Luận án tiến sĩ: Development of inducer-free expression vectors for Bacillus subtilis based on Pgrac promoters

TRAN THI MINH DINHDEVELOPMENT OF INDUCER-FREE EXPRESSION VECTORS FOR Bacillus subtilis BASED ON Pgrac PROMOTERS PhD THESIS OF MICROBIOLOGY HO CHI MINH CITY — 2022... TRAN THI MINH DINHDE

TRAN THI MINH DINH

DEVELOPMENT OF INDUCER-FREE

EXPRESSION VECTORS FOR Bacillus subtilis

BASED ON Pgrac PROMOTERS

PhD THESIS OF MICROBIOLOGY

HO CHI MINH CITY — 2022

TRAN THI MINH DINH

DEVELOPMENT OF INDUCER-FREE EXPRESSION VECTORS FOR Bacillus subtilis

BASED ON Pgrac PROMOTERS

Speciality: Microbiology

Code: 62420107

Reviewer |: Prof Le Huyen Ai Thuy

Reviewer 2: Assoc Prof Ngo Thi Hoa

Reviewer 3: Dr Nguyen Thi Thanh Thao

Independent reviewer 1: Dr Tran Thi Hai Yen

Independent reviewer 2: Dr Nguyen Thi Thanh Thao

SUPERVISOR

1 Assoc Prof Nguyen Duc Hoang

2 Prof Wolfgang Schumann

HO CHI MINH CITY — 2022

DECLARATION OF AUTHORSHIP

I hereby declare that the PhD thesis in Microbiology with the topic

"Development of inducer-free expression vectors for Bacillus subtilis based on

Pgrac promoters" is my own scientific work under the guidance of Assoc Prof

Nguyen Duc Hoang and Prof Wolfgang Schumann

The research results of the thesis are completely honest, accurate, and do notoverlap with the published works

PhD student

Tran Thi Minh Dinh

First and foremost, I would like to express my sincere thanks and gratitude to

Associate Professor Nguyen Duc Hoang His wholehearted support and continuousadvice went through the process of completion of my thesis His encouragement andcomments had significantly enriched and improved my work Without hismotivation and instructions, the thesis would have been impossible to be doneeffectively

I would like to express my deep gratitude to Professor Wolgang Schumannand Associate Professor Phan Thi Phuong Trang for their generous support, patientguidance, enthusiastic encouragement, valuable and constructive suggestions, andvaluable critiques of this research work

I heartily appreciate Huynh Thi Kim Phuong, Dang Thi Kim Ngan, Phan Thi

Thu Hanh, Nguyen Thi My Linh, and Nguyen Thi My Ngoan for their valuableassistance and for making the warm atmosphere in the Lab I am also grateful to all

of the CBBers for their help and encouragement throughout this work

My special thanks approve to my parents for their endless love, care, and havethe most effective assistance and motivation for my whole life I also would like tothank to my brother and sisters for their support and care for me all the time

I do not know how to express my thanks to my husband, Do Thanh Hung Healways persevered through late-night lab and study sessions He understands mygoals and helps me every step of the way His understanding and love mean theworld to me I could not finish my thesis without him

I would like to say a special thank to my little angel, Do Tue Minh She joinedall my study sessions and my labwork during my pregnancy I also appreciate for

her lovely patience during her infancy and toddlerhood

Last but not least, I am really grateful for financial and the whole support fromCenter of Bioscience and Biotechnology

il

SUMMARY — xii

3 Research SUJ€CfS - - c1 111v TH TH ng HH HH ng 3

4 Research COntents G- L1 SH HH HH HH HH 3hN.- v0 vii

6 Scientific and practical significance of the theS1S - «<< +++sexssess 4CHAPTER 1 LITERATURE REVIENW - SH HH TH HH HH Hư 5

1.1 Bacillus subtilis as cell factories for recombinant protein production 5

1.1.1 Overview Of B SHFHÏlS SH HH HH kh 51.1.2 Advantages of B subtilis in recombinant protein producfion 81.1.3, Advances in improving B subtilis cellular perfOrIMAanC€S - 12

1.2.1 Characteristics of a promoter Of B SUDtIIS cccccecceesteetseeeeseeteeeneeeeaes 151.2.2 Characteristics of an expression vector for B subtilis 17

1.3 BgaB reporter DYOf€ITI G5 1191991 9019010 Hư 35

1.4 Hypothesis of the Study ceeeesceesseceseecsneeceseeceaeeeseeceaeecsaeeesaeeeeeseaeeseaeeees 36

CHAPTER 2 MATERIALS AND METHODOLOGY - -.- 5< 5s <<<+s+2 38

11

2.1 Bacterial strains, plasmids, oligonucleotides, antibiotics, and media 38

2.1.1 BACtCrIAL St GINS nan ốốốố.ốỐẦ.ẦỐẦ.Ố.ằằẦ 38

QiL.2 PIASINIAS n6 42

2.1.3 Oli QONUCTCOLES eceeccessccessecesseeenecesnecececeseeessecesceceseecsaeeesaeceeeceeeeeaeenss 472.1.4 AHIDIOÍCA HH TH HH HT TH như 51QDS, MCdiIQ anh h 51

2.2 ] EHHZVH1€S SH HH TH 522.2.2 DNA and protein ÏQ(Ï@LF 55 s19 1911k rưy 52

2.2.3 Biochemicals and Chemicals oxy 532.2.4 Kits nh 542.3 General methods - - 6 2< 111191211911 1 91H HH HH Hệ 54

2.3.1 PCR and Colony PCR cv kg Hư 542.3.2 9 Ầ.Ắ 55

2.3.3 RECOMDINANE StVAINS €H€T(fÏOH Sky 55

"` va - 59

2.6.2 Construction of integrative expression vectors allowing insertion at the,1/4058199/10NhhOC 642.6.3 Construction of integrative expression vectors allowing insertion at the

"ch nh 68

CHAPTER 3 RESULTS AND DISCUSSION -.Lcnnnnsekg 69

3.1.1 Inducer-free plasmid based on PgrdCÔ Ï eccccescccsscsesseeesscessecessetesseteeeees 69

iV

3.1.2 The inducer-free plasmids based on strong promoters, Pgrac57 andPRTACLOO voecccccccsccccesssceessssecseneeeessneeesseeeeeneesseeeeseseeesseseeessaueeeneaaeeseseeseeaseseneaaes 73

3.1.3 Influence of differrent lengths of lacI deletion on the production of BgaB

%ẮẦ 793.1.4 Inducer-free expression plasmid with the Pgrac212 promof†er 84

3.2 Inducer-free integrative EXPresSSiON V€CẨOTS .- Ăn it 9]

3.2.2 Vectors with strong promoters Pgrac57, Pgracl00, Pgrac212 for highproduction levels of the bgaB repOrter QeCNE esccccscccescesseeenseeesseteneeetseeeneeeeaes 983.2.3 Increasing the production of reporter protein by introducing twoexpression cassettes into PB subtilis CHrOIHOSOIH€ cĂẶScSSScssseseees 1023.2.4 Discussion of inducer-free integrative CExXPTeSSION VECTOTS 106

