THAI NGUYEN UNIVERSITY UNIVERITY OF AGRICULTURE AND FORESTRY RYAN JAY AÑANA OGAO-OGAO EXAMINING THE FOOD ENVIRONMENTAL IMPACT: INCIDENCE AND ANTIBIOTIC RESISTANCE PROFILE OF SALMONELLA I
Introduction
Research Rationale
Chicken and pork play an important role in agricultural sector in Vietnamese economy However, the products are affected considerably by the complex diseases and the dynamic environment In this complexity, Salmonella is a major contributor to food- related infections, posing significant risks to both global public health and animal population In the United States alone, Salmonella is responsible for a staggering number of illnesses, hospitalizations, and food-related deaths each year (CDC, 2023) Furthermore, studies have consistently shown a strong connection between animal husbandry practices and foodborne illnesses, with salmonellosis being recognized as a major zoonotic disease (Stevens et al., 2006) Salmonella has been detected in various food sources worldwide
(Petersen & James, 1998; Li et al., 2013; Vo et al., 2006), including raw meats (Busani et al., 2005), vegetables (Miranda et al., 2009), and dairy products (Rodriguez-Rivera et al., 2016), which can become contaminated during various stages of handling, transportation, storage, and preparation due to factors such as unsafe slaughtering practices and unsanitary environments Additionally, Salmonella has the ability to persist in water, soil, and on surfaces, with the potential to survive for extended periods in these environments Failure to address the environmental impacts of Salmonella can have significant consequences for both the animal industry and human health (Davies and Wray, 1996; Ziemer et al., 2010)
In addition to the health risks posed by Salmonella infections, there is a growing concern over the development of antimicrobial resistance in this pathogen (Siriken et al.,
6 2015; Scallan et al., 2011) The frequent detection of multidrug-resistant (MDR)
Salmonella in food-producing animals globally, as reported by the World Health
Organization (2018), exposes humans to bacteria through contaminated food MDR
Salmonella is increasingly prevalent in food-producing animals worldwide, resulting in human exposure and the environment to antibiotic-resistant strains (Nguyen et al., 2016; Rodriguez-Rivera et al., 2016) Furthermore, Salmonella and other Enterobacteriaceae can develop resistance to β-lactam antibiotics, such as ESBLs, through the presence of resistance genes These genes can persist and be transmitted through animal-derived food products, acting as reservoirs for antibiotic-resistant bacteria (Proietti et al., 2020)
By embracing the One Health approach, which encourages collaboration among policymakers, veterinarians, public health officials, and researchers, a comprehensive understanding of the prevalence, transmission dynamics, and antibiotic resistance patterns of Salmonella in pork and chicken can be achieved This multidisciplinary approach enables the development and implementation of effective interventions, such as improved farming practices, surveillance programs, and antibiotic stewardship measures, to address the environmental impact of Salmonella Recognizing the importance of this organism in foodborne disease outbreaks and its consistent association with all aspects of pork and chicken, including its persistence in the environment, this integrated approach acknowledges the interconnectedness of human health, animal health, and the environment in addressing the challenges posed by Salmonella, ultimately enhancing our ability to protect public and environmental health (WHO, 2017)
7 Although several studies have examined the presence of Salmonella, limited information have investigated the foodborne pathogen and environmental impact of chicken and pork in Vietnam (Busani et al., 2005; Lestari et al., 2009; Sanchez-Maldonado et al., 2017; Shen et al., 2022) To address this research gap, a study was conducted in Hung Yen, Vietnam, with the aim of determining the contamination rate and incidence of antibiotic-resistant Salmonella in chicken and pork The overall objective of this research is to contribute to the understanding of the food environmental impact on the incidence and antibiotic resistance profile of Salmonella The findings of this study will provide valuable insights into the current state of contamination and antibiotic resistance in pork and chicken in Hung Yen, Vietnam This information can be utilized to develop evidence-based interventions and policies aimed at reducing the transmission of antibiotic-resistant
Salmonella, improving public health outcomes, and promoting sustainable and responsible practices in the food production industry in Vietnam.
Research Objectives
This study aimed to obtain information on the prevalence and patterns of antimicrobial resistance in Salmonella present in pork and chicken meat Specifically,
• To determine the prevalence of Salmonella isolated from chicken and pork meat in Hưng Yên, Vietnam
• To determine the antibiotic resistance profiles of Salmonella strains from isolated from pork and chicken using antimicrobial susceptibility testing
• Isolate and culture of a multi-resistant Salmonella strain for use in vaccines and
• To contribute to the broader understanding of the impact of the food environment on Salmonella incidence and antibiotic resistance in livestock production.
Research Questions and Hypotheses
Question: What is the incidence and antibiotic resistance profile of Salmonella isolated from pork and chicken samples and how does it vary between the two meat types?
Hypothesis: Salmonella is common in both chicken and pork, and the isolated bacterial strains exhibit a high level of drug resistance Additionally, it has been hypothesized that Salmonella isolated from chickens will have a higher prevalence and greater antibiotic resistance than those isolated from pork samples.
Scope and Limitations
The purpose of this study was to look into the frequency and antibiotic profile of
Salmonella found in chicken and pork meat samples This study's scope includes chicken and pork samples produced through different farming methods as well as meat samples collected from various geographic locations In order to gather information that either supports or contradicts the research question and hypotheses, this study uses a laboratory testing methodology The study attempts to address the growing problem of antibiotic resistance in zoonotic pathogens by providing information on strategies
The lack of sufficient and varied samples of chicken and pork meat due to a lack of funds, time, and resources may limit this research The equipment or technology used may
9 also have limitations on the laboratory testing process The quality and dependability of the research findings may be impacted by additional variables such sample handling, storage conditions, and microbial influence Finally, because to the complexity and variety of the samples gathered, data analysis and interpretation may be constrained However, the research may be able to isolate and control for potential confounding factors.
Definition
For the sole purpose of understanding, deep and scientifically specialized words are the list of terms used for this study and their corresponding meanings:
Antibiotic profile indicates the antimicrobial agents that a particular bacteria sample is resistant or susceptible to, and what concentrations these drugs can inhibit or kill the bacteria
Antimicrobial resistance refers to a phenomenon in which bacterial strains become resistant to the effects of antibiotics due to genetic mutations or the transfer of genes that encode for antibiotic resistance
Colonies are a group of bacteria and other microorganisms grown on a solid agar medium Resistance refers to an infection that is unlikely to respond to therapy
Susceptibility refers to an infection caused by an organism that is most likely to respond to treatment
Zoonotic pathogens are infectious microorganisms that can be transmitted from animals to humans through various routes such as inhalation, ingestion, or skin contact
Literature Review
Overview of Food Safety and Hygiene
Foodborne infections continue to pose a significant threat to human health and worldwide public health, resulting in significant monetary losses Up to one-third of people in wealthy countries get food-borne illnesses on an ongoing basis (European Food Safety Authority, 2019) In developing countries, this issue is significantly worse as there are an estimated 2.2 million cases of diarrheal infections every year that are primarily caused by tainted food and water (FAO, 2006) Unsafe food-handling practices in developing countries are a major contributor to foodborne illnesses, accounting for up to 70% of diarrheal cases (Zeru & Kumie, 2007) The global food safety landscape is continuously changing, making it challenging to ensure food safety With the increasing global trade in food, technological advancements, and the emergence of new foodborne hazards, it is necessary to assess and manage risks to meet growing and complex public health expectations (FAO/WHO, 2007) Thus, it is of utmost importance that national food safety authorities ensure safe food supply by addressing these challenges
Salmonella continues to be one of the most prevalent bacterial foodborne pathogens in the world, estimated to be responsible for 80 million instances of foodborne infections, 155,000 of which are fatal (Majowicz et al., 2010) Food poisoning from Salmonella is a common problem in both industrialized and underdeveloped nations (Badiu, 2005; Francis et al., 1992) Raw foods contaminated with Salmonella, particularly meat and fresh produce, cause illness in humans To lessen the possibility of Salmonella contamination in
11 raw foods, it is crucial to have proper farming and animal husbandry practices (Bell Kyriakides, 2002) Serotypes of the pathogen and the host's health status determine the severity of Salmonella infection in humans, with immunocompromised individuals, the elderly, and young children being more vulnerable (Eng et al., 2015)
Enteric fever, gastroenteritis, bacteremia, and extraintestinal focal infections are the four acute diseases that Salmonella enterica subsp enterica can cause (Beyene, 2008) The manifestation and progression of these infections depend on the host's immune status, genetic makeup, and pathogen dose (Francis et al., 1992) When consuming contaminated food or beverages, one can get Salmonella food poisoning; the amount and type of Salmonella consumed can affect how sick one becomes (Ricketts, 2010) Both humans and animals are susceptible to Salmonella, with the most frequent consequences being subclinical illness and healthy carrier status Animal food products are a source of the majority of Salmonella -related foodborne infections Consequently, tainted animal food can result in contaminated animal carcasses, which are then eaten by people and cause foodborne illnesses (Ricketts, 2010)
Foodborne infections are prevalent in underdeveloped nations due to poor food handling procedures and cleanliness, insufficient food safety legislation, lax regulatory systems, a lack of resources to purchase safer equipment, and inadequate training of the food-handling personnel (Food Safety | WHO | Regional Office for Africa, n.d.) Foodborne illness outbreaks have been linked to unsafe sources, tainted raw food, inadequate refrigeration and reheating of food, poor personal hygiene during food preparation, and extended times between food preparation and consumption (Du Toit & Venter, 2010)
12 Poor sanitation practices at catering facilities and the prevalence of harmful microorganisms as Campylobacter, Salmonella, Staphylococcus aureus, Bacillus cereus, and Escherichia coli have been shown by studies carried out in various regions of the country (Abera et al., 2010; Haileselassie et al., 2013; Woldemariam et al., 2010).
