Practical genetic engineering

Bài phúc trình Thực tập môn Công nghệ di truyền Ngành Công nghệ sinh học Trường Đại học Cần Thơ. Trình bày toàn bộ các thao tác và cũng như giải đáp các câu hỏi trong quá trình tham gia môn học của nhóm bằng tiếng anh.

MINISTRY OF EDUCATION AND TRAINING CAN THO UNIVERSITY BIOTECHNOLOGY RESEARCH AND DEVELOPMENT INSTITUTE LAB REPORT PRACTICAL GENETIC ENGINEERING CODE: BT217 INSTRUCTOR Pha, PhD GROUP Class: Biotechnology (Advanced Program) Course: 45 Can Tho, 11/2022 CONTENTS LESSON 1: DNA EXTRACTION LESSON 2: TESTING DNA BY GEL ELECTROPHORESIS LESSON 3: GENETIC DIVERSITY ANALYSIS OF RICE USING RAPD TECHNIQUE LESSON 4: GENETIC DIVERSITY ANALYSIS OF RICE USING SSR TECHNIQUE LESSON 5: INVESTIGATION OF EXON REGION OF osHKT1;5 BY RESTRICTION ENZYME 12 LESSON DNA EXTRACTION PRINCIPLE The principle of distinct solubility of distinct molecules (nucleic acid and protein) in two insoluble phases (phenol, chloroform, and water) underpins DNA extraction The objective is to obtain nucleic acid molecules that have not been broken down mechanically or chemically MANIPULATION Step Breaking cells open to release the DNA Step Separating DNA from proteins and other cellular debris Step Precipitating the DNA with an alcohol Step Cleaning the DNA Step Confirming the presence and quality of the DNA MATERIALS - Leaves from plant (young rice leaves) - Mortar, cotton balls, scissors, clamps, type mL Eppendorf, foil, marker, yellow and cole, etc - Micropipettes (2-20 µL, 10-100 µL, 100-1000 µL) - Water bath 65℃ - Centrifuges, moist heat sterilization pot, vacuum dryers, refrigerators -20℃ - EB buffer: 0.1M Tris HCCL (pH 8), 0.5M NaCl, 0.05 EDTA, 0.01 beta- mercaptho ethanol - TE buffer: 10 mM Tris pH ,0.1 mM EDTA (pH 8) - CTAB buffer: 0.2M Tris.Cl (pH 7,5), 2M NaCl, 0.05M EDTA, 2% (w/v) CTAB (cetyltrimethylammonium bromide) - SDS 10%, Ethanol 96% and 70%, Isopropanol - Mixed Chloroform - Isoamyl alcohol (24:1) - PROTOCOL Washing leaf with water and subsequently cleaning by alcohol Grounding the samples with mL EB solution Taking out 1mL extracted solution and then transfer to tube 2.2 mL Adding 50 µl SDS 10% and mix well Incubating at 650C in 30 minutes - Centrifuging at 13000 rpm in 10 minutes - Taking out 800 µl upper solution, transferring to a new tube and adding 800 µl isopropanol, shaking tube slightly - Incubating at -200C in hours - Centrifuging at 13000 rpm in 10 minutes Keeping precipitated part at the bottom of the tube, removing the solution - Adding to tube 400 µl TE 1X (pH 8), 400 µl CTAB buffer and incubating at 650C in 15 minutes - Adding 800 µl Chloroform: Isoamyl alcohol solution at the ratio of 24:1 and shack well - Centrifuging at 13000 rpm in minutes - Transferring carefully 600 µl solution at phase to another tube, adding 1.2 mL ethanol 96% and incubating at room temperature in 15 minutes - Centrifuging at 13000 rpm in 10 minutes, getting rid of the solution and keeping - Drying tube with DNA by using vacuum at 450C in 10 minutes - Dissolving in 80 µl BiH2O to store DNA RESULT - Obtained DNA extracted from the leaves, then preserved for further experiments Notes on DNA extraction: + Plant leaf samples have an outer cellulose shell, should be chopped and crushed to break the cellulose wall to easily obtain DNA + SDS 10% (sodium dodecyl sulfate) and Ethanol 96% helps to break down cell membranes and nuclear membranes + Isopropanol is an alcohol used to precipitate DNA The aim is to obtain nucleic acids in concentrated form and protect them from enzymatic breakdown + DNA was washed with 70% ethanol to remove salts and traces of isopropanol (Since it is 30% water, NaCl will be dissolved) + CTAB 2% has a protein-precipitating effect but dissolves DNA and note the temperature, if the temperature is too high it will denature the protein LESSON TESTING DNA BY GEL ELECTROPHORESIS INTRODUCTION Electrophoresis is the process of dividing liquid molecules based on their tendency to move in an electric field Various types of electrophoresis, including DNA or RNA, proteins, and polysaccharides, have emerged as the most important techniques for investigating biomolecules in molecular biology and biochemistry Gel electrophoresis is a laboratory method used to separate mixtures of DNA, RNA, or proteins according