effects of Kupffer cells, enhance the uptake efficiency by the liver, circumvent the hepatic sinusoidal resistance and observed tremendous increase in the transgene expression. These advantages of the current gene delivery system have proven effective by increasing HGF expression within the fibrotic foci leading to reduced HSC activation and regression of liver fibrosis in rats. This hepatic gene delivery system has the potential to restore liver homeostasis by inhibiting TGF-β1 activation pathway and with further studies in different liver injury models it might become an indispensable and robust treatment   modality for advanced hepatic fibrosis. 93   [...]... bioavailability of plasmin, which leads to an inhibition of active TGF−β1 HGF also leads to a strong inhibition of the TSP-1 dependent activation of TGF to levels comparable to the inhibition by TSP-1 inhibitor, LSKL This insight into the mechanisms of the anti-fibrotic effects of HGF provides a better understanding of the intricate regulation of cytokines and growth factors during fibrosis and how the restoration... determined from H&E stained liver tissue sections Seven days after treatment, VALH-treated rat livers, Fig 33 A showed reduced necrosis levels, both in the interior portions of the liver as well as at the liver capsule as seen in Masson Trichrome staining (Fig 33 B & 33 C), but the reduction was not statistically significant   83   A B Figure 33 : VALH-treated rat livers showing signs of fibrosis regression and... 148 ± 1. 63 1 43 ± 8.96 291.5 ± 136 .75 ± 14. 43* ,# 131 .33 ± 82   (kU/L) 21.88 46.45 ± HA 10.82 27.61 ± 39 .86 ± 29.58 5. 73 16.57 26.2 ± 8.95 (ng/ml) 13. 87** 18.54 ± 5.55# * - p < 0.05 compared to Lip-HGF, ** - p < 0.01 compared to Lip-HGF, # - p < 0.05 compared to VALD The blood serum levels of TGF-β, a fibrotic cytokine, showed a steady decline with VALH treatment in DMN-induced rat livers (Fig 32 ; p =... The levels of hyaluronic acid (HA), a marker for hepatic endothelial cell damage, showed significant improvement with both targeted and untargeted delivery of HGF Table 5: Disease-related liver proteins in the blood serum CTRL Lip-HGF 86.67 ± 51.5 ± 12.41 ALT (U/L) DMN 14.80 149.67 ± 247 .33 ± 167.75 ± AST (U/L)   46.67 ± 3. 67 1 23. 5 ± 182 ± 5. 93 14.85 LDH VALH 53. 5 ± 4.09 44 .33 ± 1 .33 VALD 19 .36 4.48... regress liver fibrosis by controlling the levels of myofibroblast activation 3. 4 DISCUSSION During fibrosis progression, the liver shows varied regional susceptibility to injury and toxins, due to architectural complexities, protein gradients, and oxygen levels (165-167) Indeed different liver diseases have different spatial distributions of fibrosis and different architectural patterns (27) Regardless of. .. restoration of homeostasis can lead to reversal of liver fibrosis With this novel understanding of the effects of HGF on in vitro fibrogenesis, we further developed it into a therapeutic modality in the treatment of liver fibrosis in DMN-induced fibrotic rats Since HGF protein has a very short half-life and the liver is a well studied organ for in vivo gene transfer, we developed a gene delivery technology to. .. significant when the p-value < 0.05 3. 3 RESULTS 3. 3.1 pDsred2-HGF Gene Construction & In Vitro Validation The HGF gene was isolated from rat cDNA and incorporated into the pDsRed2C1 vector to enable visualization of the delivered gene (Fig 22A) In order to validate the expression and functionality of the transgene, HEK-293T cells were transfected with pDsRed2 vector alone or with the pDsRed2-HGF combined... would greatly reduce the exchange of substances between the blood and the space of Disse As reduced access to the space of Disse might impair the efficacy portal vein infusion of therapeutics (164), we chose to circumvent the blocked sinusoids for our experiments, and used retrograde intrabiliary infusion to deliver the liposomes 3. 3.5 Regression Of DMN-Induced Liver Fibrosis After VALH Treatment DMN-induced... 0.08 between VALH and Lip-HGF groups) Figure 32 : Levels of pro-fibrotic cytokine TGF-β1 after treatment with VALH particles Decline in active TGF-β1 levels in the blood serum of rats 7 days after treatment n =3 3 .3. 8 VALH Treatment Improved Structural Markers Of Fibrosis To observe whether VALH therapy improved the architectural disturbances of DMNinduced fibrosis, we observed collagen deposition levels... expression (Fig 32 ) and a clear decline in the fibrotic markers as compared to the other treatment groups (Table 5, Fig 33 -35 ) VALH targeting caused the expression levels of the delivered transgene to be greatly increased in the fibrotic foci, relative to other treatments This was accompanied by a reduction in the protein levels of fibrotic markers α-SMA, TGF-β1, and Collagen I (Fig 36 -38 ) VALH treatment . to control the levels of fibrotic factors in vitro. 3. 3 .3 Establishment Of DMN-Induced Liver Fibrosis 0In order to induce liver fibrosis, male Wistar rats were injected with 1% DMN for 3. charge of -29 .33 ± 3. 13. As negatively charged particles is known to have better ability to be taken up the liver, (158) we believed that these particles could be easily taken up by the liver. tissue (33 ). Fibrotic foci are sites of active fibrosis within the affected organ (148) with an increased number of activated myofibroblasts that create a concentrated centre of pro-fibrotic cytokines