Bài phúc trình Thực tập môn Virus học Ngành Công nghệ sinh học Trường Đại học Cần Thơ. Trình bày toàn bộ các thao tác và cũng như giải đáp các câu hỏi trong quá trình tham gia môn học của nhóm bằng tiếng anh.
MINISTRY OF EDUCATION AND TRAINING CAN THO UNIVERSITY INSTITUTE OF BIOTECHNOLOGY RESEARCH & DEVELOPMENT LAB REPORT PRACTICAL VIROLOGY CODE MM414C GROUP INSTRUCTOR STUDENTS TRƯƠNG THỊ BÍCH VÂN, PhD Trần Thị Thảo My – B1904532 Trần Yến Nhi – B1904693 Trần Nguyễn Nguyệt Thanh – B1904697 12/2021 h a PART I: EXTRACTION OF WHITE SPOT SYNDROM VIRUS DNA I Introduction a Questioned The Mekong Delta is one of the largest spearhead industries in Vietnam such as aquaculture, agriculture, etc Talking about the aquaculture industry, mention shrimp farms in Vietnam, with a large area that has brought economic benefits in processing and exporting Nowadays, to serve the domestic and foreign, leading to the development of scientific and technologically applied shrimp farming models However, shrimp farms always have the potential to cause disease, causing damage to shrimp farmers and the aquaculture industry As the result, the emergence of a drugresistant mutant strain of viruses is one of the biggest obstacles to the economic development of our country Specifically, white spot syndrome virus (WSSV) with the ability to spread quickly causing mass death of shrimp is one of them WSSV does not have an effective cure, so it is very important to well in the prevention and early diagnosis Polymerase chain reaction (PCR) method has shown detecting viral diseases and it is essential to understand how the mechanism works practically Identification of white spot syndrome virus (WSSV): The virus belongs to genus Whispovirus in the family Nimaviridae with a rod-shaped, double-stranded DNA (group I according to Baltimore classification of viruses) Enveloped ovoidal particles of about 275 nm in length and 120 nm in width, with a tail-like appendage at one end The genome of WSSV is circular dsDNA about 300 kb in size, encoding for at least 531 ORF The modes of transmission of WSSV in the natural environment are mainly by vertical and/or horizontal ways WSSV can spread quickly among the farms and sites WSSV has a wide host range that contains all cultured, wild marine shrimps, crabs, lobsters, crayfishes, Squilla, copepods, and freshwater cultures species and this caused to be the control of disease more difficult White Spot Syndrome Virus Disease symptoms: The most clinical signs are redness of body coloration and appendages, reduction of feeding, lethargy, and characteristic of white spots on the carapace white spot on the shell of infected shrimp under scanning electron, dome-shaped spots on the carapace measuring 0.5 to 2.0mm in diameter Chemical composition of the spots is similar to the carapace, calcium forming 80-90% of the total material, and may have derived from abnormalities of the cuticular epidermis WSSV infection in shrimp b Objectives − Know how to use Laboratory equipment (Micropipette, Centrifuge, PCR machine, Gel electrophoresis equipment) − Know the procedure of PCR techniques (Polymerase chain reaction or PCR, is a technique to make many copies of a specific DNA region in vitro (in a test tube rather than an organism) PCR relies on a thermostable DNA polymerase, Taq polymerase, and requires DNA primers designed specifically for the DNA region of interest II Method a Preparation & equipment − Prepare + Lysis buffer + TE 0.1X + Absolutely alcohol + Shrimp sample + Mytag mix + Agarose gel: 0.48g agarose, 70mL TAX 1X, SafeView − Centrifuge: Using in DNA extraction − PCR machine: Carrying out reactions in PCR − Gel electrophoresis equipment: Used to separate mixtures of DNA, RNA, or proteins according to molecular size − Bio-rad machine − Micropipette − Eppendorf b Extraction WWSSV DNA from shrimp process: There are many different methods of DNA extraction, so it is necessary to choose a suitable method depending on the study subjects The quick DNA extraction method is a simple and efficient technique that allows us to have DNA samples to test quickly in molecular biology WSSV belongs to the group of gram-positive viruses, so the method that is supposed to have the most stable performance is shown below 100 – 150 gram of infected shrimp gill or epidermis under the head is crashed thoroughly Cells-breaking by physical methods Sample is mixed with 1mL of lysis buffer and leave for 10 minutes Break up membrane structure Centrifuging (14000rpm) for minutes, transfer 400 µL solution to a new eppendorf Add 600 µL of Ethanol 95%, undergo centrifugation (12000rpm) for minutes Remove the liquid 1mL of Ethanol 70% is added, continue to centrifuge (12000rpm) for minutes This process can be done twice Separate DNA from orthe particle Elimiate the solvation shell that surrounds the DNA, thus allowing the DNA to precipitate in pellet form DNA washing Allows the salts to dissolve while minimizing DNA solubility Use the absorbent paper to remove any droplet Help the sample dry faster Dry the