Overview of Salmonella
Salmonella is one of 32 genera in the Enterobacteriaceae family of enteric bacteria, first isolated in 1885 by Salmon and Sminth from the intestines of pigs infected with classical swine fever, now known as Salmonella (Eng et al., 2015) Later, in 1903, De Schweinitz and Dorset showed that cholera is caused by a virus, and identified S choleraesuis as the bacterium that causes paratyphoid Salmonella are gram-negative bacteria that are 0.7 x 1.5 x 2.5 m in size and have short rods with rounded ends (Barlow
& Hall, 2002; Holt et al., 2007) A temperature of 37°C was required for the growth
Salmonella can be distinguished from others by biochemical features, such as the formation of hydrogen sulfide, catalase and the absence of swine oxidase (Li et al., 2013)
Salmonella has the ability to thrive in various temperature and pH conditions, covering a range of 7°C to 48°C and pH 48 as stated by Baird-Parker (1994) Bacterial heat tolerance is low, with temperatures of 50°C for 1 hour, 70°C for 15 minutes, and 100°C for 5 minutes (Nguyễn Vĩnh Phước, 1970) A concentration of 3-4% NaCl in the medium can inhibit the growth of Salmonella (Holt et al., 2007)
According to the Kauffmann-White categorization system based on the structure of O-stem antigens and feathers becoming antigens, the Salmonella genus consists of two different species known as Salmonella enterica and Salmonella bongori, separated into more than 3000 serotypes (Grimont and Weill, 2007; S H Chen et al., 2021; Cowan, 1974)
Taxonomic ranks of Salmonella (Schoch et al., 2020)
Kingdom: Bacteria Phylum: Proteobacteria Class: Gamma Proteobacteria Order: Enterobacteriales Family: Enterobacteriaceae Genus: Salmonella
The antigenic structure of Salmonella is complex and mainly consists of three main types:
Somatic O antigen: The O strain antigen is found in bacterial cell walls It is not a toxin, but a pathogenic factor of bacteria that helps bacteria fight phagocytosis against the body's defenses (Morris et al., 1976) The component forms the outer membrane of the bacterial Lipopolysaccharide (LPS) has a large molecular structure comprising three distinct regions: the hydrophilic, core, and lipid regions The O-antigen
14 is located in the hydrophilic region, which consists of two groups: the polysaccharide is located inside, has no hydrogen group, does not bear the properties of the antigen, and only makes the difference in the colony morphology from the S to R form Polysaccharide are external, have one hydrogen group, determine antigenicity, and are specific to each individual strain (Morris et al., 1976) The O-antigen consists of several oligosaccharides Sequential oligosaccharides are the basic building blocks of KN-O, which belongs to a group of gram-negative bacteria The composition, arrangement order of the sugars, and linkage between them determine the antigenic properties of O and contribute to the diversity of Salmonella sugar strains (Liu et al., 2018) The O antigen exhibits three properties: heat resistant, which is destroyed at 100°C after 2 h Resistance to ethyl alcohol: Contact with 50% alcohol is nondestructive Easily destroyed by formol at 5% concentration
Flagella H Antigen: A protein found on bacterial hair with poor heat resistance, destroyed at 70°C, easily destroyed by alcohol, weak acid, stable up to 5 formals, less stable than O-antigen ((Nguyễn Như Thanh and Nguyễn Bá Hiên, 2001) The H antigen is not important for creating preventive immunity, but it is important for classifying and identifying bacteria (Lê Văn Phủng, 2012) According to TCVN (10780-3:2016 (ISO/TR 6579-3:2014), 2016), Antigen-H is divided into two phases: Phase 1 has specific properties, Phase 2 has no specific properties, and this phase can agglutinate with other types of Antigen-H This ingredient is sometimes found in Escherichia coli
K antigen: In addition to the -O antigen, some bacteria have soluble antigens on their surface, called envelope antigens (K antigens) There are three types of -K antigens
15 in Salmonella: antigen 5, Vi antigen, and M antigen The -K antigen helps bacteria build a protective barrier against foreign body influences and phagocytosis (Quinn et al, 2002) Pili Antigen: It protein found naturally on the pili of bacteria and in the fimbrial structure The pili antigen is an important pathogenic factor that helps Salmonella attach to the villi of the intestinal mucosa and thus have the opportunity to invade the host cell
Salmonella pathogenicity involves non-toxic and toxic factors
Toxic factors: A direct agent that determines the pathogenesis of bacteria
Salmonella produces three main toxins: enterotoxins, endotoxins, and cytotoxins (Finlay
Enterotoxins: Enterotoxins from Salmonella consist of two main components: a fast dialysis toxin and a slow osmotic toxin (Peterson, 1980) The Rapid Permeability Factor (RPF) withstands temperatures of 100°C for 4 h and can be stored at -20°C RPF stimulates the guanylate cyclase enzyme system in intestinal epithelial cells, thereby preventing the electrical absorption of barrier electrolytes and water in the intestinal cavity, leading to intestinal mucosal irritation and diarrhea (Clarke et al., 1988) The Delayed Permeability Factor (DPF) is destroyed after 30 minutes at 70°C and after 4 hours at 56°C DPF disrupts the exchange of water and electrolytes, leading to increased excretion of these substances into the intestinal lumen This hindered absorption can result in diarrhea, as explained by Peterson in 1980
Endotoxin: Endotoxins, such as LPS are pathogens of gram-negative bacteria that are involved in the development of gram-negative shock (Galanos & Freudenberg, 1993)
16 LPS is a component of bacterial cell membranes and is considered an endotoxin of
Salmonella LSP acts on phagocytes, polymorphonuclear leukocytes, leukocytes, platelets, the liver, kidney, cardiovascular system, digestive system, muscles and host immune system LSP slows complement activation, helps bacteria survive in the stomach and intestines, and promotes the invasion of epithelial cells (Finlay & Falkow, 1988)
Cytotoxins: According to Clarke et al (1988) cytotoxins cause cell damage and toxicity Cytotoxins are not lipopolysaccharides and are found in the outer membrane of Salmonella They can inhibit protein synthesis in eukaryotic cells and damage epithelial cells Both properties are toxic to the cell and help bacteria to enter the cell
Elements that are not toxins
Non-toxic factors include the O antigen, K antigen, H antigen, adhesion factor, ability to enter cells, ability to synthesize iron, and resistance to antibiotics These factors act through different mechanisms and in different ways to create favorable conditions for pathogenic bacteria
Adhesion Factor: Most bacterial species begin their pathogenicity by adhering to the villi of the intestinal lining (epithelial cells), which allows them to enter the host (Jones and Richardson, 1981) According to Finlay and Falkow (1988), the ability to penetrate nucleated cells or the intestinal mucosa is characteristic of some virulent Salmonella Salmonella strains that cannot enter cells are usually nonviable Upon reaching the host cell, Salmonella act by increasing intracellular Ca2+ levels, activating the actin- depolymerizing enzyme, altering the structure and shape of actin filaments, and altering the cell membrane, resulting in the formation of pseudocysts, giving bacterial cells a form
17 of bacteria enclosing vacuoles Salmonella enters the cell, lives there and multiplies rapidly, kills the host cell, produces enterotoxins, and causes diarrhea in the host (Frost et al., 1997)
The ability to synthesize iron: According to Benjamin et al (1985), this factor contributes to the rapid increase in Salmonella and the weakening of host resistance due to iron deficiency Salmonella respond to changes in the iron transport mechanism; when iron synthesis is inhibited, they transfer all iron-regulating membrane proteins to the surface of bacterial cells, significantly increasing iron uptake
Each Salmonella species can ferment certain carbohydrates Most Salmonella strains produce sugars such as glucose, galactose, mannose, mannitol and arabinose during their fermentation process (Nguyễn Như Thanh and Nguyễn Bá Hiên, 2001) Several
Salmonella species, including S abortus equi, S abortus ovis, S abortus bovis, S typhi, and S typh suis, also ferment these sugars without gas formation
Salmonella often have the ability to hydrolyze nitrate to nitrite and produce H2S, break down glucose into gas and use citrate as the sole carbon source ((Đào Trọng Đạt and Phan Thanh Phượng, 1995) Most strains of Salmonella secrete the enzymes needed to decarboxylate lysine Except for S paratyphi, S abortusequi, and S typhisuis, the following parameters were positive: catalase, urease reaction, indoor, Methyl Red (MR), Voges-Proskauer, and H2S With the exception of S paratyphi, S abortus and S typhisuis, the urease reaction was negative, indoor negative, methyl red (MR) positive, Voges-
Salmonella Detections and Isolation Methods
For the monitoring and management of Salmonella infections, effective and trustworthy laboratory techniques for the isolation, detection, and characterization of
Salmonella in diverse samples are crucial (Lee et al., 2015) Various methods of
Salmonella isolation have been introduced and implemented worldwide However, the ideal method must ensure high sensitivity and specificity, while being simple, fast, and inexpensive No single method can meet all these criteria, and no single method is optimal for all purposes Success in isolating Salmonella from any food source can be considered in terms of many factors, including sample preparation methods, number of organisms presented, diversity of competing flora in raw samples, handling, etc.(USDA-FSIS, 2017)
Salmonella, in addition to a variety of other germs, can spoil and stress food
Therefore, preliminary non-selective pre-enrichment and a combination of selective and cultural media are often conducted to reduce the possibility of unfavorable effects First, damaged Salmonella cells from the food matrix were harvested and multiplied in nonselective liquid media using pre-enrichment (Andrews et al., 2018) It is common practice to employ a variety of liquid pre-enrichment media, such as buffered peptone water (BPW) and lactose broth (LB) (Fricker, 1987) According to WHO in 2010, using BPW water for initial and non-selective enrichment complies with ISO's standards (ISO 6579-2002) for Salmonella spp detection in food
Many types of selective culture media are used for Salmonella isolation