CHAPTER 4 CONCLUSION AND SUGGESTION ee ecceecceseeseeeeeteeeeneeeeees 112

A2 Electrophoresis of the colony PCR of inducer-free integrative expression

VECCOTS TT d

A4 Sequencing of inducer-free integrative V€CfOFS ccceesseeeseeeeeeeeeeeeeseeeeaeeeees iA5 The schematic map showed the primer sites and PCR product sizes for

checking the integration of the expression CaSSffC - 5S seireree m

A6 Electrophoresis of the colony PCR for integrating checking at the amyE

A7 Electrophoresis of the colony PCR for integrating checking at both the amyEand 220 on" OA8 Growth of some B subtilis recombinant strains habouring IPTG-inducible or

inducer-free expression vectors with PgracO1] promOf€T 55+ <++ss2 q

A9 Variance analysis of data using Stagraphics plus 3 « <+5 r

vi

ABBREVIA TIONS

Abbreviations Full words

bp base pair

Cas CRISPR-associated CoSE Controllable Stabilizing Elements

CRISPR Clustered Regularly Interspaced Short Palindromic RepeatsDMSO DiMethyl SulfOxide

DNA DeoxyriboNucleic AciddNTP deoxyriboNucleotide TriPhosphateEGFP Enhanced Green Fluorescent ProteinGFP Green Fluorescent Protein

IPTG IsoPropyl B-D-1-ThioGalactopyranoside

LB Luria-BertaniMCS Multiple Cloning SitesMUG 4-MethylUmbelliferyl-8-D-Glucuronide

min minute

ori origin of replication

PCR Polymerase Chain ReactionRBS Ribosome Binding Site

RFP Red Fluorescent ProteinRNA RiboNucleic Acid

SDS Sodium Dodecyl Sulfate SDS-PAGE Plectrophovea Sulfate PolyAcrylamide Gel

sfGFP superfolder Green Fluorescent ProteinX-gal 5-bromo-4-chloro-3-indolyl-B-D-galactopyranoside

Vil

LIST OF TABLES

Table 2.1 Bacterial strains used 1n this Work 5 5s + kEssessseeseeves 38

Table 2.7 Components of the restriction cleavage with KpnI and Sac]l 60

Table 2.8 Components of ligation reaction ccceeceeeseeeeseceseeceeeeeeeeeeaeceeaeeennessaes 62 Table 2.9 Components of the restriction cleavage with BamHI and Aaill 62

Table 2.10 Components of the restriction cleavage with BamHI and Kpnl 62

Table 2.11 Components of the restriction cleavage with SnaBI and Sacl 63

Table 2.12 Components of the restriction cleavage with BamHI and EcoRl 65

Table 2.13 Components of the restriction cleavage with BglII and EcoRI 67

Table 2.14 Components of the restriction cleavage with BamHI and Spel 67

Table 2.15 Components of the restriction cleavage with BamHI and Sacl 67

Table 3.1 ODeoo value of B subtilis recombinant sfTa1nS - s55 55 <+<<+ 71 Table 3.2 Repression of different expression vectors 1n E cøÏj « 78

Table 3.3 Inducer-free replicative expression plasmids with different lengths of lacI Table 3.4 BgaB production of B subtilis recombinant strains carrying plasmids with different lengths of lacI deπfIOT - c5 1113111311119 1111 111v ng rey 81 Table 3.5 Inducer-free integration vectors carrying Pgrac57, Pgracl00, or Pgrac212 promoters allowing integration at the amyE locus in this study 99

Table 3.6 Inducer-free integration vectors carrying PgracO1, Pgrac57, Pgrac100, or Pgrac212 promoters allowing integration at the /acA locus constructed in this study Table 3.7 Percentage of BgaB in comparison with total intracellular proteins in B subtilis Wte grants 20.0 nh Ầ ằ.ea 104

Vili

LIST OF FIGURES

Fig 1.1 Colony morphology and scanning electron microscopic image of B subtilis

Fig 1.2 The schematic model of the organization - segregation cycle in B subtilis 6Fig 1.3 The schematic plasmid map showing the main component of typicalEXPTESSION VECCOTS 2.0 eeecccesecesecsseecseeeesecesceceeecseessaeceseecesceceeessaeeeeaeseneeseneeseaeeesaees 17Fig 1.4 Location of some well-characterized loci for ectopic integration on B.SUbtilis circular FENOME Q2 HH TH HH 20Fig 1.5 The Pgrac01 promoter and RBS sequence in the pNDH33 plasmid 24Fig 1.6 Secondary structures of the 5’-steMm-lOOPS cc:cccescesseeeseeeeteeeeeeeseeeees 24Fig 1.7 Schematic map of the pHTO1 plasimid - 5 «<< £+s£<se+se+sessxs 27

Fig 1.8 Control of ColEl repÏ1CafIOII - - < + +3 + VE*kkseieeeeeeereere 28

Fig 1.9 P43 promoter S€QU€TCG G2 0111311119111 911191111 HH ng ng 29

Fig 1.10 The cry3Aa promoter sequence and some of its derivatives 33

Fig 1.11 The schematic representation of repession and expression mechanism ofthe target gene ON PHT V€CfOTS 00.0 eee eeesccesseseeeceseecesceceseeeeseesaeceeeeeeeseaecesaeeeeeesaes 37

Fig 2.2 The schematic diagram shows the sites of oligonucleotides used for

checking the double crossover at both amyE in B subtilis recombinant strains 58Fig 2.3 Schematic diagram of the construction of inducer-free expression vectors

Fig 2.4 Schematic diagram of the construction of inducer-free expression vectors

Fig 2.5 Schematic diagram of the construction of inducer-free expression vectorsintegrating into the AMYE ÏOCUS 5c 111191018910 19 111911 ng ky 64Fig 2.6 Schematic diagram of the construction of inducer-free expression vectorsintegrating into the [ACA ÏOCUS - s5 6+ 1E E919 211 9101 911101 hi HH 66Fig 3.1 BgaB activity of B subtilis recombinant strains carrying the Pgrac01PLOMOLEL 00111777 69

1X

Fig 3.2 SDS-PAGE revealed BgaB synthesis of Bs/pHT1655 70Fig 3.3 Colonies of B subtilis recombinant strains on LB-agar-Xøgal 71

Fig 3.4 BgaB activities of E coli strains carrying the PgrzcOÖ] - - 73

Fig 3.5 Gel electrophoresis of the colony PCR product of pHT1658 on agarose 2%2111810150300) da 74Fig 3.6 Gel electrophoresis on 2% agarose of PCR product for cloning ofPHT 1656.00 ce 75Fig 3.7 BgaB activities of B subtilis recombinant strains carrying inducer-free

plasmids with the Pgrac01, Pgrac57, or Pgrac100 promoters - -‹- 76

Fig 3.8 SDS-PAGE showing BgaB production of B subtilis recombinant strainscarrying inducer-free plasmids with PgracO1, Pgrac57, or Pgrac100 77Fig 3.9 Gel electrophoresis on agarose 2% of colony PCR of pHT2079 with theproduct size Of V29) 80Fig 3.10 Gel electrophoresis on 2% agarose of PCR products for cloning of

2:0 80

Fig 3.11 BgaB protein of B subtilis carrying inducer-free plasmids with PgracO1,Pgrac57, OF PgraclOO PT 43 83Fig 3.12 Gel electrophoresis on 2% agarose of colony PCR of pHT2080 with the

Fig 3.13 BgaB activities of B subtilis carrying plasmids with Pgrac212 85

Fig 3.14 BgaB protein in B subtilis carrying plasmids with Pgrac212 86

Fig 3.15 The supposed DNA-loop formed by binding of tetrameric LacR on theTWO LAC OPECTALOTS Tai 89Fig 3.16 Cloning result of PHT 2170 0 e 92Fig 3.17 Background expression of plasmids carrying Pgrac01 promoter in E coliOMNIMAX 0121 94