sample (vaccum centrifuge can be used) Drain out any ethanol particle which will prevent any later reaaction Solubilize DNA while protecting it from degradation 150 µL TE 0.1 is added to dissovle the DNA Electrophoresis a part and store the rest to use in PCR Detect the present of DNA III Result Gel electrophoresis is a laboratory method used to separate mixtures of DNA, RNA, or proteins according to molecular size, charge, or conformation In gel electrophoresis, the molecules to be separated are pushed by an electrical field through a gel that contains small pores Agarose is appropriate for separating DNA fragments ranging in size from a few hundred base pairs to about 20 kb SafeView products represent a new and safe class of nucleic acid stains for the visualization of double-stranded DNA, single-stranded DNA, and RNA in agarose gels The dyes are developed to replace toxic Ethidium Bromide (EB, a potent mutagen), commonly used in gel electrophoresis for visualization of nucleic acids in agarose gels SafeView Classic is used the same way as Ethidium Bromide in agarose gel electrophoresis It emits green fluorescence when bound to dsDNA and red fluorescence when bound to ssDNA or RNA This stain has two fluorescence excitation maxima when bound to nucleic acid, at approximately 290nm and 490nm DNA extraction result 10 11 12 13 14 15 16 17 DNA Proteins Large agarose gel (17 wells) after electrophoresis Meaning No.8: Trần Thị Thảo My No.9: Trần Yến Nhi No.10: Trần Nguyễn Nguyệt Thanh − All samples contain DNA − DNA’s purity is low as the presence of protein Disscusion Purify it to reduce the number of contaminants that can compromise the results of your research and shorten the shelf-life of your precious samples If the DNA samples are not purified completely due to samples not mixed well enough during extraction or not washed thoroughly, the samples need to be repurified to removes all the remaining cellular debris and unwanted material Polymerase chain reaction (PCR) is an in vitro or laboratory technique used to amplify sequences of DNA of interest It is an artificial process which mimics a natural DNA replication, also known as molecular photocopying Positive control is one that you expect to work under the conditions given The positive control will test your master mix, MgCl2 amounts, primer annealing temperature and extension times If your positive control does not work, those results indicate that something is wrong with your annealing or extension times or temperatures, MgCl2, master mix set up Negative control is one which should not give you amplicons, typically the negative control will contain no template or have one/ the other primer Setting up two negative controls, each containing only the forward or reverse primer, should not provide visible amplicons Thus, any visible bands might be a result of contamination or multiple opposing binding sites for the designed primers Ladder consists of a set of DNA fragments of different sizes These DNA fragments are separated and visualised as DNA bands on agarose or SDS DNA gels DNA ladders are used during gel electrophoresis to determine both sizes as well as for the quantification of PCR products In this experiment, we used the Invitrogen 100 bp DNA Ladder This ladder is designed for sizing and approximate quantification of double-stranded DNA in the range of 100 bp to 2,000 bp It is prepared from a plasmid containing repeats of a 100 bp DNA fragment The ladder consists of 15 blunt-ended fragments ranging in length from 100 to 1,500 bp, at 100 bp increments, and an additional fragment at 2,072 bp 100 bp DNA Ladder is ideal for separation on 1–2% agarose gels PCR mechanism PCR tube components Chemical/ Solution H2 O My Taq Mix 2X DNA Primer Vp26 F Primer Vp26 R Total Volume (L) 14 0.5 0.5 25 Primer Sequence 5’-3’ sequence F: GTCTTCTGACGCAATCGTTG R: ATACGAGTGGTTGCTGTCATG Vibrio Primer Gen ToxR Kim et al (1999) Amplifier Length (bp) 368 Processing Step Initialization Process Denaturation Annealing Elongation Final elongation Amplifier Final hold Temperature 94 94 54 72 72 10 Time 50 sec 30 sec 20 second Forever Cycle 35 PCR result Positive control Ladder 10 11 12 13 14 15 1500bp 500bp Large agarose gel electrophoresis result from white spot syndrome virus Meaning No.8: Trần Thị Thảo My No.9: Trần Yến Nhi No.10: Trần Nguyễn Nguyệt Thanh − All samples were tested negative for WSSV − The result has proven that the shrimps we used for this experiment were not infected by WSSV Disscusion Although the result has clearly proven that WSSV did not infects the shrimps, there are still some theories that may cause errors in PCR result and lead to false-negative test result: − When we used the micropipette to take the sample from eppendorf, we did not shake the tube carefully Thus, we just took the water on the surface which is not contain the DNA − An incorrect PCR primer can lead to a failed reaction - one in which the wrong gene fragment or no fragment is synthesized − The DNA samples were not stored in negative temperature