After 24 hours, bacteria develop into S-shaped colonies (smooth), round, smooth, with clean margins and slightly convex in the center, slightly moist and sparkling (Nguyễn Như Thanh & Nguyễn Bá Hiên, 2001)
On BS agar: After 48 h of culture at 37 °C, Salmonella grew characteristic colonies; around the colonies they were dark brown, in the center of the colonies, the darker the colonies turned closer to black, and the colonies had a dark brown color and metallic color
On MacConkey agar, the bacteria developed into spherical, transparent, colorless, smooth, and slightly convex colonies after 18–24 hours at 35–37 °C
On XLD (Xylose-Lysine-Deoxycholate) agar, bacteria grow at 37 °C in glossy, convex colonies with a black center dot, and a dark pink base (Aspinall et al., 1992)
On SS agar (Salmonella - Shigella), at a temperature of 35-37 °C, bacteria grow after 18-24 hours into round, colorless, smooth colonies with a black spot in the middle
Bacteria grow as pale colonies on TSI agar; the medium's slope is red; the bacteria exclusively digest glucose, thus the bottom of the test tube is yellow; and the bacteria themselves are responsible for the test tube's middle being black H2S gas, when left for a long time, the black color overwhelmed the acid reaction and lost the yellow color at the bottom of the test tube Vapor-producing bacteria crack the agar and the gas pushes the agar off the bottom of the test tube
Salmonella that is motile can only grow on MSRV agar, where the bacteria move around and form an obvious white ring
Several rapid identifications approaches utilizing molecular DNA amplification technologies have been created and are currently offered in the market These techniques allow for the rapid turnaround of data and the detection of Salmonella spp in high sample volumes The new selective medium expressed by color emission, immunological tests, and tests based on nucleic acids are all included in the quick detection approach Techniques like PCR and enzyme-linked immunosorbent test (ELISA) are frequently employed While PCR has a sensitivity of 104 CPU/ml, ELISA can identify Salmonella at concentrations of 104-105 CPU/ml The microbiota in the sample, the matrix, and the inhibitor (such as lipids, proteins, polysaccharides, heavy metals, antibiotics, and chemicals) (organic matter) are what determine how sensitive and specific these procedures are (Ta et al., 2014) However, the use of an immunological method based on the principle of antigen-antibody specificity has the disadvantage that false positive results can easily occur The detection method is now based on biotechnological molecular technology (PCR, multiplex PCR, RT-PCR) for fast, more accurate, more precise and more specific test results
In a PCR variant known as multiplex PRC, several target sequences can be amplified by using several primer pairs in the same reaction (Markoulatos et al., 2002) This method could result in significant time and effort savings in the lab Since its first recording in 1988 (Chamberlain et al., 1988), multiplex PCR has been utilized successfully
22 in a number of DNA testing applications, including gene deletion studies (Chamberlain et al., 1988), study of polymorphism and mutation (Shuber et al., 1993), quantitative analysis (Zimmermann et al., 1996), and reverse transcription (RT)-PCR (Crisan, 1994) Multiplex PCR has shown to be an effective method for virus detection (Markoulatos et al., 2000) and bacteria (Hendolin et al., 1997) regarding infectious illnesses In the study by Xu et al (2019), PCR reactions were performed in a volume of 25 μL containing 0.25 μL of 2.5 U/ μL Taq DNA polymerase and 2 5 μL of 10PCR contained buffer, 2 μL of 2.5mM dNTPs, 8 μL of primers (10M of each primer), and 1 μL of DNA template PCR amplifications were performed with an initial denaturation step at 94°C for 3 mins, 30 cycles of 94°C for 30 s, 58°C for 30 seconds, and 72°C for 35 seconds, followed by a final extension step at 72°C for 10 s The products were visualized by 2% agarose gel electrophoresis in 1% Tris-acetate-ethylenediaminetetraacetic acid (EDTA) buffer (TAE) (40mM Tris-acetate, 1mM EDTA)
In the study by Xu et al (2019), PCR reactions were performed in a volume of 25 μL containing 0.25 μL of 2.5 U/ μL Taq DNA polymerase and 2 5 μL of 10PCR contained buffer, 2 μL of 2.5mM dNTPs, 8 μL of primers (10M of each primer), and 1 μL of DNA template PCR amplifications were performed with an initial denaturation step at 94°C for
3 mins, 30 cycles of 94°C for 30 s, 58°C for 30 seconds, and 72°C for 35 seconds, followed by a final extension step at 72°C for 10 s The products were visualized by 2% agarose gel electrophoresis in 1% Tris-acetate-ethylenediaminetetraacetic acid (EDTA) buffer (TAE) (40mM Tris-acetate, 1mM EDTA)
Antimicrobial resistance
Antibiotics are special compounds produced by microorganisms, animals, and plants, and are synthesized by humans that kill or inhibit microorganisms, even at very low concentrations(Bùi Thị Tho, 2003) Low-molecular-weight naturally occurring substances produced by bacteria or fungi are known as antibiotics, and they either kill or prevent the growth of other microbes (Gualerzi et al., 2013) They are commonly used in modern healthcare to treat infections (Gualerzi et al., 2013) Antibiotics can be categorized into several classes based on their chemical makeup and method of action, including β-lactams, aminoglycosides, anthracyclines, (fluoro)quinolones, tetracyclines, lincosamides, and sulfonamides
Bacteria are considered to be resistant to a specific antibiotic when antibiotics are no longer effective in treating a disease caused by a specific bacterial pathogen (Calo et al., 2015) There are many mechanisms of antibiotic resistance in bacteria, the five most common of which are enzymes inhibiting antibiotic activity, changes in penicillin-binding proteins (PBPs), porin mutation, pump that pushes the antibiotic out of the cell, and cell wall changes (Calo et al., 2015)
Chemicals that combat bacteria, viruses, fungi, and parasites are referred to as
"antimicrobials" (CDC 2013) The US Food and Drug Administration defines antimicrobials as substances that affect wide variety of microorganisms, such as bacteria, viruses, fungi, and parasites (USFDA, 1999) In contrast, antibiotics have a limited range of action despite being predominantly effective against germs
An individual or bacterial species is said to be resistant if it can survive and thrive in an environment with an antibiotic concentration higher than the concentration that prevents it from reproducing widely in other people of the same culture or other people of the same species Due to the fact that some bacterial species are not affected by antibiotic resistance, the phenomena of bacterial drug resistance can be split into two primary categories: natural resistance and acquired resistance This is due to the antibiotic's inability to penetrate the target or its low affinity for the target This resistance is persistent and chromosomally derived, stable, and passed on to the offspring during cell division, but not transmitted from one bacterium to another (Guardabassi & Courvalin, 2006)
In both human and veterinary medicine, antimicrobial resistance is an issue that is getting worse (Silbergeld et al., 2008) Bacteria exhibiting multidrug resistance (MDR) can simultaneouslt resist the effects of multiple antibiotics (CDC, 2010) Antimicrobials can be categorized in a number of ways, using a variety of widely used classification methods based on mechanism of action (Collignon et al., 2009) There are different modes of action (Tenover, 2006):
• Inhibition of cell wall synthesis: B-lactams (penicillins, cephalosporins, carbapenems, and monobactams) inhibit the peptidoglycan layer's development by inhibiting enzyme activity
• Inhibition of Protein Synthesis: Using their antibacterial properties to prevent the synthesis of acidic nucleic acids, macrolides, aminoglycosides, tetracyclines, chloramphenicol, streptogramins, and oxazolidinones all suppress protein synthesis Contrary to chloramphenicol, which binds to the 50S subunit of the ribosome,
25 aminoglycosides, macrolides, and tetracyclines all function in a similar ways by binding to the 30S component of the ribosome
• Disruption of nucleic acid production: fluoroquinolones use their antibacterial effects to disrupt DNA synthesis Suppression of metabolic processes: To prevent DNA synthesis, sulfonamides and trimethoprim interfere with the metabolic pathway of folic acid synthesis The same pathway is inhibited in two steps by a combination of trimethoprim and sulfamethoxazole
Antimicrobial resistance can develop as a result of bacterial mutations, acquisition of genetic information encoding resistance from other bacteria, and alteration of target structures ((Schwarz & Chaslus-Dancla, 2001; Tenover, 2006) This process results from the strain on selection brought on by the use of antibiotics (Michael et al., 2014) Because these bacteria possess resistance to self-defense, resistance genes may originate from the bacteria that produce antibiotics (Schwarz & Chaslus-Dancla, 2001) The resistance genes encode proteins that provide resistance to a certain class or agent of antibiotics These resistance genes can be transmitted to other bacteria by mobile genetic element (Schwarz
Overview of β-lactamase
The most significant antibiotics in terms of quantity and value are thought to be β -lactam antibiotics because of their great efficacy, low toxicity, and potential for derivatization by chemical and enzymatic processes (Schmid and Hammelehle, 2006) A significant issue in the treatment of gram-negative bacteria is β-lactamase These include broad-spectrum lactamase enzymes, which can hydrolyze penicillin and the majority of
26 cephalosporins, or penicillinases, which are resistant to penicillin antibiotics.(Calo et al., 2015)
Salmonella and other Enterobacteriaceae species have been found to contain broad- spectrum β-lactamase (BSBL) genes The first BSBL gene discovered was TEM-1, which was found in Escherichia coli in the 1960s Since then, several other BSBL genes have been discovered in Salmonella, including SHV, CTX-M, and OXA (Pitout & Laupland,
2008) In 1983, the first case of ESBL was found in a cefotaxime-resistant Klebsiela ozaenae strain in Germany, which was named SHV-2 Notably, CTX-M helps bacteria to degrade most of the 3 rd and 4 th generation cephalosporin antibiotics (Paterson & Bonomo, 2005)
