Advanced methods for genetic engineering

See discussions, stats, and author profiles for this publication at: https://www.researchgate.net/publication/274735317 Advanced methods for genetic engineering of Haematococcus pluvialis (Chlorophyceae, Volvocales) Article in Algal Research · April 2015 DOI: 10.1016/j.algal.2015.03.022 CITATIONS READS 572 5 authors, including: Revital Sharon-Gojman Aliza Zarka Ben-Gurion University of the Negev Ben-Gurion University of the Negev 1 PUBLICATION 7 CITATIONS 41 PUBLICATIONS 1,059 CITATIONS SEE PROFILE SEE PROFILE Sammy Boussiba Ben-Gurion University of the Negev 141 PUBLICATIONS 4,382 CITATIONS SEE PROFILE All content following this page was uploaded by Sammy Boussiba on 11 April 2015 The user has requested enhancement of the downloaded file All in-text references underlined in blue are added to the original document and are linked to publications on ResearchGate, letting you access and read them immediately Algal Research 10 (2015) 8–15 Contents lists available at ScienceDirect Algal Research journal homepage: www.elsevier.com/locate/algal Advanced methods for genetic engineering of Haematococcus pluvialis (Chlorophyceae, Volvocales) Revital Sharon-Gojman, Edo Maimon, Stefan Leu, Aliza Zarka, Sammy Boussiba ⁎ Microalgal Biotechnology Laboratory, French Associates, The Albert Katz Department of Dryland Biotechnologies, The Jacob Blaustein Institutes for Desert Research, Ben-Gurion University of the Negev, Sede Boker Campus, 84990 Israel a r t i c l e i n f o Article history: Received 23 September 2014 Received in revised form March 2015 Accepted 28 March 2015 Available online xxxx Keywords: Genetic engineering Transformation Haematococcus pluvialis Phytoene desaturase a b s t r a c t An advanced shuttle-vector for efficient nuclear transformation and genetic engineering of Haematococcus pluvialis has been developed and tested by inserting linked trans-genes The phytoene desaturase (pds) gene mutated in the codon for the amino acid at position 504 (from leucine to arginine), yields an enzyme resistant to the herbicide norflurazon and is used as an endogenous selection marker for transformation of H pluvialis A novel cloning vector allowing insertion of additional genes, both at the 5′ and the 3′ end of the mutated pds, has been designed by inserting the selection marker into the cloning vector pBluescript II SK(−) to give pBS–pds featuring the genomic mutated pds including 2000 bp of its promoter In a second version pBS–pds short was created, by shortening the promoter sequence to 1000 bp Unique restriction sites 5′ and 3′ of the selection marker have been reserved for insertion and simultaneous transformation with two transgenes Transformation efficiency was significantly better than previously reported, achieving transformation frequencies of × 10−5 both with long and short promoters, as well as with linear constructs An expression cassette for the ble derived from vector pGenD-ble was inserted into pBS-pds either 5′ or 3′ of the pds, and successfully transformed into H pluvialis, resulting in engineered strains weakly expressing the ble mRNA driven by the Chlamydomonas reinhardtii PsaD promoter Both circular plasmids, as well as linear DNA fragments only consisting of the ble cassette fused to the pds selection marker were used successfully to engineer H pluvialis The plasmid constructs presented here, as well as the use of an endogenous dominant selection marker, represent a blueprint for the future successful production of safe, genetically modified microalgae, for the possible production of high value products or biofuels © 2015 Elsevier B.V All rights reserved Introduction Microalgae have high areal biomass productivity and can accumulate significant concentrations of high value products, or over 50% of dry weight as oil in the form of triacylglycerol (TAG) under adequate conditions [30,31,33,41] The suitability of microalgae as a potential source of biofuel has attracted increased interest in microalgal biotechnology [5,7,11,17,19,26,35,36,41] Microalgae produce a wide range of high-value products including carotenoids and polyunsaturated fatty acids (PUFAs), both constitutively in the frame of primary metabolism or inductively as a secondary metabolism response to various stresses [1,3,9,17] The production of such pharmaceutically and nutraceutically important chemicals is one of the most promising