Fig 3.18 Confirmation of double crossover of the expression cassette in B subtilis

FAT U00 96

Fig 3.19 BgaB synthesis of integrative strains carrying Psrac01 in comparisonwith other strains carrying replicative plasmids with the same or different promoters

Fig 3.20 BgaB production of recombinant B subtilis strains habouring expressioncassettes at the GME LOCUS 0.0 eecccessccessceeneeeseeceseeeeseeeeaecesaeceseeceaeeeeaeeesaeeeseeeneeeses 100

Fig 3.21 Confirmation of the insertion of the expression cassette at both the amyE

Fig 3.22 BgaB synthesis of B subtilis recombinant strains carrying two inserted

expression Cassettes On the GENOME - .- <1 13011991 E991 91 1v ng ng nếp 105

XI

B subtilis - Escherichia coli shuttle vectors, so the background expression can

interfere the efficiency of cloning steps in E coli Therefore, generation of

expression vectors that could produce the heterologous proteins in the absence ofinducers at a high level in B subtilis while they still repress leaky expression in E.coli is a demand in heterologous protein production The Pgrac promoter is a strongpromoter, created by hybridization of PgroES promoter and the /ac operator forprotein overexpression in B subtilis These promoters have the potentiality togenerate vectors that produce heterologous proteins in an inducer-free manner in

B subtilis but stay controllable in E coli because of the presence of thechromosomal /ac/ gene in the E coli and its absence on the B subtilis genome Inthis study, inducer-free expression vectors carrying Pgrac promoters, includinginducer-free plasmids and inducer-free integrative vectors, were generated bydeleting the /JacI gene on the IPTG-inducible pHT plasmids

In the first section, inducer-free plasmids were constructed, and heterologous

protein production controlled by them was investigated using bgaB fromGeobacillus stearothermophilus as a reporter gene First, plasmids for IPTG-independent expression in B subtilis and background repression in E coli weredemonstrated using Pgrzc01 promoter and the BgaB reporter protein PlasmidpHT1655 (AlacI 1362 bp, Pgrac01-bgaB) expressed BgaB in an IPTG- independent

manner, accounting for 14.6% of total intracellular proteins without affecting host

cell growth Meanwhile, it still repressed the background expression in E coli with

an inhibition ratio of 5.1-fold Initially, the strategy to generate inducer-free

plasmids by deleting of /acI gene achieved the expected results Next, inducer-free

plasmids were generated using more potent promoters and deleting different

XI

fragments of the Jacl gene Series of inducer-free expression plasmids were

generated using stronger promoters carrying mutations in the core promoter regions

and upstream sequences, including Pgrac57 (-35”, -15”), Pgrac100 (UP”, -357,-15”),

and using 5’-messenger ribonucleic acid (nRNA) controllable stabilizing element(CoSE), including Pgrac212 BgaB expression by B subtilis strains harboring AlacIplasmids with Pgrac57, Pgrac100, and Pgrac212 accounted for 22.4%, 24.7% and31.1%, respectively The AlacI plasmids with Pgrac57, Pgrac100 repressed thebackground expression in FE coli with an inhibition ratio of 1.5 and 1.2-fold,

respectively In the next step, the influence of different lengths of JacI gene deletion

(1226 bp, 913 bp, and 670 bp) on BgaB expression in B subtilis of AlacI plasmidswith Pgrac0O1, Pgrac57, and Pgracl00 promoters was investigated BgaBproduction in B subtilis strains carrying plasmids with different lengths of Jacldeletion showed slight differences and did not follow a particular pattern Among

them, 1226 bp-AlacI plasmids exhibited an improvement in BgaB production The

B subtilis recombinant strains carrying inducer-free plasmids with different lengths

of lacI deletion could produce BgaB ranging from 14.6% up to 26.5% of the totalintracellular proteins

In the second section, inducer-free integrative vectors were constructed, andBgaB production controlled by them was investigated At the first step, a 1226 bp-

AlacI vector carrying Pgrac01, allowing the insertion of expression cassettes into

amyE locus on the B subtilis genome were created By introducing the rop geneinto these integrative vectors, the background expression in E coli was significantlyreduced and, similar to that of the plasmid used as a negative control, which did notproduce BgaB In B subtilis, the inducer-free integrative vectors carrying Psrac01produced BgaB accounting for 8% of the total cellular proteins at 4 h, lower thanthat of the inducer-free replicative plasmids carrying the same promoter due to thegene dosage effect Next, 1226 bp-AlacI vectors carrying stronger promoters,including Pgrac57, Pgrac100, and Pgrac212, allowing the insertion of expressioncassettes into amyE locus on the B subtilis genome were constructed At 4 h, the

Xili

B subtilis integrants carrying Pgrac57 and Pgrac100 Alacl cassettes producedBgaB up to 8.8%, 12% of the total cellular proteins, respectively However, BgaBsynthesized by these integrants continued to increase gradually until 12 h afterculture and accounted for 14.7% and 20.9%, respectively Remarkably, the inducer-free integrative vectors Pgrac212 could synthesize BgaB 32.7% at 4 h, which is asmuch as the cognate replicative plasmid After that, BgaB synthesis of this vectorcontinued to rise over the time of culture and accumulated up to 42% after 12 hours.Besides, a total of seven 1226 bp-AlacI vector carrying Pgrac01, Pgrac57,

Pgrac100 and Pgrac212, allowing the insertion of expression cassettes into lacA

locus on the B subtilis chromosome were constructed They were transformed into

B subtilis 1012 competent cells, which had already contained an expression cassette

at amyE locus, to generate the strains inserted at both the amyE and lacA loci

Strains integrated at both the amyE and lacA loci with PgracO01, Pgrac57 andPgrac100 produced BgaB accounted for 23.4%, 23.6%, and 24% respectively.Moreover, the plasmid-less B subtilis strain with the Pgrac212 expression cassettesintegrated into both amyE and lacA loci synthesized BgaB accounted for 53.4% ofthe total intracellular proteins Significantly, the integrant with Pgrac212 producedBgaB at low levels during the early stage of culture but changing to high levelswhen host cells reached the late log phase These positive results desmonstrate thepotential commercial value of the newly constructed vectors

In conclusion, a new approach to change IPTG-inducible expression vectors toinducer-free expression vectors, allowing the production of the target protein at ahigh level in B subtilis in the absence of inducers while remaining repression ofbackground expression in E coli, by deletion of the Jac] gene on plasmids wasdemonstrated in this study Besides, a series of various replicative and integrativevectors with a variety of expression levels were created to meet different purposes.This approach with inducer-free expression vectors is available for the expression ofdifferent genes in future studies

XIV

1 Rationale of the study

B subtilis is currently the best characterized Gram-positive bacterium [1], and

a great deal of essential information has been gained [2] In addition, it allowsexcellent growth on cheap carbon sources, and robustness in industrialfermentations [3] Especially, B subtilis is regarded as a Generally Recognized asSafe (GRAS) organism as its lacks of endotoxins and pathogenicity [4], [5].Moreover, it has no significant bias in the use of codon [2] Therefore, it hasbecome an attractive factory for the production of heterologous proteins [2]