The double-disk synergy test evaluates the inhibition of broad-spectrum cephalosporin antibiotics in the presence of clavulanic acid in order to identify extended- spectrum β-lactam (ESBLs) As a result, an inhibition zone forms around the amoxicillin- clavulanate-coated paper plates A positive test is indicated by the formation of a bottleneck antibacterial zone and the extension of the antibiotic disc's sterile ring towards the junction of the amoxicillin-clavulanate disc This test is a reliable and easy-to-implement method for detecting ESBLs (Drieux et al., 2008)
A synergistic action between discs containing ceftazidime or cefotaxime in conjunction with clavulanic acid is the foundation of the combined disk approach An antibacterial ring diameter of the cephalosporin/clavulanic acid disc that is less than or equal to 5 mm in comparison to that of the cephalosporin disc indicates the presence of an ESBL strain (CLSI, 2015)
27 The two-way E-test paper tapes used in the e-test ESBL method contain low to high dilutions of broad-spectrum cephalosporin antibiotics as well as cephalosporin coupled with a compound containing clavulanic acid A decrease in the MIC value of the drug tested by more than three stages of dilution in the presence of clavulanic acid is indicative of a positive ESBL test result However, this approach might not work if the MIC values for cephalosporins are higher or lower than the MICs listed on the test strip (Cormican et al., 1996; Linscott & Brown, 2005)
Methods
Research Period, Location and Sampling
Chicken (n) and pork (n) samples (Figure 3.1) were collected randomly following the TCVN 7925;200 at markets in Hung Yen, Vietnam Samples were placed in a sterile specialized sample bag and place in an ice box Collected sample were transported to the Laboratory of Bacteriology, Veterinary Hospital, Department of Veterinary Medicine, Faculty of Veterinary Medicine, Gia Lam, Hanoi, and cultured according to ISO 6579-2017 procedures within 24 hours Sample names were individually coded and other information was recorded, such as sampling time, temperature, store name, location, and type of sample
Figure 3 1 Chicken and pork meat at the market after slaughter
Isolation of Salmonella from Meat Samples
Figure 3 2 Diagram of isolation of Salmonella
Salmonella was isolated from meat samples in accordance with TCVN
Sample preparation: Upon arrival at the laboratory, 25 g meat samples undergo a process of cutting into smaller pieces The pieces of meat were then placed in a Petri dish, and further isolation procedures were carried out
Figure 3 3 Preparation of meat samples
Non-selective enrichment: 25 g of meat samples were homogenized in 225 ml of buffered peptone water using a Stomacher machine for one minute at 230 rpm The prepared samples were then incubated at of 37°C for 18 h
Proliferation on selective medium: 1 ml of the primary enrichment solution was inoculated into 10 ml of Rappaport-Vassiliadis with soya (RVS broth) and 10 ml of Müller-
31 Kauffmann tetrathionate broth (MKTT) After inoculation, RVS broth was incubated at 41.5°C for 24 h, whereas MKTT broth was incubated at 37°C for the same 24-hour period
To select agar plates containing xylose lysine deoxycholate (XLD) and bismuth sulfite (BS), the proliferative solution was taken up by the cultivated selective agar The inoculated plates were then incubated at 37°C for 24 hours To confirm the presence of
Salmonella , typical colonies were harvested from XLD agar (identified by a black center, glossy convexity, and inner border) and BS agar (round, brown and with a green inner border) and plated onto two media NB and MR-VP for Gram staining and biochemical analysis, including TSI, Indole, Methyl Red, and SC Potential Salmonella strains were stored in Eppendorf tubes containing 20% glycerol solution at -20 °C
Gram staining: Take 1-2 drops of Salmonella grown in NB medium Staining was performed as follows:
Step 1: The slides were stained with crystal violet solution and allowed to stand for
30 s to 1 min before rinsing with water
Step 2: Lugol's solution was added and left for 1 min before further rinsing the slide with water
Step 3: A 90% alcohol solution was added and allowed to stand for approximately
30 s or until the slide became clear The slides were then rinsed with water
Step 4: The slides were stained with fuchsin solution for 1 min before rinsing thoroughly with water and drying
32 The slides were examined under a microscope with a 100x oil objective lens
Biochemical indicators: Two media (NB and MR-VP) were used to cultivate typical Salmonella colonies, which were subsequently incubated at 37°C overnight The following particular indicators were used to examine biochemical properties:
To detect the presence of Salmonella, a small amount of the corresponding broth grown in NB medium was injected into TSI agar up to 2/3 of the vertical agar and then inverted on the sloping surface of the agar Incubation was performed at 37°C for 18-24 hours The resulting features indicating the presence of Salmonella in typical TSI agar were as follows: pink alkaline sloped agar (lactose (-)), yellow acidic stand agar (glucose (+)), blackened agar bottom (H2S (+)), and broken or raised agar bottom (steam(+))
Colonies from the TSI-sloped agar were used to perform further biochemical reactions
In urea broth, the typical strains of Salmonella do not have the ability to break down urea, resulting in no change of color in the urea agar and a negative reaction (-) Conversely, a positive reaction occurs owing to the release of ammonia, resulting in the phenol acquiring a pink-purple color
Salmonella strains were examined on a lysine medium, where the characteristic burgundy color (+) was retained and any (-) reactions appeared yellow Transferring
Salmonella broth from NB medium to Tryptone/Tryptophan medium and incubating it at
37°C for 24 hours allow for the testing of Indole production using IMViC reactions The medium tube tested positive when 2-3 drops of Kovacs Reagent were added; in contrast, the surface of the tube showed a tan ring in the case of a negative reaction
Reaction with Methyl Red (Methyl Red): A test tube containing 1 ml of MR-VP broth and five drops of the methyl red reagent was used for the methyl red reaction The broth remains red in the presence of a positive Salmonella test, while a negative outcome causes the broth to turn yellow
Vosges-Proskauer reaction: 1 mL of MR-VP broth must be transferred to a different test tube, along with 0.6 mL of naphthol alcohol solution and 0.2 mL of 40% potassium hydroxide solution, before being thoroughly shaken Readings taken between 5 and 15 minutes later reveal a yellow surface ring for a positive reaction and a red surface ring for a negative (-) reaction
On Simmons Citrate Agar: Salmonella induces a positive reaction (+), which causes a medium shift from green to blue, confirming the presence of Salmonella Bacterial cultures were cultivated on Simmons Citrate Agar slants, followed by incubation at 37°C for 24 h On the other hand, if Salmonella was not present, the medium's color remained unaltered
The agar dilution technique, involving the determination of minimum inhibitory concentrations (MICs) of antibacterial substances, including antibiotics, is a widely used method This was performed to determine the effectiveness of antibacterial agents against bacterial inhibition (bacteriostatic activity) or killing (bactericidal activity) The MIC value was used to assess the susceptibility of bacteria to antibiotics and to evaluate the activity of the newly developed antibacterial agents In this study, we determined antibiotic resistance by applying standardized bacterial concentrations to the surface of antibiotic
34 agar plates and visual inspecting the agar plates carried out to detect any inhibition mechanism for bacterial growth
Preparation of bacterial strains: Prior to antibiotic testing, both test and control strain were inoculated into LB broth Any isolated Salmonella colonies found on TSA were inoculated into LB broth and cultured at 37°C for a period of 4-6 hours in order to reach a bacterial concentration of 107 CFU/ml
Figure 3 4 Preparation of Antibiotic Agar plates
Dilution of Agar: The MHA medium was prepared based on the guidelines of the
Clinical and Laboratory Standards Institute (CLSI, 2018b) For each antibiotic tested, the required volume of antibiotic solution was prepared and applied to the agar, creating a test area The mixed antibiotic was then added to MHA agar at 1:9 ratio and maintained at approximately 50°C in a water bath The agar plates had a thickness of 3-4 mm (Figure 3.12), and the antibiotic plates were stored at 4-6°C
Antibiotic Test: The Antibiotic plates were taken out of the refrigerator, sealed, and allowed to stabilize for an hour at room temperature This period is necessary to minimize water vapor buildup on the agar surface The bottom of the agar plates was labeled clearly to denote the test strains as well as the antibiotic concentrations to be tested Drops of bacterial suspension, measuring 3-5 μl, were placed precisely on the marked positions on the agar plate using a pipette or a culture stick The plates were then left at room temperature until the bacterial suspensions were absorbed and the surface was dry Finally, the plates were transferred to their incubation chambers, which were maintained at a 37 °C temperature for a period -16-20 hours
Detection of Salmonella strains with ESBL Phenotype
To detect Salmonella strains displaying resistance to cefotaxime and possessing the ESBL phenotype, a combination method was used in accordance with the Clinical and Laboratory Standards Institute guidelines (CLSI, 2018c) Selected resistant strains were cultured on Mueller Hinton agar, and a sterile cotton swab was used to spread a thin layer of bacterial suspension with a turbidity equivalent to 0.5 McFarland (108 CFU/mL) on the agar surface, followed by 10 mins of drying at room temperature Sterile forceps were used to place plates containing ceftazidime (30 g/l), ceftazidime (30 g/l) + clavulanic acid (10 àg), cefotaxime (30 g/l), and cefotaxime (30 g/l) + clavulanic acid (10 àg) onto the agar and incubated at 37°C for 16-18 hours The plates were then observed the next day, and a positive association (synergy test +), indicating the presence of ESBLs, was concluded if the diameter of the sterile ring on the plate with clavulanic acid was greater than that of the plate without clavulanic acid by more than 5 mm Conversely, a negative association concluding the absence of ESBLs (synergy test) was concluded if the diameter of the sterile ring on the plate with clavulanic acid compared to the plate without clavulanic acid was less than 5 mm.