approaches for the commercial exploitation of microalgae However, algal strains and production processes require significant improvements at various levels, to compete successfully with products used in food, cosmetics, aquaculture and agriculture, that are prepared synthetically or extracted from other natural feedstock In general, estimated microalgal product prices ⁎ Corresponding author E-mail address: sammy@bgu.ac.il (S Boussiba) http://dx.doi.org/10.1016/j.algal.2015.03.022 2211-9264/© 2015 Elsevier B.V All rights reserved (fuels, carotenoids, PUFA, protein etc.) are about 3–5 times above the market prices for competing products from other sources [22] Thus, significant advances in biomass and product accumulation rates, cheaper cultivation technologies and improved harvesting and product extraction procedures are required for advancing the competitiveness of microalgal products [11,41] One of the main approaches for improving productivities of microalgae is successful genetic engineering using safe technologies facilitating outdoor cultivation and product marketing Most technologies of microalgae transformation have relied on the insertion of bacterial antibiotics markers driven by viral or algal promoter elements [2,14,21,29,39] Successful nuclear transformation and metabolic engineering so far have been reported only in Chlamydomonas reinhardtii, Phaeodactylum tricornutum and Thalassiosira pseudonana [16,27,38] The unicellular green alga Haematococcus pluvialis (H pluvialis) is regarded as the best natural source for the high-value red pigment astaxanthin, a carotenoid that is accumulated in cytoplasmic oil globules under various stress conditions [3] Accumulation of astaxanthin in H pluvialis is positively correlated with lipid accumulation [34,42,43] Under nitrate deprivation, astaxanthin and fatty acid contents can reach up to 4% and 40% of cell dry mass, respectively [42] In H pluvialis R Sharon-Gojman et al / Algal Research 10 (2015) 8–15 astaxanthin serves as protective pigment against exposure to excessive light [28,40] Natural astaxanthin from H pluvialis is a popular high price nutraceutical product successfully produced in Israel at Kibbutz Qetura using Ben-Gurion University's (BGU) proprietary technology [8] The major commercial use of much cheaper synthetically produced astaxanthin is as a colorant for aquaculture, primarily for salmonids [24] Astaxanthin productivity of H pluvialis is limited by intrinsically slow proliferation, sensitivity to environmental stresses and contaminants and slow induction of pigment accumulation [4,22], so that the production price for natural astaxanthin is significantly higher than the price of the synthetic compound Therefore, genetic engineering of this alga for increased growth, resilience and carotenoid productivity is a major goal in algal biotechnology, for more competitive pigment production, in the face of growing competition and significantly larger market opportunities in the aquaculture sector H pluvialis was successfully transformed by microparticle bombardment with the pPlat-pds vector developed by Steinbrenner and Sandmann [37], which carries a mutated copy of the pds conferring resistance to the herbicide norflurazon Recently, chloroplast transformation in H pluvialis using the C reinhardtii aadA expression cassette [12] was also reported [15] However, robust nuclear transformation and successful genetic engineering have not been demonstrated in this valuable algae species, due to lack of suitable shuttle vectors and adequate transformation frequencies We present here a novel transformation and expression vector for high efficiency transformation and simultaneous expression of two additional transgenes in H pluvialis Based on an endogenous dominant marker, the vector also permits the production of safe transgenic algae strains that not contain foreign DNA sequences Table Primers used for cloning and construction of the various transformation plasmids Restriction sites are marked with bold italic Name of plasmid Name of primer F/R Primer sequence pBS–pds S pdsSHindIIIF F pdsEcoRIR R pdsLHindIIIF F pdsEcoRIR R blepGenDKpnIF blepGenDXhoIR blepGenDBamHIF blepGenDXbaIR F R F R pBS–pds L pBS–pds S/L–ble KpnI, XhoI pBS–pds S/L–ble BamHI, XbaI ATAGAAGCTTCTGTACGCCATTGT ACGCCG GCGAATTCTGACCCCATATCCGTT ACTGCC ATAGAAGCTTGCACAGTTAGAGGC GTGGTTGC GCGAATTCTGACCCCATATCCGTT ACTGCC AGTGGTACCCACACACCTGC