Using strong promoters to construct expression systems is one of the dominantstrategies for expressing heterologous and homologous proteins [6] A wide range

of expression vectors have been developed to produce recombinant proteins in

B subtilis They are either inducible or inducer-free [7], [8], [9] Inducer-freeexpression vectors have lately received more attention because of inducers’disadvantages such as high costs [10] and toxicity [11]

Expression vectors in B subtilis are either replicative or integrative vectors.The first one is more common and drives the expression of the target gene at ahigher level In contrast, the latter is preferred because of its genetic stability, safety,

and environmental friendliness However, it shows a noticeable disadvantage of

low-level expression due to the gene dosage effect [5], [12]

In fact, most of the expression vectors in B subtilis are E coli - B subtilisshuttle vectors The cloning steps are performed in E coli, following by theexpression of heterologous proteins in B subtilis Therefore, background expression

in E coli has a significant influence on the application of the expression vectors Anexpression vector that allows protein expression at high levels in B subtilis whileremains repression in E coli seems to be more agreeable to the expression ofheterologous proteins

As mentioned above, high-level expression, inducer-free, antibiotic-free, andrepression in E coli seem to be indicators for an effective vector for large-scale

production of heterologous proteins So far, the replicative and integrative vectors

do not fully meet these requirements In addition, the number of inducer-freevectors, especially inducer-free integrative vectors for B subtilis is still tiny.Besides, the unsolved issue in the generation of strong and effective vectors for

B subtilis is the leaking expression level in E coli As it was mentioned elwhere,increase in protein production level in B subtilis resulted in higher basal expression

in E coli, and high background expression levels in E coli can inhibit the growth ofthis host [13]

To overcome the problem, isopropyl B-D-1-thiogalactopyranoside

(IPTG)-inducible pHT plasmids harboring strong Pgrac promoters and lac operators wereused to develop inducer-free vectors Firstly, Pgrac promoters are strong promoters,and the Pgrac promoter library consists of 85 promoters of different strengths Thesynthesis of the BgaB reporter protein driven by Pgrac promoters ranging from10% up to 42% of the total intracellular proteins [13], [14], [15], [16] Secondly, inthe pHT plasmids, transcription of the target gene was controlled by LacR proteinencoded on the plasmids In addition, the level of repression was enhanced by usingtwo lac operators Therefore, when /acÏ gene on the plasmids was removed, thetarget gene on pHT plasmids was expressed in an inducer-free manner in B subtiliswhile repressed by the chromosomal /acI gene in E coli

For all of the above reasons, IPTG-inducible pHT plasmids harboring strongPgrac promoters were used to construct inducer-free replicative and integrativeexpression vectors for B subtilis

2 Objective of the study

This study aims to develop inducer-free replicative and integrative expressionvectors for B subtilis based on Pgrac promoters, which could express the targetprotein at a high level in B subtilis in the absence of inducers while remaining

repression of background expression in E coli

3 Research subjects

This study is carried out on the inducer-free pHT vectors carrying Pgrac0O1,Pgrac57, Pgracl00, and Pgrac212 promoters, and BgaB reporter protein fromGeobacillus stearothermophilus

4 Research contents

Research contents include two main sections: Inducer-free expressionplasmids and inducer-free integrative expression vectors In the first section,inducer-free expression 1n B subtilis and repression in EF coli of the bgaB reportergene was proved by investigation of bgaB expression of an inducer-free plasmid(AlacI 1362 bp) carrying PgracO1 promoter Next, in order to improve BgaBprodution in B subtilis, stronger Pgrac promoters belonging to 2 different groupsincluding Pgrac57, Pgrac100 (mutation at -35, -15, UP element) and Pgrac212(with CoSE) were used for inducer-free plasmid construction A AlaclI-1362-bpplasmid based on Pgrac100 was cloned, and bgaB expression of AlacI-1362-bpplasmids carrying Pgrac57 or Pgrac100 promoters in B subtilis was examined.After that, other constructions of AlacI plasmids (AlacI 1226 bp, AlacI 913 bp, andAlac† 670 bp) carrying Pgrac100 promoters were constructed, and the influence ofdifferent lengths of /acI gene deletion of AlacI plasmids with PgracO1, Pgrac57,

and Pgracl100 promoters on BgaB expression in B subtilis was investigated

Finally, an inducer-free plasmid (AlacI 1226 bp) based on Pgrac212 wasconstructed, and its bgaB expression in B subtilis was examined

In the second section, inducer-free expression of the bgaB gene fromintegrated AlacI expression cassettes was demonstrated At first, a AlacI-1226-bpintegrative vector based on the Pgrzc0l promoter carrying the homologoussequences to allow insertion at the amyE locus was constructed, and its bgaBexpression in B subtilis and E coli was investigated Next, BgaB production inintegrated B subtilis strains was enhanced by using Pgrac57, Pgrac100, and

Pgrac212 promoters to construct AlacI-1226-bp integrative vectors carrying the

homologous sequences to allow insertion at the amyE locus and investigation of

their bgaB expression in B subtilis Finally, Alacl-1226-bp integrative vectorsbased on PgracO1, Pgrac57, Pgracl00 or Pgrac212 promoters carrying thehomologous sequences to allow insertion at the JacA locus were constructed Then,

B subtilis recombinant strains integrated at both the /JacA and amyE loci weregenerated, and their BgaB synthesis was investigated

5 Research scope

This study used the only strategy to change IPTG-inducible pHT vectors intoinducer-free vectors, which is to delete parts of the /zcÏ gene on the pHT vectorsusing enzymes with the unique restriction site in and around the lacI gene Thenewly constructed expression vectors were investigated for expression level usingBgaB from G stearothermophillus as the only reporter protein This study focused

on the production of BgaB reporter protein in B subtilis In contrast, the leakingexpression in FE coli was analyzed in some specific cases to demonstrate therepression ability of the newly developed vectors in E coli

6 Scientific and practical significance of the thesis

Scientific significance: This study reports a new strategy to create inducer-freeexpression vectors to achieve high-level expression of the target gene in B subtilis

while repressing leakiness in F coli based on the JacO-hybrid promoter

Practical significance: Inducer-free expression vectors generated could be a

cost-effective solution for the production of recombinant protein Besides, a series

of different vectors with a wide range of expression levels were generated to meetdifferent requirements in protein expression Significantly, the integrant withPgrac212 produced BgaB at low levels during the early stage of culture but

changing to high levels when host cells reached the late log phase These optimistic

results desmonstrate the potential commercial value of the newly constructed

vectors.