to molecular size, charge, or conformation In gel electrophoresis, the molecules to be separated are pushed by an electrical field through a gel that contains small pores Agarose is appropriate for separating DNA fragments ranging in size from a few hundred base pairs to about 20 kb SafeView products represent a new and safe class of nucleic acid stains for the visualization of double-stranded DNA, single-stranded DNA, and RNA in agarose gels The dyes are developed to replace toxic Ethidium Bromide (EB, a potent mutagen), commonly used in gel electrophoresis for visualization of nucleic acids in agarose gels SafeView Classic is used the same way as Ethidium Bromide in agarose gel electrophoresis It emits green fluorescence when bound to dsDNA and red fluorescence when bound to ssDNA or RNA This stain has two fluorescence excitation maxima when bound to nucleic acid, at approximately 290 nm and 490 nm MATERIALS - Material: DNA sample and DNA ladder - Chemical substances: agarose solutions, electrophoresis buffer (TBE 1X buffer), loading buffer - Tools: gel casting trays, sample combs, an electrophoresis chamber and power supply, micropipette, eppendorf, parafim paper, microwave, conical flask, Gel documentation system a - PROTOCOL Preparation agarose gel Prepare 100 mL TBE 1X buffer and transfer the buffer to a conical flask Weigh 0.7 – gram agarose and add to the conical flask containing 100 mL TBE 1X buffer - Melt completely the agarose solution in a microwave And melted agarose should be cooled to about 60℃ After that, add SafeView, shake and pour the solution to the gel caster tray for solidification - Put the comb in the caster tray containing gel, after the gel has solidified, then withdraw the comb b Loading and running gel - Place the gel in the electrophoresis tank Add sufficient electrophoresis buffer to cover the gel to depth of about 1mm (or just until the tops of the wells are submerged) Make sure no air bubbles are trapped within the wells - DNA Ladders is pipetted into the first well - Sample containing µL DNA mixed with µL Loading buffer 6X by micropipette and then pipetted into the sample wells - Connect the electrodes and switch on the current Set the voltage of 50V to start electrophoresis Run the gel until the loading buffer dyes have moved an approriate distance through the gel - Turn off the power suppy and then the gel tray may be removed and placed directly on Gel documentation system to image and save RESULT AND DISCUSSION a Results DNA extraction result Marker Marker Figure 1: Small and large agarose gels after electrophoresis Meaning - The result of group showed that in the small agarose gel - All samples were not contained DNA b Discussion All samples were not contained DNA of the material Due to the manipulation when we proceed to extract DNA from the material was not standard such as: - The samples were not mixed well enough with different chemicals, so the DNA was not separated out of the tissue of the material - When we used the micropipette to take the sample from eppendorf, we did not shake the tube carefully Thus, we just took the water on the surface which is not contain the DNA LESSON GENETIC DIVERSITY ANALYSIS OF RICE USING RAPD TECHNIQUE PRINCIPLE Short PCR primers with random sequences, typically between and 15 nucleotides in length, are used in RAPD (randomly amplified polymorphic DNA) marker analysis These primers anneal randomLy at multiple sites on the genomic DNA at a low annealing temperature, typically 35°C As these random sequence primers anneal to various regions of an organism's genome, complex patterns of PCR products are produced Due to the requirement of consistent PCR amplification conditions, including thermal cycler ramp speeds, RAPD exhibits poor reproducibility across laboratories Consistently scoring electrophoretic images even in single-source samples is difficult due to the complex patterns of RAPD, which also prevent mixture interpretation A PCR-based method known as randomly amplified polymorphic DNA (RAPD) makes use of arbitrary primers that bind to nonspecific DNA sites and amplify the DNA After being migrated on agarose gel, these amplified fragments exhibit a distinct band pattern The diversity study made use of this relatively straightforward and