Detection of Genes Enconding ESBL
3.5.1 Preparation of sample and primer DNA
The strains with the ESBL phenotype were tested for the presence of ESBLs encoding genes using the multiplex PCR technique The DNA of these strains was extracted by the boiling method The primer pairs used for PCR in this study is shown in Table 3.2
Table 3 2 Summary of primers used for amplification of the β-lactamase (Le et al.,2015)
The composition of the PCR reaction and the thermal cycles are described in Tables 3.3 and 3.4
Target group Primers Sequence 5’-3 Amplified product (bp)
CTX-M-1 ctxm1-115F GAATTAGAGCGGGAGTCGGG 588 ctxm1-702R CACAACCCAGGAAGCAGGC
CTX-M-2 ctxm2-39F GATGGCGACGCTACCCC 107 ctxm2-145R CAAGCCGACCTCCCGAAC
CTX-M-9 ctxm9-16F GTGCAACGGATGATGTTCGC 475 ctxm9-490R GAAACGTCTCATCGCCGATC
Table 3 3 Components of the PCR reaction
Component Concentration Volume (àl) dNTPs 0.2 mM 2.5
Table 3 4 Thermal cycle of the PCR reaction
Following amplification, the PCR products were examined on a 1.5% agarose gel in 1x TAE buffer (Le et al., 2015) When the position of the colored line reached 2/3 of the gel, the electrophoresis procedure was finished at 75V, 300A After 30 minutes of ethidium bromide staining, the gels were scanned using a Universal Hood II gel electrophoresis camera (Biorad)
Results and Discussion
Isolation and Identification of Salmonella
Salmonella is a significant foodborne illness that poses a threat to public health
(Bean et al 1997) It is one of the most common bacteria found in raw meat and other food products In this study, 93 (46.97%) of 198 pork and chicken samples tested positive for
Table 4 1 Results obtained from the isolation of Salmonella in samples from chicken and pork
As shown in Table 4.1, both chicken and pork had relatively high levels of
Salmonella contamination, with 49 (49.49%) chicken samples and 44 (44.44%) pork samples testing positive These results are similar to those of a study conducted in Northern Vietnam (39.6% in pork and 42.9% in chicken, Thai et al., 2012) and Southern Vietnam (50% in pork and 49.62% in chicken, Truong et al., 2021), but higher than those reported by other researchers such as Lertworapreecha et al (2012); Nguyen et al (2016); Zhang et al (2018), reported prevalence levels of more than 60% It is worth noting that prevalence rates can vary across different studies due to geographic location, methodology, seasonal variations, and farming and slaughtering practices
Type of meat No of sample No (%) of Positive sample
41 The high rate of Salmonella contamination found in the study has significant implications for the environmental impact of foodborne diseases Our study's high-rate
Salmonella spp isolation from samples of chicken and pig suggests that these meats are important sources of human salmonellosis, according to Foley and Lynne (2008) This highlights the need for effective control measures throughout the food production chain, from farms to consumers Contamination can occur at various stages, including farming, slaughtering, processing, and handling, which can contribute to the environmental impact through the release of contaminated waste and byproducts Additionally, the study's findings indicate that unsanitary processing, subpar cleaning, insufficient handling, and environmental contamination after processing contribute to the high incidence rates of
Salmonella These practices can lead to the release of pollutants into the environment, including water bodies and soil, which can have adverse effects on ecosystems and human health.
Antibiotic Susceptibility Test
The administration of antibiotics to livestock and poultry for disease treatment and prevention has been a successfully, consequently improving production efficiency in the agricultural sector However, indiscriminate use of antibiotics by farmers, especially for growth promotion, has resulted in selective pressure on bacteria, leading to diseases that could initially be effectively treated with antibiotics becoming resistant to treatment According to Dafale et al (2020), the uncontrolled use of antibiotics for growth promotion and prophylactic treatment in chickens and pigs has significantly contributed to the
42 emergence of antibiotic resistance in zoonotic bacteria Furthermore, bacteria can transmit resistance to other bacteria that cause diseases, leading not only to animal health concerns, but also, to human health
To determine resistance patterns towards a panel of veterinary antibiotics, 15 commonly used antibiotics were tested against isolates obtained from chicken and pork samples The results are presented in detail in Table 4.2 and Figure 4.1
Table 4 2 Rate of antibiotic resistance of Salmonella isolated from chicken and pork
No (%) of resistance isolates from:
Streptomycin 22 (44.9) 19 (43.18) 41 (44.09) Macrolides Azithromycin 13 (26.53) 10 (22.73) 23 (24.73) Tetracyclines Tetracycline 42 (85.71) 38 (86.36) 80 (86.02) Phenicols Florfenicol 31 (63.27) 29 (65.91) 60 (64.52)
Ge nt am yci n Str ep to my cin Azi thr om yc in
Te tra cyc lin Flo rfe nic ol
Na lid ixi c a cid Cip ro flo xa cin
Su lfa me tho xa zo le/ Tri me tho pr im e
Antbiotic resistance rate of Salmonella (%)
Chicken Pork The highest resistance observed amongst chicken samples was to tetracycline (85.71%), followed by ampicillin (77.55%), sulfamethoxazole/trimethoprim, and florfenicol (63.27%), nalidixic acid (53.06%), streptomycin (44.9%), gentamycin (30.61%), cefotaxime (28.57%), cefepime (28.57%), azithromycin (26.53%), cefoxitin (16.33%), and ceftazidime (12.24%) On the other hand, in pork samples, the highest resistance observed was also to tetracycline (86.36%), followed by ampicillin (68.18%), florfenicol (65.91%), sulfamethoxazole/trimethoprim (47.73%), nalidixic acid (43.18%), streptomycin (43.18%), gentamicin (34.09%), cefotaxime (27.27%), azithromycin (22.73%), and cefepime (11.36%) and low resistance to ciprofloxacin (4.55%), ceftazidime (6.82%), and cefoxitin (6.82%) Nonetheless, all the isolates were susceptible to meropenem and colistin
Figure 4 1 Percentage of Salmonella isolates exhibiting resistance to various antibiotic types
44 Notably, compared to pork samples, Salmonella isolates from chicken samples had a greater rate of antibiotic resistance Tetracycline (86.02%) and ampicillin (73.12%) had the highest prevalence of resistance, followed by florfenicol (64.52%), sulfamethoxazole/trimethoprime (55.91%), nalidixic acid (48.39%), streptomycin (44.09%), gentamycin (32.26%), cefotaxime (27.96%), azithromycin (24.73%), cefepime (20 Meropenem was effective against every isolate, although minor levels of resistance to colistin (3.22%) and ciprofloxacin (4.30%) were found These results are in accordance with other studies that showed gastrointestinal bacteria to have significant levels of tetracycline, ampicillin, and streptomycin resistance, according to Tu et al (2015) The resistance patterns observed in this study indicate that tetracycline and ampicillin have the highest prevalence of resistance, followed by other antibiotics commonly used in livestock and poultry production The heavy usage and common use of these antibiotics in meat production may contribute to the high resistance rates observed
Our results are much higher compared to the previous study reported by Nguyễn Thanh Việt & Nghiêm Ngọc Minh (2017) was showed high resistance to streptomycin and tetracycline (44% and 32%, respectively), followed by chloramphenicol, ampicillin, and sulfamethoxzole/trimethoprim and all strains were highly susceptible to ceftazime Similarly, Akbar and Anal (2013) found tetracycline, chloramphenicol, nalidixic acid, and ciprofloxacin resistance in 73%, 18.48%, 36%, and 27% of Salmonella isolates, respectively Another study Similar to our findings in Vietnam, a different study also found that a high percentage of Salmonella strains were resistant to common antibiotics like
45 streptomycin, tetracycline, ciprofloxacin, norfloxacin, ampicillin, nalidixic acid, trimethoprim, ceftazidime, gentamicin, and nitrofurantoin (84.44%, 82.22%, 35.56%, 35.56%, 62.22%, 62.22%, 80.00%, 33.33%, 33.33% and 33.33%, respectively, (Nguyễn Viết và cs, 2012)
Our findings are consistent with those of similar studies from other countries showing a high prevalence of resistance to antibiotics, such as tetracycline, ampicillin, and streptomycin, in livestock and poultry isolates (Chen et al., 2004; Poppe et al., 2001; Wilson, 2004) These results indicate that antibiotic resistance in Salmonella is increasing over time, and appropriate measures should be taken to address this concern (Osterblad et al., 2001; Xi et al., 2009)