CHAPTER 1 LITERATURE REVIEW

1.1 Bacillus subtilis as cell factories for recombinant protein production

1.1.1 Overview of B subtilis

1.1.1.1 General information

In 1835, Ehrenberg described the bacterium “Vibrio subtilis’ which wasrenamed Bacillus subtilis by Cohn in 1872 [17] In Bergey’s manual of systematicbacteriology, B subtilis belongs to Bacteria domain, Firmicutes phylum, Bacilliclass, Bacillles order, Bacillaceae family, Bacillus genus, and Bacillus subtilisspecies [18]

Immediately after the beginning of replication, the duplicated origins move as a unit

to the middle of the cell, and the two unreplicated arms resolve into opposite cellhalves, creating a left-ori-right pattern Then, the origins are actively segregated to

opposite poles, reinitializing the cycle (Fig 1.2) [23]

New DNA: ori-ter Template: left-right

Fig 1.2 The schematic model of the organization - segregation cycle

in B subtilisOrigins are represented as black balls, and termini are represented as brown

lines The compacted left and right chromosome arms are shown as thick blue

and purple lines (or blobs) Newly replicated DNA is shown with a lighter hue,

whereas uncompacted DNA is shown as thin lines In newborn cell, unreplicated

DNA is shown as a black cloud [23]

When B subtilis cells are cultured in rich media, multiple DNA replicationforks are present in each cell, and the cells are born with chromosomes which arepartially replicated On average, each cell has 3.1 origins if it is grown in definedrich media with a generation time of about 35 min Even under the slowest growthconditions, more than 50% of their chromosomes are replicated when B subtilis

cells are born [23]

Since DNA replication sfarts at the origin of replication, and a new round of

DNA replication are initiated before the completion of the preceding one in cells

growing rapidly, gene dosage increases from the origin to the terminus ofreplication As a result, the copy number of inserted genes will fluctuate, depending

on the inserted sites on the chromosome The expression of a gene located near thereplication origin is approximately 5-fold higher than when it is located close to the

terminus [24]

1.1.1.3 Plasmids

In B subtilis, plasmids are quite uncommon, being detected in about 10% to20% of all wild-type isolates examined Most of the plasmids are smaller than 10

kb, low-copy number, and circular They are high homology in sequence that

perhaps shows that they are widespread distributed by horizontal gene transfer [25].Large plasmids have also been isolated from B subtilis, but they seem to be rare.They include pLS20, and pLS32 with sizes greater than 50 kb [26], [25] The

B subtilis strain NCIB3610, supposed to be the direct descendent of the 1899

“Marburg strain” original strain [27], carry a large plasmid with the size of 84 kb,called pBS32 [28] The typical laboratory B subtilis 168 strain does not contain

plasmids [29]

1.1.1.4 Natural transformation

At the beginning of the stationary phase, up to 20% of all B subtilis cells canbecome competent Then, proteins that bind environmental DNA to the cell surfaceare induced to express, and the competent cells can process and transport the single-stranded DNA into its cytoplasm Recombination proteins allow integration of thehomologous or “partially” homologous foreign DNA into recipient’s genome, orenable the establishment of plasmids The proteins for competence state arecontrolled by the master competence transcription factor, ComK The proteins take

up linear single-stranded DNA molecules, which are then available to theintracellular recombination machinery [30]

If taken up DNA contains less than 20% divergence to the chromosome,single-stranded DNA may be directly incorporated into the chromosome viachromosomal transformation, setting up heteroduplex DNA When cells re-enterinto the vegetative state and daughter cells are born via binary fission One daughtercell inherits a copy of chromosome derived from parental DNA while the other cellgets a copy of chromosome derived from the foreign DNA, which become the

transformed cell If homology of taken up single-stranded DNA to the chromosome

is too low, the taken DNA must be annealed to establish a circular double-strandedDNA and be self-replicative if carrying a replication origin It is interesting to notethat plasmid DNA can only lead to transformation if it is multimeric, andmonomeric plasmid DNA cannot be transformed [30]

1.1.2 Advantages of B subtilis in recombinant protein production

1.1.2.1 Safety

Most importantly, B subtilis has no pathogenicity, and does not possess genescoding for exotoxins and endotoxins [31] As reported by the European ScientificCommittee on Animal Nutrition, B subtilis was examined and exhibited no signs oftoxicity Besides, these strains are demonstrated to be safe by acute and chronictoxicity researches on animals Thus, B subtilis is generally recognized as safe bythe Food and Drug Administration (FDA), that is to say it is friendly to humans Inaddition, the European Food Safety Authority (EFSA) considered B subtilis species

to be suitable for Qualified Presumption of Safety [32]

1.1.2.2 Large bodies of genetic information

The complete genome of many B subtilis strains have been sequenced andannotated, encouraging novel methods for interpreting metabolic pathways andproviding an overview of protein machinery [22] The early accessibility of thegenome sequence not only improved our comprehension of basic cellular processes

in B subtilis, but also served as guidance for the genetic modification of B subtilis[33] Through the data analysis of the transcriptome, proteome, and metabolome of

B subtilis, its endogenous properties were comprehensively understood [34] Bycombination of these physiological data with genome sequence data, severalspecialized databases have been created, such as Sporeweb [35], DBTBS database[36], SubiWiki database [37], MetaCyc database [38], and BioBrick Box [39].Many information can be extracted from these databases, such as DNA sequences,pathway maps, protein-protein interactions, and gene transcript levels Thepurposeful predictability of genetic engineering targets is helpful to improveperformances of strains and increase product yields, especially for biotechnologicalapplications Additionally, 384 essential genes were repressed by using theclustered regularly interspaced short palindromic repeats interference (CRISPRi)technique, resulting in an essential gene knockdown library [40].

1.1.2.3 Advances in genetic manipulation

Microorganisms appropriate for large-scale fermentation are seldom

wild-type, and can rarely be obtained from microbial strain depositories In general,strain development based on elaborate and intricate research efforts are essential toadapt and optimize a microorganism to fit a biotechnological process In otherwords, to convert microorganisms into hosts for the production of high-value

compounds and further improve their performance, their DNA sequence must be

changed to provide them with pertinent stable inheritable traits [41] The readyaccessibility of complete genome sequences is useful for the study of systematicmechanisms, and has paved the way for progress in genetic modification of

B subtilis [42]

s* Transformation

These days, the protocol published by Kunst and Rapoport is the mostcommonly used method for transforming DNA into B subtilis competent cells [43].The preferred method exploits natural competence of B subtilis for transformation

of foreign DNA into the host cells Nevertheless, some B subtilis strains, especially

highly developed production strains, do not easily become competent For suchstrains, ectopic expression of ComK, the master regulator for competence, may help

[44] As an alternative, the target DNA was first transformed into a lab strain thateasy to manipulate, and next the modified genome of this strain is transferred toproduction strain by phage transduction or protoplast fusion Besides, replicativeplasmids can also be transformed into B subtilis protoplasts (protoplasttransformation) Moreover, replicative plasmids as well as linear DNA fragments,such as polymerase chain reaction (PCR) products or linearized integrative plasmidscan be transformed into B subtilis by electrotransformation [41].

s* Genome-editingEffective available genome-editing tools are the basic requirements inmetabolic engineering for the development of microorganisms as microbial cellfactories [45] Genome-editing manipulations typically involve the deletion,insertion, and mutation of genes [42] Besides, the common single-marker counter-selection method, many advanced and developed tools have been established in

B subtilis, such as counter-selectable markers systems, site-specific recombinationsystems, and ultramodern CRISPR-CRISPR-associated (Cas) systems [4]

The cassette of counter-selectable markers systems usually consists of twohomologous regions flanking the target chromosome locus, the resistance gene, thetoxin gene under the control of an inducible promoter, and two directly repeatedsequences [46] The counter-selectable cassette can be inserted into the target locus

on the chromosome by a double-crossover event between PCR products/linearizedvectors and the genome Then, the two directly repeated sequences will cause thenext single-crossover event and the resistance gene and the toxin gene areeleminated Up to now, six types of counter-selectable markers based on upp [47],blal [48], mazF [49], ysbC [50], hewl [46], and cat [51] genes have been reportedfor B subtilis This method make it possible to achieve the desired change in thebacterial chromosome without leaving any remnant sequences [51]

In comparision to the native recombination events in counter-selectablemarker systems, the recombination efficiencies of site-specific recombinationsystems are much higher due to the use of recombinases In B subtilis, frequently

10

used site-specific recombination systems include the Xer/dif [52] and cre/loxPsystems [53] For example, the expression of the Cre recombinase in the cre/loxPsystem could catalyze the reciprocal site-specific recombination between two loxPsites on the chromosome [53] With a cre IPTG-inducible expression system on thechromosome, a genome engineering process can be achieved in two days, whichmakes them more suitable for multiple genome-editing operations [53].