less expensive method However, this method has some drawbacks because the amplification protocol must be very carefully designed to ensure the reproducibility of the samples; Aside from that, the used DNA template needs to be properly purified because PCR reactions may be stymied by contaminated samples MATERIALS - Material: DNA template (lesson 1) - Tools and chemical substances: Micropipette, Electrophoresis equipment minisub gel, Gel reader Bio-Rad machine, Eppendorf tubes 1.5mL and 2mL, PCR machine, Tris HCL (pH8), EDTA, agaroses, loading buffer 6X, RAPD primers PROTOCOL - Prepare 1.5 mL eppendorf to contain the mixture which in turn will be separated to many tubes for PCR to be carried out - Use micropipette to drag those chemical substances in the following table into 1.5 mL eppendorf respectively Table Chemical substances mixture for RAPD technique (1 reaction) Chemical substances Volume (µl) Bi.H2O 9,65 Buffer 5X Primer RAPD 1,2 Taq polymerase 0,15 DNA Total volume 15 - - After mixing up those compositions as table (the number of reactions carry out by each group) To separate the mixture into tubes 0.2 mL in such a way that each tube contains 14 µL, then add µL DNA sample to reach 15 µL Set program for PCR machine as the following thermal cycles: Figure Thermal cycle of PCR-RAPD - 1.5% Agarose gel electrophoresis process steps: Prepare a piece of paraffin to carry loading buffer, each droplet of loading buffer is µL Use micropipette to drag 15 µL PCR-DNA product to mix well with a droplet of loading buffer then put into gel wells Pour TBE 1X into electrophoresis box after putting the gel on Inject ladder solution on the first well Operate the machine with 50V electric current Pay attention the tracks of bands, not let the color stain track run out of the gel LESSON GENETIC DIVERSITY ANALYSIS OF RICE USING SSR TECHNIQUE PRINCIPLE Microsatellites or simple sequence repeats (SSRs) are short repetitive elements of 1- bases that found in prokaryotic and all eukaryotic genomes Dinucleotide repeats like (CA)n and (GA)n are the most abundant repeats in most of the eukaryotes (for e.g., in humans (CA)n repeat occurs once in every 30 kb) These repeat motifs, which present in both coding and noncoding regions are smaller than 100bp Microsatellites are highly polymorphic, reproducible, abundant, inherited codominantly and distribute throughout genome The excessive rate of mutation, high number of alleles and frequency in the genomic DNA, have made SSRs very effective molecular markers in population genetics, genome mapping, taxonomic study, linkage analysis, genetic fingerprinting, and diversity Generation of new alleles and microsatellite instability can be related to several diseases SSRs can be amplified by the standard polymerase chain reaction (PCR), using specific primer sequences from the flanking regions This process of amplification and visualization in agarose or denaturing polyacrylamide gel METARIALS - DNA template (lesson 1) - Tools and chemical substances: Micropipette, Electrophoresis equipment minisub gel, gel reader Bio-Rad machine, Eppendorf tubes 1.5mL and 2mL, PCR machine, agarose, loading buffer 6X, SSR primers PROTOCOL - Prepare 1.5mL eppendorf to contain the mixture which in turn will be separated to many tubes for PCR to be carried out - Use micropipette to drag those chemical substances in the following table into mL eppendorf respectively Table Chemical substances mixture for SSR technique (1 reaction) Volume (µL) 8.65 Chemical substances Bi.H2O Buffer 5X Primer R Primer F Taq polymerase DNA Total volume 0.6 0.6 0.15 15 - After mixing up those compositions as table (the number of reactions carry out by each group) To separate the mixture into tubes 0.2 mL in such a way that each tube contains 13 µL, then add µL DNA sample to reach 15 µL - Set program for PCR machine as the following thermal cycles: PCR product was run on 1.5% agarose gel electrophoresis in TBE buffer 1X for 20 minutes under 100V and take gel pictures with Bio-Rad UV gel camera 10 94oC 5:00 94oC 0:25 46oC 72oC 72oC 0:25 3:00 0:25 4oC 30 cycles Figure 3: Thermal cycle of PCR-SSR RESULT AND DISCUSSION Figure Electrophoresis product of the SSR technique was performed on 1.5% agarose gels in TBE buffer 1X for 15 minutes at 100 volts