The resistance rates observed in our study for antibiotics such as tetracycline, ampicillin, florfenicol, sulfamethoxazole/trimethoprim, nalidixic acid, streptomycin, gentamycin, cefotaxime, azithromycin, and cefepime may be due to their heavy usage or common use in livestock and poultry These findings emphasize the urgent need for strict measures to restrict antibiotic use in meat production and enhance antibiotic stewardship in order to mitigate the threat of antibiotic resistance in foodborne pathogens Our results on the susceptibility of Salmonella isolates to antibiotics such as meropenem, colistin, ciprofloxacin, ceftazidime, and cefoxitin suggest that these antibiotics could be used as treatment options for Salmonella infections
As shown in Table 4.3, multidrug-resistant (MDR) Salmonella isolates were prevalent in this study, with almost all isolates being resistant to at least one drug and the
46 majority of isolates exhibiting resistance to three or more antibiotics
Table 4 3 Multidrug-resistant Salmonella isolates from chicken and pork
Chicken (nI) Pork (nD) Total (n)
Of the 93 Salmonella isolates, 90 (96.77%) were resistant to at least one drug, with the highest rate observed in chicken (97.96%) and pork (95.45%) samples In accordance
47 with our findings, Osaili et al (2014) found that all Salmonella isolates were resistant to at least one antibiotic and that the majority of isolates were responsive to the majority of the tested antibiotics In addition, MDR or resistance to three or more antibiotics was frequently observed among the Salmonella isolates (76.34%) Our results showed lower rate of MDR than the previous study reported by Katoh et al (2015) was 90% and higher than reported by (Nguyễn Thanh Việt & Nghiêm Ngọc Minh, 2017) at 69.23% The rate of multidrug resistance tends to increase This trend can be attributed to the overuse of antibiotics in livestock and poultry, which increases the selection pressure on bacteria and leads to the emergence of many MDR strains of Salmonella According to Hassan et al (2019), Salmonella strains that are becoming resistant to many drugs pose a serious threat to the public's health since they reduce the range of possible treatments These findings emphasize the urgent need for strict measures to limit the use of antibiotics in meat production and improve antibiotic stewardship to help combat the threat of antibiotic resistance in foodborne pathogens The indiscriminate use of antibiotics in livestock and poultry farming, particularly for growth promotion, has contributed to the emergence of antibiotic-resistant bacteria This selective pressure on bacteria has resulted in diseases that were once treatable with antibiotics becoming resistant to treatment This phenomenon not only poses a threat to animal health but also to human health and the environment
Figure 4 2 Percentage of Salmonella isolates resistant to different types of antibiotics
The data presented in Figure 4.2, shows that strains exhibiting resistance to a range of 12 to 15 antibiotics constitute a minor proportion, accounting for only 1% Conversely, the greatest proportion, constituting approximately 42%, was represented by strains exhibiting resistance to four to seven antibiotics Strains exhibiting resistance to antibiotics 1- 3 and 8 – 11 constituted 36% and 21% of the sample, respectively, signifying a substantial percentage.
Antibiotic Resistant Pattern of Salmonella Isolated from pork and chicken
Salmonella spp are resistant to many antibiotics for several reasons Although antibiotics are commonly used treatment methods, in recent years, the dose of drugs administered often falls below the recommended concentration, and the active ingredient content may not meet label standards This lack of precision and accuracy can lead to an increase in dosage of up to two times the recommended level.A maximum of 13 and 10
Salmonella isolates resistant to number of antibiotics
49 antibiotics, respectively, were found to be ineffective against 93 Salmonella isolates from chicken and pork in this study Antibiotic resistance patterns are listed in Table 4.4
Table 4 4 Antibiotic resistance pattern of Salmonella isolated from chicken and pork
Resistance pattern (No of isolates)
Resistance pattern (No of isolates)
1 Amp (1); Sxt (1); Amp (1) 3 (6.12) 1 Amp (1); Tet (2) 3 (6.82)
2 Fox-Tet (1); Tet-Nal (1); Amp-Flo
(1); Fox-Str (1); Amp-Tet (2) 6 (12.24) 2 Tet-Flo (2); Amp-Fox (1); Str-Tet
(1); Tet-Flo (1); Amp-Str (1); Tet-
3 Amp-Tet-Nal (1); Amp-Fox-Str (1);
Tet-Flo-Sxt (1); Amp-Fox-Str (1);
Amp-Tet-Sxt (1); Tet-Flo-Sxt (1);
Amp-Tet-Flo (4); Str-Tet-Nal (1);
Amp-Fox-Tet-Flo (1); Amp-Tet-
Nal-Sxt (4); Str-Tet-Flo-Sxt (1);
Amp-Tet-Cst-Flo (1) 7 (14.29) 4 Amp-Tet-Flo-Sxt (2); Amp-Fox-
Amp-Fox-Tet-Flo-Sxt (1); Str-Tet-
Cst-Nal-Sxt (1); Amp-Tet-Flo-Nal-
Sxt (2) 4 (8.16) 5 Amp-Str-Tet-Flo-Sxt (1); Amp-
Amp-Fox-Str-Tet-Flo-Sxt (1); Amp-
Fep-Str-Tet-Flo-Sxt (1); Str-Tet-Cst-
Flo-Nal-Sxt (1); Amp-Ctx-Tet-Flo-
Azm-Sxt (1); Gen-Str-Tet-Flo-Nal-
Sxt (1); Amp-Fep-Gen-Tet-Flo-Azm
(1); Amp-Str-Tet-Flo-Nal-Sxt (1);
Amp-Ctx-Tet-Flo-Azm-Nal (1);
Amp-Fep-Tet-Flo-Azm-Sxt (1)
Gen-Str-Tet-Flo-Nal-Sxt (1);
Amp-Ctx-Str-Tet-Flo-Nal (1);
Gen-Str-Tet-Flo-Azm-Nal (1) 3 (6.82)
Amp-Fep-Gen-Tet-Flo-Nal-Sxt (1);
Amp-Fep-Str-Tet-Flo-Nal-Sxt (1);
Gen-Str-Tet-Flo-Azm-Nal-Sxt (2);
Amp-Ctx-Str-Tet-Flo-Azm-Sxt (2)
Amp-Ctx-Str-Tet-Flo-Nal-Sxt (1);
Amp-Gen-Str-Tet-Flo-Azm-Sxt (1); Amp-Ctx-Gen-Str-Tet-Nal- Sxt (1); Amp-Ctx-Gen-Tet-Flo-
Amp-Ctx-Caz-Gen-Tet-Flo-Azm-
Nal (1); Amp-Ctx-Fep-Gen-Str-Tet-
Amp-Ctx-Caz-Gen-Str-Tet-Flo- Nal (1); Amp-Fep-Gen-Tet-Flo- Azm-Nal-Sxt (1); Amp-Ctx-Gen- Tet-Flo-Azm-Nal-Sxt (1)
Amp-Ctx-Fep-Gen-Str-Tet-Flo-Nal-
Sxt (2); Amp-Ctx-Fep-Caz-Gen-Str-
Amp-Ctx-Gen-Str-Tet-Flo-Azm- Nal-Sxt (3); Amp-Ctx-Fep-Gen- Str-Tet-Flo-Nal-Sxt (1)
Amp-Ctx-Fep-Caz-Gen-Tet-Flo-
Azm-Nal-Sxt (1); Amp-Ctx-Fep-
Gen-Str-Tet-Flo-Azm-Nal-Sxt (1);
Amp-Ctx-Fep-Caz-Gen-Str-Tet-Flo-
Amp-Ctx-Fep-Caz-Gen-Tet-Flo- Azm-Nal-Sxt (1); Amp-Fep-Gen- Str-Tet-Flo-Azm-Cip-Nal-Sxt (1);
Amp-Ctx-Fep-Caz-Gen-Str-Tet- Flo-Cip-Nal-Sxt (1)
11 Amp-Ctx-Fep-Caz-Gen-Str-Tet-Flo-
13 Amp-Ctx-Fox-Fep-Caz-Gen-Str-Tet-
Flo-Azm-Cip-Nal-Sxt (1) 1 (2.04)
51 Among the chicken isolates, the occurrence of six antibiotic-resistant isolates (18.37%) was higher, followed by those resistant to four antibiotics (14.29%) The most frequently observed phenotypes were Amp-Tet-Nal and Stx, which were present in 4 out of 49 isolates, followed by Amp-Tet (2/49), Amp-Tet-Flo-Nal-Sxt (2/49), Gen-Str-Tet-Flo- Azm-Nal-Sxt (2/49), Amp-Ctx-Str-Tet-Flo-Azm-Sxt (2/49), and Amp-Ctx-Fep-Gen-Str- Tet-Flo-Nal-Sxt (2/49) Among the pork isolates, the number of isolates resistant to three antibiotics (22.73%) was higher than that of isolates resistant to two antibiotics (15.91%) Resistance to Amp-Tet and Flo (4/44) and Amp-Ctx-Geb-Str-Tet-Flo-Azm-Nal-Sxt (3/44) were the common features these multidrug resistant
According to research by Nguyen et al (2016), the resistance profiles Amp, Tet, Chl, and Sxt and Amp, Tet, Chl, Nal, and Sxt were the most common among MDR isolates (43 isolates, 12.8% each), followed by Amp, Tet and Stx (16 isolates for each profile, 4.8% each) Recent research on Salmonella isolates from animals raised for food production was done in Vietnam and revealed the same trend of antibiotic use (Lettini et al., 2016; Tu et al., 2015) According to Carrique-Mas et al (2015) and Thai et al (2012), Amp, Tet, Chl, and Sxt are often utilized in veterinary medicine in Vietnam Due to the high rates of resistance to various antibiotics displayed by the Salmonella isolates reported in this investigation, the use of these and other antimicrobial medications should be regulated, preventing the possible spread of antibiotic-resistant Salmonella in this country
The environmental impact of antibiotic resistance in Salmonella is twofold Firstly, the release of antibiotic-resistant bacteria into the environment can lead to the spread of resistance genes to other bacteria, including those that cause diseases in humans This
52 horizontal transfer of resistance genes can occur through various mechanisms, such as plasmids or mobile genetic elements, and can contribute to the overall increase in antibiotic resistance in the environment The use of antibiotics in livestock and poultry farming can result in the release of antibiotic residues and metabolites into the environment These residues can contaminate water bodies, soil, and crops, leading to the selection and spread of antibiotic-resistant bacteria in the environment This can impact ecosystems, disrupt microbial communities, and potentially contribute to the transmission of antibiotic resistance to human pathogens
To address the environmental impact of antibiotic resistance in Salmonella, it is crucial to implement strict measures to limit the use of antibiotics in meat production This includes promoting responsible antibiotic use, improving antibiotic stewardship, and exploring alternative strategies for disease prevention and treatment in livestock and poultry farming Additionally, proper waste management, including the treatment of animal waste, can help reduce the release of antibiotic-resistant bacteria and antibiotic residues into the environment.