What is more, CRISPR-Cas systems have also been developed into a genome

editing for B subtilis [54], [55], [56] A comprehensive CRISPR-Cas9 tool kit wasdeveloped using the chromosomal transcription of guide RNAs, chromosomalexpression of Cas9, and counter selectable guide RNA delivery vectors, whichallowed effective gene insertion, site-specific mutation, and continuous genome

editing and multiplexing In addition, this CRISPR-Cas9 tool kit was extended to

CRISPR interference for regulation at transcriptional level [55]

1.1.2.4 Large-scale fermentation

The fermentation capacities of B subtilis are as excellent as, or even betterthan, those of E coli [20] B subtilis can grow in nutrient media as well as inchemically defined salt media where sources of carbon come from glucose, malate,and other simple sugars and sources of nitrogen are ammonium salts or certainamino acids [21]

Besides, B subtilis is well adapted for culture in large aerobic stirred-tankreactors The bacterial cells are rather uniform in size and tend to form chains of afew cells due to incomplete cell wall separation during the growth cycle They donot grow on the solid surfaces of the fermentation equipment Cultures of B subtilisare low viscosity even at high cell density, making them easy to mix and aerate.After the end of fermentation process, the biomass separation by centrifugation,decantation, or microfiltration is usually not a serious problem [41]

11

simplifying the downstream processing [20] Generally, newly synthesized

preproteins can be targeted to, and translocated through the membrane by a number

of possible pathways in B subtilis To date, four separate protein secretionpathways have been identified The most of exported proteins are translocatedthrough the major Sec-SRP cooperation pathway In contrast, only a few proteinscan be transported by other pathways which can be considered as special-purpose

pathways, including twin-arginine translocation (Tat) pathway, certain ATP-binding

cassette (ABC) transporters, and a pseudopilin export pathway for competencedevelopment [58]

1.1.3 Advances in improving B subtilis cellular performances

Over the past decades, numerous strategies have been employed to enhanceprotein expression levels [59] and large-scale fermentation ability of B subtilis [4]

In general, B subtilis possesses a number of undomesticated characteristics forlarge-scale fermentation, such as the production of a large amount of foam,sporulation under nutrient depletion conditions, and high maintenance metabolism.These properties causes an increase in requirements and difficulties in industrialoperations Therefore, certain inherent genes must be inactivated, including s7fCassociated with foam production and spolAC associated with endospore formation

Additionally, respiration chain should be engineered to lower maintenance

metabolism [4]

12

Like all living organisms, B subtilis has cellular protein quality controlsystems They enable the production of high-quality proteins, and eliminateimproperly folded and incompletely synthesized proteins Unfortunately, cellularquality control systems also cause significant bottlenecks in heterologous proteinproduction [20] Successful strategies for improvement of protein production in B.subtilis consist of the knockout of extracellular and/or intracellular proteases, over-

expression of chaperones and folding catalysts, overexpression of components of

the secretion machinery, and/or modification of the cell wall microenvironment

[20]

Many B subtilis hosts have been created by inactivation of certain proteasegenes to reduce extracellular protease activity, including mutant strains 1A751(AnprE and AaprE), WB600 (AnprE, AaprE, Aepr, Abpr, mpr::ble, and nprB::bsr),WB700 (AnprE, AaprE, Aepr, Abpr, mpr::ble, nprB::bsr, and Avpr), and WB800(AnprE, AaprE, Aepr, Abpr, mpr::ble, nprB::bsr, Avpr, and wprA::hyg) Besides, aset of 14 marker-free knockout strains was created for the production of therapeuticproteins by sequentially deleting each gene of the eight extracellular proteases andthe two quality control proteases HtrA and HtrB in a B subtilis 168 background.These strains have significantly lower protease activity than the wild-type strain and

generally exhibit better foreign protein secretion These protease-inactivated strains

are stable and used to produce antigenic proteins of B anthracis on an industrialscale However, inactivation of quality control proteases affects cell wall synthesis,leading to the induction of the stress regulon encoding for other quality control

proteases [52]

In addition, Yao (2019) found that extracellular proteases are not alwaysdetrimental to foreign protein production Many publications have shown thatstrains that inactivate all eight extracellular proteases are not the best option forsecretory expression of recombinant proteins For instance, the secretion ofpullulanase in B subtilis WB600 was about 3-fold higher than that in B subtilisWB800 In other word, some extracellular proteases are not beneficial for the

13

expression of recombinant protein secretion, while others are Therefore, for highly

efficient recombinant protein expression, the extracellular proteases of B subtilis

need to be selectively inactivated Nine mutant strains that do not contain antibioticresistance genes in the genome, were generated by successively inactivatedextracellular proteases from B subtilis 168 Among them, strain PD8 (dnprE,AaprE, Aepr, Abpr, Ampr, AnprB, Avpr, and AwprA) synthesized methyl parathion

hydrolase and chlorothalonil hydrolytic dehalogenase, giving an activity of 79.9

U/mL and 13.4 U/L, respectively, much higher than their activity when expressed

by B subtilis WB800 (AnprE, AaprE, Aepr, Abpr, mpr::ble, nprB::bsr, Avpr, andwprA::hyg), respectively, are 32.5 U/mL and 7.4 U/L [60]

Recent studies focusing on the modification of B subtilis wild strains forindustrial production have generated strains with a high prospect for proteinproduction improvement [59] Despite the fact that B subtilis WB600, WB700, andWB800 have been commonly exploited for protein overexpression at large scale,they are protease-deficient strains generated from auxotrophic B subtilis 168 whichcannot effectively utilize amino acids of the glutamate family Manyundomesticated strains exhibit more favorable growth properties as well as higherprotein productivity than those of B subtilis 168 This indicates that undomesticatedstrains have a marvellous prospect to replace host strains currently in industrial use

or to generate alternative strains for industrial use For example, B subtilis ATCC

6051 was constructed as an expression host strain by knockout of lytC and spolIGA,resulting in autolysis decrease and no spore formation Similarly, the inactivation ofsrfC, spolIAC, nprE, aprE, and amyE in the undomesticated B subtilis ATCC

6051a resulted in a strain with many favorable characteristics, including much less

foam, lower extracellular protease and o-amylase activities, and no endospore

formation during the fermentation period, regarded as an outstanding host strain[59]

Effective secretion and folding of proteins are essential in recombinant proteinproduction in B subtilis These processes are supported by components of the

14

translocation system along with intracellular and extracytoplasmic chaperones As ageneral rule, heterologous proteins are produced at a lower level than homologousprotein in B subtilis This may happen due to the fact that environments employedfor folding and secretion of heterologous proteins are different from those ofhomologous proteins in B subtilis strains, resulting in some bottlenecks Besides,secretion and folding bottlenecks may also occur in the production of somehomologous proteins because of restriction of some key components of the proteinexpression apparatus Hence, in order to eliminate these bottlenecks, systematicstudies have been done on the secretion and folding apparatus components [59].