Thus, the DNA was damaged and inactivated Questions Why is a DNA standard ladder important? The DNA ladder is a composition of standard-size fragments that runs according to their fragment size It contains a series of DNA fragments of known molecular weight that we compare to our experimental samples and helps to determine the size of DNA fragments and to be popular markers What kind of chemical is used to dye the gel to see the bands in the gel? Why? The chemical uses to dye the gel is Safeview because the sample is dyed with better quality, safe and minimizes the possibility of toxicity to users Besides, Safeview can be decomposed in sunlight, we can rest assured about the number of toxins left on the skin When to use large comb and small comb in electrophoresis? We use the large comb when there are few samples with large volumes because the large comb has few wells and the gap between each slit is large, so the sample with a large volume will be easier to pass Small comb is used when there are many samples with a small volumes because the small comb has many wells and the distance between each slit is small, then it is easier for sample with a small volume to pass through the slit PART II: INVESTIGATE THE EFFECTS OF BACTERIOPHAGES ON BACTERIA I Introduction Bacteriophages (phages) are viruses of bacteria that can kill and lyse the bacteria they infect After their discovery early in the 20th century, phages were widely used to treat various bacterial diseases in people and animals Phages get into a bacterium, where they multiply, and finally they break the bacterial cell open to release the new viruses Theoretically, there are no bacteria that cannot be lysed by at least one bacteriophage In this regard, bacteriophages are significantly more effective than antibiotics, as, although some antimicrobial drugs have a very large spectrum of activity, an antibiotic able to kill all the bacterial species does not exist However, the most attractive characteristic of bacteriophages is their specificity of action, i.e., their ability to kill only the pathogen that they can recognize Purpose: The goal of this method is to investigate the effects of bacteriophages on bacteria, some factors are used in this experiment such as the concentration of bacteriophage population solution, time factor, etc After the experiment, we can discover bacteriophages’ factors which have effects on the number of colonies of bacteria II Calculate 104 plaques 𝑝𝑙𝑎𝑞𝑢𝑒𝑠 𝑐𝑜𝑢𝑛𝑡𝑒𝑑 𝑃𝑓𝑢 = 𝑣𝑜𝑙𝑢𝑚𝑒 𝑥 𝑑𝑖𝑙𝑢𝑡𝑖𝑜𝑛 = 104 𝑥 1000 𝑥 500 𝑥 10−3 = 1.664 (Pfu/ml) 19 plaques 𝑃𝑓𝑢 = 𝑝𝑙𝑎𝑞𝑢𝑒𝑠 𝑐𝑜𝑢𝑛𝑡𝑒𝑑 𝑣𝑜𝑙𝑢𝑚𝑒 𝑥 𝑑𝑖𝑙𝑢𝑡𝑖𝑜𝑛 10 = 19 1000 𝑥 500 𝑥 10−3 = 0.038 (Pfu/ml) 25 plaques 𝑃𝑓𝑢 = 𝑝𝑙𝑎𝑞𝑢𝑒𝑠 𝑐𝑜𝑢𝑛𝑡𝑒𝑑 𝑣𝑜𝑙𝑢𝑚𝑒 𝑥 𝑑𝑖𝑙𝑢𝑡𝑖𝑜𝑛 = 25 1000 𝑥 500 𝑥 10−3 = 0.05 (Pfu/ml) IMOJEV vaccine contains 4,0 – 5,8 log PFU It indicates that in 0.5mL of the solution contains enough virus particles to produce 4,0 – 5,8 log infectious plaques 11 PART III: INDIVIDUAL POINTS After this virology laboratory course, our group have been provided basic and specialised knowledge of viruses and methods used in virology, for examples, DNA extraction and purification, PCR (Polymerase chain reaction) Besides, we have been taught about principle of basic tool and equipments in molecular biology lab for virus research such as manipulation of using micropipette and operating PCR, etc We also know how to calculate CFU, PFU, MOI and how to operate the laboratory equipments This thing is extremely meaningful because the majority of the group’s members have never practiced with the PCR experiments before Moreover, we were trained about self-study ability and problem-solving skills in the learning and working process We really appreciate the enthusiastic guidance of Ms Trương Thị Bích Vân, Mr Trần Văn Bé Năm and teachers in Biotechnology Institute, supporting and giving us the opportunities to work in the laboratory in the most effective way while ensuring the safety Nevertheless, our group has some suggestions for improvement for virology laboratory course: − Althought the lecturers have provided related textbooks and taught us about the lessons before doing the experiments, it would be better if we were given printed books During experiments, we can note important information directly into the textbooks and we can prepare the lessons by reading step by step before doing experiments − The laboratory is full of equipment but the space is limited In the COVID pandemic situation, it was difficult to keep distance from others and very hard to observe clearly while lecturers were operating the equipment If we have a chace to work in this laboratory in next semesters, we request a larger space for the safety and convenience − In this semester, our class does not have much time left in the laboratory due to the pandemic, thus, the practical time is limited We hope that we will have more time to the experiments carefully and repeat experiments many times, so we can reduce the risk of errors in the results and also practice some crucial techniques while operating or using equipment 12