Distribution of Resistance Genes by Gene Group
The presence of ESBL-producing microorganisms, specifically in Salmonella strains, is a concerning issue due to the potential development of multidrug resistance (MDR) ESBL-producing strains often exhibit resistance not only to cephalosporins but also to commonly used veterinary antibiotics(EFSA, 2011) In this study, the prevalence of ESBL genes, specifically blaCTX, blaTEM, and blaSHV, was investigated due to their
53 prevalence in Salmonella strains The distribution of isolates of Salmonella that produce ESBL is shown in Table 4.5
Table 4 5 Distribution of β -lactamase genes in Salmonella from raw meat (n) that produce ESBL
Table 4.5 shows the distribution of ESBL-producing Salmonella isolates ESBL genes were detected in 12 samples, with the highest prevalence observed in the TEM group (91.67%) The CTX-M-1, CTX-M-2, CTX-M-8/25, and SHV groups carried genes at rates of 50%, 8.33%, 25%, and 25%, respectively This distribution is consistent with findings from a study conducted in Southern Vietnam, where the TEM group and CTX group accounted for 58.14% and 9.30% of ESBL genes in Salmonella strains, respectively
(Truong et al., 2021) However, in our analysis, the prevalence of blaTEM was the lowest (31.71%), while a study by Ogu et al (2021) found that blaCTX-M genes were the most common (92.68%) among ESBL-positive Salmonella strains 0
54 Interestingly, pork samples showed a limited number of instances of ESBL-positive
Salmonella, while chicken samples exhibited the highest percentage of TEM-positive samples This is consistent with previous research by Kohler et al (2012), which found a dominance of the TEM group in chicken samples Studies by Valentin et al (2014) and Poomchuchit et al (2021) also confirmed the presence of CTX, SHV, and TEM genes in pigs and poultry
Regular monitoring of the prevalence and types of β-lactamase genes in Salmonella strains is crucial to gain a better understanding of antibiotic resistance development in this pathogen This information is essential for devising effective strategies to mitigate the food environmental impact of ESBL-producing Salmonella in raw meat By monitoring and addressing the prevalence of ESBL genes, the food industry can work towards reducing the spread of antibiotic resistance and ensuring the safety and sustainability of food systems
In conclusion, this study reveals a concerning prevalence of Salmonella strains in chicken and pork samples, with these bacteria showing resistance to multiple antibiotics The high incidence of multidrug resistance (MDR) and the presence of ESBL-producing bacteria raise significant concerns about food safety in Hung Yên, Vietnam The identified antibiotic resistance genes further complicate the treatment of infections caused by these bacteria
To address these issues and mitigate the environmental impact of foodborne diseases, several strategies can be implemented:
• Provide comprehensive training programs on meat handling practices to meat producers and slaughterhouse managers This will ensure that they have the necessary knowledge and skills to maintain high food quality and safety standards
• Emphasize the importance of antibiotic selection based on antibiograms or recommended doses for the treatment of Salmonella infections in both animals and humans This approach will help optimize treatment outcomes and minimize the development of antibiotic resistance
• Organize seminars and awareness campaigns to enhance the professional capacity of producers, farm workers, butchers, sellers, and consumers By raising awareness about the dangers of Salmonella-related diseases, the spread of bacteria can be minimized
• Implement strict monitoring systems for the use of antibiotics in the treatment of
Salmonella and other bacterial infections This will ensure responsible and judicious use of antibiotics, reducing the likelihood of resistance development
• Implement measures to limit the use of antibiotics in animal husbandry, such as improving environmental sanitation in barns and supplementing livestock diets with probiotics and plant-based stimulants instead of growth-promoting antibiotics
• Conduct further research with larger sample sizes to determine the sources of contamination and assess the level of risk associated with consuming contaminated meat
• Continuously explore antibiotic resistance genes in Salmonella to gain a deeper understanding of their diversity and distribution patterns in meat samples
By implementing these strategies, we can improve food safety, reduce the environmental impact of foodborne diseases, and better manage antibiotic resistance in
Abera, B., Biadegelgen, F., & Bezabih, B (2010) Prevalence of Salmonella typhi and intestinal parasites among food handlers in Bahir Dar Town, Northwest Ethiopia Ethiopian Journal of Health Development, 24(1) https://doi.org/10.4314/ejhd.v24i1.62944
Akbar, A., & Anal, A K (2013) Prevalence and antibiogram study of Salmonella and
Staphylococcus aureus in poultry meat Asian Pacific Journal of Tropical Biomedicine,
Andrews, W H., Wang, H., Jacobson, A., Ge, B., Zhang, G., & Hammack, T (2018)
Bacteriological Analytical Manual (BAM) Chapter 5: Salmonella In Bacteriological
Analytical Manual (Vol 1, Issue December 2015)
Antimicrobial resistance: global report on surveillance (n.d.) Retrieved August 14, 2023, from https://apps.who.int/iris/handle/10665/112642
Aspinall, S T., Hindle, M A., & Hutchinson, D N (1992) Improved isolation of salmonellae from faeces using a semisolid rappaport-vassiliadis medium European Journal of Clinical
Microbiology & Infectious Diseases, 11(10), 936–939 https://doi.org/10.1007/BF01962379
Badiu, C (2005) Harrison’s Principles of Internal Medicine 16th ed Acta Endocrinologica
(Bucharest), 1(4) https://doi.org/10.4183/aeb.2005.499
Baird-Parker, A C (1994) Foods and microbiological risks Microbiology, 140(4) https://doi.org/10.1099/00221287-140-4-687
Barlow, M., & Hall, B G (2002) Origin and evolution of the ampC β-lactamases of Citrobacter freundii Antimicrobial Agents and Chemotherapy, 46(5) https://doi.org/10.1128/AAC.46.5.1190-1198.2002
Bean, N H., Goulding, J S., Daniels, M T., & Angulo, F J (1997) Surveillance for foodborne disease outbreaks - United states, 1988-1992 In Journal of Food Protection (Vol 60, Issue 10) https://doi.org/10.4315/0362-028X-60.10.1265
Bell Kyriakides, C (2002) Salmonella: A Practical Approach to the Organism and Its Control in Foods Oxford: Blackwell Science
Benjamin, W H., Turnbough, C L., Posey, B S., & Briles, D E (1985) The ability of
Salmonella typhimurium to produce the siderophore enterobactin is not a virulence factor in mouse typhoid Infection and Immunity, 50(2), 392–397 https://doi.org/10.1128/iai.50.2.392-397.1985
Beyene, G (2008) Phenotypic and molecular characterizations of salmonella species in ethiopia phenotypic and molecular characterizations of salmonella species in ethiopia a phd thesis presented to the school of graduate studies of addis ababa university in partial fulfillment of the requirements for the degree of doctor of philosophy in medical microbiology
Bùi Thị Tho (2003) Thuốc kháng sinh và nguyên tắc sử dụng trong chăn nuôi NXB Hà Nội Busani, L., Cigliano, A., Taioli, E., Caligiuri, V., Chiavacci, L., Di Bella, C., Battisti, A.,
Duranti, A., Gianfranceschi, M., Nardella, M C., Ricci, A., Rolesu, S., Tamba, M.,