Recently, minimal genome engineering has been shown to enable B subtilis tobecome the optimal production host For example, B subtilis MBG874 whosegenome was reduced by 20% constructed by deletion of unessential genes,remarkably enhanced heterologous protein productivity [61]

1.2 Expression systems for B subtilis

1.2.1 Characteristics of a promoter of B subtilis

Conserved DNA sequences that signal and direct the transcription of anadjacent gene or group of genes are called promoters Promoters are regarded ascrucial elements for transcription since they are the initial stage in expression ofgenes and component of regulation at transcriptional level To initiate transcription,

the sigma factor of RNA polymerase must regconize promoter sequences and

initiation site As a result, the specificity of the RNA polymerase for a promotersequence is decided by the sigma factor However, the function of sigma factor isonly to recognize promoters, and hence the sigma factor dissociates from the coreenzyme after a short sequence of an RNA molecule has been synthesized [62]

At least 17 different o factors are encoded by the genome of B subtilis

Among them, at least six housekeeping sigma factors, including ø, 08, øC, øP, oF and o! are utilized by growing cells Another four sigma factors, including o*, of, Ø8 and oX are used during endospore formation in B subtilis cells The remaining

15

seven o factors were identified after the availability of complete genome sequence,and all of them belong to the extracytoplasmic function subfamily [63].

The transcription of most of the housekeeping genes in B subtilis is initiated

by o4, which recognizes the same consensus sequence with o” of E coli, which is

5’-TTGACA-17 nt-TATAAT-3’ In addition, an extended -10 region is used in

majority of o4-dependent promters of B subtilis This region whose consensus is

5’-TRTG-3’, where R means G or A, is found to lie 1 bp upstream of the -10 region,and is therefore known as the -16 region This extension is estimated to exist inapproximately 45% of the promoters in B subtilis Particularly in promoterscontaining this extended signal, a series of A and T rich regions upstream of the-35 sequences, referred to as UP element, has been noticed [63] It is believed that

UP elements interact with the C-terminal domain of the a-subunit of the RNApolymerase holoenzyme, resulted in transcription enhancement [64]

A compilation and analysis of promoter sequences recognized by o“ factor in

B subtilis suggested that the most favorable promoters consist of sequences asfollows: (i) a purine at the +1 site where transcription initiates, (11) a spacer of sixnucleotides in length from the +1 to the -10 sequences, (iii) a TATAAT at the -10region, (iv) a T(A/G)TG between -17 and -14 referred to as the -15 region, (v) a

TTGACA at the -35 region, (vi) a spacer consisting of 17 nucleotides from the —10

to the —35 region, and (vii) an UP element rich in A and T [64]

The promoter has been developed in a systematic and comprehensive manner,and characterized for specific use in recombinant B subtilis [33] Strong promotersare required to achieve high levels of gene expression and production ofheterologous proteins [2] Various natural and artificial promoters, includinginducible promoters and constitutive promoters have been fabricated, characterized,

and frequently employed in recombinant gene expression in B subtilis for various

purposes [33]

16

1.2.2 Characteristics of an expression vector for B subtilis

1.2.2.1 General features

There are a number of components that are required for expression vectors to

perform their functions, as follows: (i) a replication origin; (ii) a selection marker(usually genes coding antibiotic resistance); (11) a promoter to initiate transcription

of heterologous gene; and (iv) multiple cloning sites (MCS) consisting of severalunique sites of restriction enzyme placed after the promoter to facilitate the cloning.Besides, fusion tags may also be introduced to the MCS for easy purification oftarget proteins At least one terminator must be included in plasmids to make surethat the transcription of the target gene can be efficiently terminated, anddownstream transcription can be eliminated (Fig 1.3) Additionally, for effectivetranslation, a ribosome binding site (RBS) with a Shine-Dalgarno sequence(UAAGGAGG) must be included at the sequence between -5 and -13 on plasmids[65]

affinity

we, tag cleavage site

promoter gene of interest

terminator

origin of

replication

antibiotic resistance

Fig 1.3 The schematic plasmid map showing the main component of

typical expression vectors

Promoter is shown in red, affinity tag is shown in orange, cleavage site is shown

in grey, the target gene is shown in purple, terminator is shown as a green circle,

antibiotic resistance gene is shown in blue, origin of replication is black [65]

Shuttle plasmids are commonly used in B subtilis because the efficiency oftransformation of B subtilis is relative low when used as the primary host for

17

cloning Shuttle plasmids include two distinct replication origins: one for replication

in E coli, and another for replication in B subtilis Therefore, E coli is used as the

host for the cloning steps, and B subtilis is used as the host for heterologous proteinproduction [2]

1.2.1.2 Replicative vectors

Plasmid vectors can be classified into two groups, based on the mechanism bywhich they replicate The first group employs the rolling circle mechanism toreplicate, and the second replicates using the theta mechanism The rolling circlemechanism is used by most plasmids smaller than 12 kb from the Gram-positivebacteria while the theta mechanism is used by larger plasmids The two modes ofreplication are distinguished mainly by the formation of single-stranded DNAintermediates by rolling circle mechanism plasmids [2]

Many plasmids derived from Gram-positive bacteria replicate by the circle mode, which is characterized by the uncoupled synthesis of leading andlagging strands from separate origins of replication: the single-strand origin and thedouble-strand origin In this mechanism, single-stranded DNA intermediates areformed at first, then they are converted to double-stranded DNA Double-strand

rolling-origins are often active in only a limited number of strains, and this affects the

efficiency of replication and plasmid stability Rolling-circle plasmids can existbetween 5 and 200 copies per chromosome in B subtilis [21]

Many plasmids replicating by the theta mechanism have been employed forvector development for B subtilis, such as the enterococcal plasmid pAMb1 andpWV0OI, and the endogenous B subtilis plasmids pLS20 and pBS72 Derivatives ofthe enterococcal plasmid pAMB1 have been used as the basis of a series of vectorsfor B subtilis For example, pHV1431, a B subtilis - E coli shuttle vector, carriesthe origin of pBR322 for replication in E coli and the pAMB1 origin for replication

in B subtilis This plasmid has a copy number of 200 in B subtilis, and long insertsare generally maintained stably Plasmid pWVOI from Lactococcus lactis is a small

(2,178 bp) cryptic rolling-circle plasmid that replicates stably in B subtilis, a variety

18

of other Gram-positive bacteria, and even in E coli pWVOI, which exists about 5copies in B subtilis but 50 — 100 copies in E coli, has also been used to developsome special-purpose vectors The general lack of native B subtilis antibiotic-resistance plasmids means that plasmids from other Gram-positive bacteria, such as

S aureus and L lactis, were initially used to develop cloning vectors for B subtilis.The replication origins and/or antibiotic-resistance genes of S aureus plasmids

pUB110, pC194, and pE194 are still in common use, even though endogenous

Bacillus plasmids have now been used to develop vectors [21]

Various systems have been constructed to control expression of genes at ahigh level in B subtilis Expression vectors can be based on either high-copy-number plasmids or integrative plasmids Integrative vectors tend to be more stablethan replicative plasmids when there is no selection, but they generally do notproduce heterologous proteins to such a high level because they have only a singlecopy of the target gene [21]

1.2.1.3 Integrative vectorsThe instability of plasmids can be overcome by insertion of target genes intothe host’s genome Integrative vectors are especially relevant for application of

