Herpes Herpes Simplex Simplex Virus Virus ; ; Type I PCR Product 5’TCAACTTCGACTGGCCCTTCTTGCTGGCCAAGCTGACG GACATTTACAAGGTCCCCCTGGAGACGGGTACGGCCGCA TGAACGGCCGGGGCGTGTTTCGCGTGTGGGACATAGGCC AGAGCCACTTCCAGAAGCGCAGCAAGATAAAGGTGAACG GCATGGTGAGCATCGACATGTACGG 3’ Type II PCR Product 5’TCAACTTCGACTGGCCCTTCGTCCTGACCAAGCTGACG GAGATCTACAAGGTCCCGCTCGAGACGGGTACGGGCGCA TGAACGGCCGGGGTGTGTTCCGCGTGTGGGACATAGGCC AGAGCCACTTCCAGAAGCGCAGCAAGATAAAGGTGAACG GCATGGTGAACATCGACATGTACGG 3’ HSV HSV Type Type I I infects infects the the nervous nervous system, system, however however HSV HSV Type Type II II infects infects the the genital genital system system . . In routine analysis; the discrimination between Type I and II is done by sequence detection system. Variations of Variations of HSV T HSV T ype ype 1 1 and and T T ype ype 2 2 discriminations and probes selection discriminations and probes selection : : HSV T HSV T ype ype 1 1 (between (between 64208 64208 and and 64386 64386 bases sequences) bases sequences) 5 5 ’ ’ ATC AAC TTC GAC TGG CCC TTC ATC AAC TTC GAC TGG CCC TTC * * T T T T G G CTG CTG G G CC AAG CTG CC AAG CTG ACG GA ACG GA C C A A * * T T T T TAC AAG GTC CC TAC AAG GTC CC C C CT CT G G GAC GGG TAC GG GAC GGG TAC GG C C CGC ATG CGC ATG AAC GGC CGG GG AAC GGC CGG GG C C GTG TT GTG TT T T CGC GTG TGG GAC AT CGC GTG TGG GAC AT A A GGC CAG AGC CAC GGC CAG AGC CAC TTC CAG AAG CGC AGC AAG ATA AAG GTG AAC GGC AT TTC CAG AAG CGC AGC AAG ATA AAG GTG AAC GGC AT G GTG A G GTG A G G C ATC C ATC GAC ATG TAC GG GAC ATG TAC GG 3 3 ’ ’ HSV T HSV T ype ype 2 2 (between (between 64669 64669 and and 64847 64847 bases sequences) bases sequences) 5 5 ’ ’ ATC AAC TTC GAC TGG CCC TTC ATC AAC TTC GAC TGG CCC TTC * * G G T T C C CTG CTG A A CC AAG CTG CC AAG CTG ACG GA ACG GA G G A A * * T T C C TAC AAG GTC CC TAC AAG GTC CC G G CT CT C C GAC GGG TAC GG GAC GGG TAC GG G G CGC CGC ATG AAC GGC CGG GG ATG AAC GGC CGG GG T T GTG TT GTG TT C C CGC GTG TGG GAC AT CGC GTG TGG GAC AT C C GGC CAG AGC GGC CAG AGC CAC TTC CAG AAG CGC AGC AAG ATA AAG GTG AAC GGC AT CAC TTC CAG AAG CGC AGC AAG ATA AAG GTG AAC GGC AT G GTG A G GTG A A A C C ATC GAC ATG TAC GG ATC GAC ATG TAC GG 3 3 ’ ’ Real Samples Real Samples - - 2 2 Label-Free Electrochemical Hybridization Genosensor for the Detection of Hepatitis B Virus Genotype on the Development of Lamivudine Resistance -Lamivudine is a pyrimidine nucleoside analogue that inhibits viral replication by blocking viral reverse transcriptase -Continuous lamivudine therapy may lead to selection of resistant strains Anal. Chem.2005, 77,4908-4917 z Hepatitis B virus (HBV) causes acute and chronic hepatitis, chirrosis and hepatocelular carcinoma. z Hepatitis B virus infection is the ninth mainly reason of death on the world Accordingtothe WorldHealthOrganization(WHO) more than 400 million people are chronically infected by Hepatitis B virus (HBV) worldwide. Long-term treatment is often needed and that is associated with many problems such as, z low cure rate z development of lamivudine resistance z Lamivudine-resistance is associated with nucleotide substitutions that induce amino acid changes in codon 204 of the polymerase gene. z HBV strains revealed isoleucine (I) or valine (V) substitutions instead of methionine in the tyrosine(Y), methionine(M), aspartate(D) and aspartate(D) motif (YMDD motif) z These changes are named YVDD or YIDD which are the most general described mutations PCR MAP of HBV 5’ - (372) tcgctggat gtgtctgcgg cgttttatca tattcctctt catcctgctg ctatgcctca tcttcttgtt ggttcttctg gattatcaag gtatgttgcc cgtttgtcct ctaattccag gatcaacaac aaccagtacg ggaccatgca aaacctgcac gactcctgct caaggcaact ctatgtttcc ctcatgttgc tgtacaaaac ctacggatgg aaattgcacc tgtattccca tcccatcgtc ctgggctttc gcaaaatacc tatgggagtg ggcctcagtc cgtttctctt ggctcagttt actagtgcca tttgttcagt ggttcgtagg gctttccccc actgtttggc tttcagc (tat atggatgatg tggtatt)ggg ggccaagact gtacagcatc gtgagtccct ttataccgct gttaccaa (808)-3’ z YMDD mutants are caused by a point mutation from A to G at the 743nd position (YVDD) and from G to T at the 745rd position (YIDD) of the human genome. . 1 (between (between 64208 64208 and and 64386 64386 bases sequences) bases sequences) 5 5 ’ ’ ATC AAC TTC GAC TGG CCC TTC ATC AAC TTC GAC TGG CCC TTC * * T T T T G G CTG CTG G G CC. (between (between 64669 64669 and and 64847 64847 bases sequences) bases sequences) 5 5 ’ ’ ATC AAC TTC GAC TGG CCC TTC ATC AAC TTC GAC TGG CCC TTC * * G G T T C C CTG CTG A A CC. Herpes Herpes Simplex Simplex Virus Virus ; ; Type I PCR Product 5 TCAACTTCGACTGGCCCTTCTTGCTGGCCAAGCTGACG GACATTTACAAGGTCCCCCTGGAGACGGGTACGGCCGCA TGAACGGCCGGGGCGTGTTTCGCGTGTGGGACATAGGCC AGAGCCACTTCCAGAAGCGCAGCAAGATAAAGGTGAACG GCATGGTGAGCATCGACATGTACGG