while taking gel images with a Bio-Rad UV gel camera From well 13 to well 16, Electrophoresis results show that primer can amplifies all samples of the group with clear monomorphic band, to fuzzy and blurred bands The cause could be: - Due to an error in the micropipette (non-standard volume) resulting in too much template was added, primer concentration was too high - Thermal cycler was not at correct temperature, need to calibrate the thermal cycler or use a different machine 11 LESSON INVESTIGATION OF EXON REGION OF osHKT1;5 BY RESTRICTION ENZYME INTRODUCTION Numerous studies that have been done on the mechanism of rice's salinity tolerance have revealed that it is a complex mechanism governed by numerous genes Na+ and K+ channels related to salinity tolerance play a significant role in the mechanisms by which plants resist stress The protein HKT (High-Affinity K + Transporter) is crucial for maintaining ion balance in cells, according to research on ion balance in plants Numerous genes, including OsHKT1; 2, OsHKT2; 3, OsHKT1; 1, OsHKT1; 4, and OsHKT1; 5, are members of this gene family (Waters et al., 2013; Hama-moto et al., 2015) The key to rice's ability to withstand salinity is the role that OsHKT1; plays in encoding ion Na+ transport proteins from roots to shoots OsHKT1;5 is at about 4.487 bp long, with a coding region that requires 1665 bp to encode 555 amino acids Figure Map of osHKT1;5 gene MATERIALS - DNA template (lesson 1) - Tools and chemical substances: Micropipette, Electrophoresis equipment minisub gel, gel reader Bio-Rad machine, Eppendorf tubes 1.5 mL and mL, PCR machine, agarose, loading buffer 6X - Primers for exon (F- 5’GGACCTGATCTTCACGTCGG3’ and R5’GAGCACCATCTCACCGGAG3’) Amplifier product length is 1000 bp PROTOCOL - Prepare 1.5 mL ependorf to contain the mixture which in turn will be separated to many tubes for PCR to be carried out - Use micropipette to drag those chemical substances in the following table into 1.5 mL ependorf respectively 12 Table Chemical substances mixture for PCR osHKT1;5 (1 reaction) Chemical substances Volume (μL) Bi.H2O 15.75 Buffer 5X Primer R (osHKT1;5) Primer F (osHKT1;5) Taq polymerase 0.25 DNA Total volume 25 - - - After mixing up those compositions as table (the number of reactions carry out by each group) To separate the mixture into tubes 0.2 mL in such a way that each tube contains 14 μL, then add μL DNA sample to reach 15 μL Set program for PCR machine as the following thermal cycles: 95°C for of pre-denaturation, 30 cycle of (94°C for 30s, Tm 58℃ for 30s, 72°C for 45s), 72°C for of prolonged extension step PCR product was run on 1.5% agarose gel electrophoresis in TBE buffer 1X for 20 under 100V and take gel pictures with Bio-Rad UV gel camera RE reaction - Prepare 1.5mL ependorf to contain the mixture which in turn will be seperated to many tubes for RE reaction - Use micropipette to drag those chemical substances in the following table into 1.5 mL ependorf respectively Table Chemical substances mixture for RE reaction (1 reaction) Chemical substances Volume (μL) Bi.H2O 4.5 Buffer 10X 1.5 RE PCR-product Total volume 15 - After mixing up those compositions as table (the number of reactions carry out by each group) To separate the mixture into tubes 1.5 mL in such a way that each tube contains μL, then add μL DNA (PCR-product) sample to reach 15 μL - The RE reaction was incubated in suitable temperature - RE reaction product was ran on 1.5% agarose gel electrophoresis in TBE buffer 1X 13 for 40 mins under 50V and take gel pictures with Bio-Rad UV gel camera RESULT AND DISCUSSION The result showed in agarose gel with all sample contained DNA and appear two bands of DNA Two DNA bands were visible on the gel electrophoresis because of restriction enzymes that cleave the original DNA into two fragments with different molecular sizes In Figure 6, Smaller DNA molecules can move through gel electrophoresis more quickly and farther (lower band) Large DNA molecules will move slowly and not very far on the gel electrophoresis (the upper band is above) Large molecule DNA Small molecule DNA Figure Electrophoresis of the RE reaction product was performed on 1.5% agarose gels in TBE buffer 1X for 30 minutes at 50 volts while taking gel images with a Bio-Rad UV gel camera 14