B subtilis in industrial biotechnology Nevertheless, the shortage of integrativevectors and the complex structure of integrative vectors hinder expression of

multiple genes as well as integration of genetic circuit into B subtilis genome [3]

To solve these problems, a series of modular integrative vectors was generatedusing the Biobrick and Golden Gate DNA assembly method, including the BacillusBiobrick box [66], Bacillus Biobrick box 2.0 [39], and Bacillus SEVA siblings [67].Moreover, a systematic study was carried out on the effects of B subtilischromosomal loci on gene expression, and the results showed that expression levels

of the target gene reduced steadily from replication origin to replication terminuswith a five-fold difference [24]

Some well-studied, nonessential loci of the B subtilis genome are availablefor ectopic integration and expression of the target gene (Fig 1.4), such as the amyE

19

[68], gltA [69], lacA [69], pyrD [69], sacA [69], sacB [70], thrC genes [71], bpr,

epr, and vpr [41]

oriC

(0°)

lacA sacB

thrC

Bacillus subtilis chromosome

Fig 1.4 Location of some well-characterized loci for ectopic integration

on B subtilis circular genome

oriC: chromosomal replication origin, ter: chromosomal replication terminus

The amyE gene, which encodes a non-essential œ-amylase, is most commly

used to integrate target genes into the B subtilis genome [72] Location of the amyE

locus is near the oriC, and located at 28° on the circular chromosome of B subtilis

[67] The sacA and sacB genes code for sucrase and levansucrase, respectively Theformer is also close to the origin, at 333° [69], while the latter locates at 302° [70]

It is ready to dectect recombinant colonies with successful integration of targetgenes at the amyE, sacA, or sacB locus by using the simple color assays for œ-amylase or levansucrase [41] The /zcA gene, locating at 299°, codes for B-galactosidase, and is poorly expressed in B subtilis [72] The thrC, gitA, and pyrDcodes for threonine synthase, glutamate synthase, and polypeptide dihydroorotatedehydrogenase respectively While thrC is close to the oriC, and locates at 283°,pyrD gene at 139° and gitA gene at 172° are close to the terminus of the circularchromosome When these loci are used for ectopic integration of genes into B

20

subtilis genome, the integrants can be verified by a threonine auxotrophy, glutamate

auxotrophy, or pyrimidine auxotrophy tests [67], [73]

Generally, the integrated overexpression cassettes mostly contain antibioticresistance genes because it is rapid, efficient, and easy to use antibiotic resistancegenes as selectable markers The most common antibiotic resistance genes used inintegrative vectors are the spc, erm, tet, neo, kan and cat genes that providesresistance to spectinomycin, erythromycin, tetracycline, neomycin, kanamycin, and

chloramphenicol, respectively However, using antibiotic resistance genes as

selection markers has some disadvantages Firstly, the number of availableresistance genes restrict the number of sites that could be modified on the genome.Secondly, the physiology of the engineered strain could be affected the use ofmultiple antibiotics for selection Last but not least, FDA regulators in the UnitedStates and EFSA regulators in the European Union are more critical of strainscarrying antibiotic resistance genes that are used to produce commercial enzymesand metabolites As a result, it is increasingly preferable to eliminate antibioticresistance genes from expression cassettes on integrated chromosome or merely toconstruct genetically modified strains that are free of antibiotic-resistant genes [41]

1.2.3 Inducible expression systems

Inducible promoters are frequently employed to develop expression systems in

B subtilis, and have experienced considerable advances in recent decades.Numerous studies have paid attention on the new construction and modification ofinducible promoters, and applied them to the overexpression of various recombinant

proteins [33]

1.2.3.1 IPTG — inducible systems

The first promoter for protein production in B subtilis was Pspac developed

by Yansura and Henner in 1984 Pspac, induced by IPTG, consists of the SPO-1phage promoter and the Jac operator of E coli [74] Besides, the E coli T7 RNApolymerase system was adapted and utilized for gene expression in

B subtilis [75] Furthermore, Pgrac promoter based on PgroESL of B subtilis and

21

the Jac operator derived from E coli was developed for heterologous protein

bey Glycine oir | PE

riboswitch and œ-amylase

Except for Pspac, two other IPTG-inducible promoters, including T7 andPgrac, were modified and developed in B subtilis T7 promoter was used forcontrol the expression of the target gene integrated into chromosome B subtilis Forthis purpose, a B subtilis strain with a copy of the T7 gene coding for the T7 RNApolymerase on the chromosome under the control of Pspac was constructed Whenintegrated to B subtilis chromosome, T7 promoter could drive the production ofnattokinase encoded by aprN with a yield of 10,860 CU/mL, and endoglucanase E1

with a yield of 8.4 U/mL [78]

The other commonly used IPTG-inducible promoter was constructed by Phan

et al (2006) based on the hybridization of strong promoter groESL from B subtilisand the lacO operator Pgrac-based expression system was used to secretory

expression of a-amylase and cellulase A and B at high level, demonstrating that the

system is superior in producing enzymes of industrial relevance [76]

1.2.3.2 Pgrac promoters and pHT vectors

s* Perac promoters

The Pgrac promoter, generated by the fusion of the groESL promoter of

B subtilis and the lac operator of E coli (Fig 1.5.), is induced by IPTG [76] BgaBactivities produced by Pgrac01 is about 60-fold higher than those by Pspac, andBgaB protein synthesized by PgracO1 accumulating up to 10% of total cellularproteins [64] PgracO1 promoter has been used in the commercial plasmids,including pHTO1 and pHT43, which have been used by many researchers tosuccessfully produce various recombinant proteins, such as recombinant S-

layer/allergen fusion protein [86], dimerized bone morphogenetic protein 2 [87],recombinant human parathyroid hormone [88]

The Pgrac promoter was improved by introducing mutation at thetranscriptional start site, the -10, the -15, the -35 regions, and the UP element [64].Besides, the mRNA controllable stabilizing elements (CoSE) were constructed tocontrol mRNA stability in the cells [15] Consequently, a library consisting of 85

different Pgrac promoters of different strengths was generated [16]

23

TTGAAAttggaagggagattcttTATTATaagaattgt

-35 -10ggAATTGTGAGCGGATAACAATTeccaatt

lacO

aaaggaggaaggatcctctagagtcgacgtccccggggcagcc

RBS BamHI Xöal Aall ‘Smal

Fig 1.5 The Pgrac01 promoter and RBS sequence in the pNDH33 plasmid

The DNA sequence of the Pgrac promoter (in capital letters) including the upstreamAT-rich UP element, the lac operator (lacO; in capital letters) and the ribosome-

binding sequence (underlined) [64]

Fig 1.6 Secondary structures of the 5’-stem-loops

(A) 5’-stem-loops of pHTOI carrying Pgrac01 [15], (B) 5’-stem-loops of pHT212

carrying Pgrac212Among the strong Pgrac promoters, Pgrac57 was the result of optimizingPgracO1 at the -15 and the -35 regions In B subtilis host cells, it showed 38.8-foldhigher mRNA level and 17.9-fold higher BgaB activity than PgracO1 [16]

Pgrac100 was modified at the core promoter sequences (-35, -15) like

Pgrac57; moreover the UP element of Pgrac100 was also engineered In B subtilishost cells, it drives the synthesis of BgaB making up about 30% of the total cellularproteins [64] It was reported that Pgrac100 produced BgaB at high level in

B subtilis, but it still remained low background expression in E coli [13]

24