Marabelli, R., & Caprioli, A (2005) Prevalence of Salmonella enterica and Listeria monocytogenes contamination in foods of animal origin in Italy Journal of Food
Calo, J R., Crandall, P G., O’Bryan, C A., & Ricke, S C (2015) Essential oils as antimicrobials in food systems - A review Food Control, 54(May 2021), 111–119 https://doi.org/10.1016/j.foodcont.2014.12.040
58 Carrique-Mas, J J., Trung, N V., Hoa, N T., Mai, H H., Thanh, T H., Campbell, J I.,
Wagenaar, J A., Hardon, A., Hieu, T Q., & Schultsz, C (2015) Antimicrobial usage in chicken production in the mekong delta of vietnam Zoonoses and Public Health, 62(s1), 70–78 https://doi.org/10.1111/zph.12165
Chamberlain, J S., Gibbs, R A., Rainer, J E., Nguyen, P N., & Thomas, C (1988) Deletion screening of the duchenne muscular dystrophy locus via multiplex DNA amplification
Nucleic Acids Research, 16(23) https://doi.org/10.1093/nar/16.23.11141
Chen, S., Zhao, S., White, D G., Schroeder, C M., Lu, R., Yang, H., McDermott, P F., Ayers, S., & Meng, J (2004) Characterization of Multiple-Antimicrobial-Resistant Salmonella Serovars Isolated from Retail Meats Applied and Environmental Microbiology, 70(1) https://doi.org/10.1128/AEM.70.1.1-7.2004
Clarke, G J., Qi, G M., Wallis, T S., Starkey, W G., Collins, J., Spencer, A J., Haddon, S J., Osborne, M P., Worton, K J., Candy, D C A., & Stephen, J (1988) Expression of an antigen in strains of Salmonella typhimurium which reacts with antibodies to cholera toxin
Journal of Medical Microbiology, 25(2), 139–146 https://doi.org/10.1099/00222615-25-2-
Clinical and Laboratory Standards Institute (2015) Clinical and Laboratory Standards Institute Methods for dilution antimicrobial susceptibility tests for bacteria that grow aerobically Document M07 A6 Wayne (PA): The Institute; 2003 CLSI
CLSI (2018a) Clinical and Laboratory Standards Institute (CLSI) (2018): Performance standards for antimicrobial susceptibility testing In Twenty-ninth informational supplement,
CLSI (2018b) Methods for Antimicrobial Dilution and Disk Susceptibility Testing of
Infrequently Isolated or Fastidious Bacteria www.clsi.org
CLSI (2018c) The Clinical and Laboratory Standards Institute (CLSI In The Encyclopedia of
Astronomy and Astrophysics https://doi.org/10.1888/0333750888/6100
Collignon, P., Powers, J H., Chiller, T M., Aidara-Kane, A., & Aarestrup, F M (2009) World health organization ranking of antimicrobials according to their importance in human medicine: a critical step for developing risk management strategies for the use of antimicrobials in food production animals In Clinical Infectious Diseases (Vol 49, Issue 1) https://doi.org/10.1086/599374
Cormican, M G., Marshall, S A., & Jones, R N (1996) Detection of extended-spectrum β- lactamase (ESBL)-producing strains by the Etest ESBL screen Journal of Clinical
Microbiology https://doi.org/10.1128/jcm.34.8.1880-1884.1996
Crisan, D (1994) Molecular diagnostic testing for determination of myeloid lineage in acute leukemias Annals of Clinical and Laboratory Science, 24(4)
Dafale, N A., Srivastava, S., & Purohit, H J (2020) Zoonosis: An Emerging Link to Antibiotic Resistance Under “One Health Approach.” In Indian Journal of Microbiology (Vol 60, Issue 2) https://doi.org/10.1007/s12088-020-00860-z Đào Trọng Đạt , Phan Thanh Phượng, L N M (1995) Bệnh đường tiêu hóa ở lợn NXB Nông Nghiệp
Davies RH, Wray C (1996) Seasonal variations in the isolation of Salmonella Typhimurium,
Salmonella Enteritidis, Bacillus cereus and Clostridium perfringens from environmental samples J Vet Med B Infect Dis Vet Public Health 1996; 43: 119–127
De Schweinitz and Dorset (n.d.) New facts concerning the etiology of hog cholera Retrieved June 19, 2023, from
59 https://books.google.com.vn/books?hl=en&lr=&id=0oJGAQAAMAAJ&oi=fnd&pg=PA15 7&dq=Schweinitz%27s+and+Dorset+(1903)&ots=tqoATAspux&sig=pxPZTP7bsSQhuvmt -
2xc_Q_SdVg&redir_esc=y#v=onepage&q=Schweinitz’s%20and%20Dorset%20(1903)&f false
Drieux, L., Brossier, F., Sougakoff, W., & Jarlier, V (2008) Phenotypic detection of extended- spectrum β-lactamase production in Enterobacteriaceae: Review and bench guide In
Clinical Microbiology and Infection (Vol 14, Issue SUPPL 1, pp 90–103) European
Society of Clinical Microbiology and Infectious Diseases https://doi.org/10.1111/j.1469- 0691.2007.01846.x
Du Toit, L., & Venter, I (2010) Food practices associated with increased risk of bacterial food- borne disease of female students in self-catering residences at the Cape Peninsula
University of Technology Journal of Family Ecology and Consumer Sciences /Tydskrif Vir
Gesinsekologie En Verbruikerswetenskappe, 33(1) https://doi.org/10.4314/jfecs.v33i1.52864
EFSA (2011) Scientific Opinion on the public health risks of bacterial strains producing extended-spectrum β-lactamases and/or AmpC β-lactamases in food and food-producing animals EFSA Journal https://doi.org/10.2903/j.efsa.2011.2322
Eng, S.-K., Pusparajah, P., Ab Mutalib, N.-S., Ser, H.-L., Chan, K.-G., & Lee, L.-H (2015)
Salmonella: A review on pathogenesis, epidemiology and antibiotic resistance Frontiers in Life Science, 8(3), 284–293 https://doi.org/10.1080/21553769.2015.1051243
FAO/WHO (2007) Principles and Guidelines for the Conduct of Microbiological Risk
Assessment FAO: Agriculture and Consumer Protection, 63
Finlay, B B., & Falkow (1988) Virulence factors associated with Salmonella species https://europepmc.org/article/med/3079173
Foley, S L., & Lynne, A M (2008) Food animal-associated Salmonella challenges: pathogenicity and antimicrobial resistance Journal of Animal Science, 86(14 Suppl), E173-
87 https://doi.org/jas.2007-0447 [pii]
Food Safety | WHO | Regional Office for Africa (n.d.) Retrieved June 30, 2023, from https://www.afro.who.int/health-topics/food-safety
Food safety risk analysis A guide for national food safety authorities (2006) FAO Food and
Francis, C L., Starnbach, M N., & Falkow, S (1992) Morphological and cytoskeletal changes in epithelial cells occur immediately upon interaction with Salmonella typhimurium grown under low‐oxygen conditions Molecular Microbiology, 6(21) https://doi.org/10.1111/j.1365-2958.1992.tb01765.x
Fricker, C R (1987) The isolation of salmonellas and campylobacters In Journal of Applied
Bacteriology (Vol 63, Issue 2) https://doi.org/10.1111/j.1365-2672.1987.tb02692.x
Frost, A J., Bland, A P., & Wallis, T S (1997) The Early Dynamic Response of the Calf Ileal Epithelium to Salmonella typhimurium Veterinary Pathology, 34(5), 369–386 https://doi.org/10.1177/030098589703400501
G W JONES, & LEIGH A RICHARDSON (1981) The Attachment to, and Invasion of HeLa Cells by SuhoneUu typhimuriurn: The Contribution of Mannose-sensitive and Mannose- resistant Haemagglutinating Activities In Journal of General Microbiology (Vol 127)
60 Galanos, C., & Freudenberg, M A (1993) Bacterial endotoxins: biological properties and mechanisms of action Mediators of Inflammation, 2(7) https://doi.org/10.1155/S0962935193000687
Grimont, P A D., & Weill, F X (2007) Antigenic formulae of the Salmonella serovars.9 th edition WHO Collaborating Center for Reference and Research on Salmonella France:
Gualerzi, C O., Brandi, L., Fabbretti, A., & Pon, C L (2013) Antibiotics: Targets, Mechanisms and Resistance In Antibiotics: Targets, Mechanisms and Resistance https://doi.org/10.1002/9783527659685
Guardabassi, L., & Courvalin, P (2006) Mode of antimicrobial action and mechanisms of bacterial resistance https://www.researchgate.net/publication/345652566_Modes_of_Antimicrobial_Action_an d_Mechanisms_of_Bacterial_Resistance