CGGTCTCGAGAAGCTTGATT AGTGGATCCCACACACCTGC CGGTCTAGAGAAGCTTGATT 2.5 Gel purification of DNA fragments DNA fragments were purified from agarose gels using the AccuPrep Gel purification kit (Bioneer), and ligated into plasmid DNA digested with compatible restriction sites, or by using the In-Fusion HD Cloning Kit (Clontech) according to the manufacturer's recommendations The plasmid was transformed into competent DH5α Escherichia coli (E coli) (Invitrogen, Life Technologies) which were than cultivated on solid LB agar media containing 100 μg × mL−1 ampicillin Linear transformation cassettes were extracted from plasmids by digestion with restriction enzymes cutting on both sides of the desired insert and purification from gel (Fig 1) Materials and methods 2.6 Construction of pBS–pds long and short 2.1 H pluvialis strain The pds cassette from pPlat–pds Mod4.1 [37] was amplified using PrimeStar HS DNA polymerase and primers: pdsSHindIIIF, pdsLHindIIIF, for pBS–pds short (S) and long (L), respectively and pdsEcoRIR for both (Table 1), restricted by HindIII and EcoRI and ligated into pBluescript II SK(−) Ligated plasmid was transformed into DH5α E coli cells and cultivated on solid LB agar media containing 200 μg × mL−1 ampicillin Transformed colonies were verified by PCR with the abovementioned primers and by DNA sequencing in the DNA sequencing center of BenGurion University (BGU), Israel pBS–pds long contains bases Nr 186 till 5825 of plasmid pPlat–pds (accession number DQ404589, the pds cassette including the full length promoter) pBS–pds short contains bases Nr 1212 till 5825 of plasmid pPlat–pds cassette including short version of promoter H pluvialis Flotow 1844 em Wille 1903, SCCAP K-0084 (Chlorophyceae, order Volvocales) was obtained from the Scandinavia Culture Center for Algae and Protozoa (SCCAP) at the University of Copenhagen, Denmark 2.2 Growth conditions for algal cultures H pluvialis algal cultures were grown from a cell concentration of × 105 cell × mL− (determined with a hemocytometer) in 250 mL flasks, each containing 100 mL of modified BG-11 medium [6]; the flasks were held in a shaker (150 RPM) enriched with CO2 (300 mL × min−1) at 25°C, 110–140 μmol photon × m−2 × s−1 Under these conditions the cultures reach a stationary stage within one week 2.3 DNA manipulation and cloning Total H pluvialis DNA was purified as described [32] with slight modifications, or by using the DNeasy plant mini kit (Qiagen) after breaking the cells in Retsch MM400 Mixer Mill using mm metal beads for several rounds of 40 s, 25 Hz or grinding by mortar and pestle in the presence of liquid nitrogen PCR reactions were performed using the following DNA polymerases: Go-Taq (Promega), Ex-Taq (TAKARA) and PrimeStar HS (TAKARA) using the primers described in Table 2.4 Primer design Primers were designed using the VectorNti advance 11.0 (Invitrogen, Life Technologies) software Alignments and sequencing results were viewed by BioEdit Sequence Alignment Editor 7.0.5.3 PCR primers used for cloning and sub-cloning of pBS–pds and pBS– pds–ble are shown in Table 2.7 Construction of pBS–pds–S/L–ble KpnI–XhoI The PsaD–ble cassette from pGenD–ble [10] was amplified using ExTaq DNA polymerase (TAKARA) and primers blepGenDKpnIF and blepGenDXhoIR (Table 1) PCR product was cut and cleaned from gel using the Bioneer AccuPrep Gel purification kit followed by ligation into pGem-T-easy and transformation into JM109 E coli cells Cells were cultivated on 100 μg × mL−1 ampicillin-LB agar plates Transformed colonies were verified by PCR with the abovementioned primers The PsaD–ble cassette was extracted with KpnI and XhoI restriction enzymes from extracted plasmids using the Bioneer AccuPrep Plasmid Mini extraction kit Restricted PsaD–ble was ligated into KpnI–XhoI restricted pBS–pds S or Land transformed into E coli DH5α Transformed colonies were verified by restriction assay using EcoRI and BglII and DNA sequencing 2.8 Construction of pBS–pds-S/L-ble BamHI–XbaI The PsaD–ble cassette from pGenD–ble [10] was amplified using PrimeStar HS DNA polymerase (TAKARA) and primers blepGenDBamHIF 10 R Sharon-Gojman et al / Algal Research 10 (2015) 8–15 Gene A amp amp pBS - pds long pBS - pds short 8599 bp 7571 bp pds pds B pds pds short - Gene pds pds short - Gene pds pds short - Gene +2 Fig A Maps of pBS–pds long (left) and pBS–pds short (right); the mutation L–R in the CDS of pds (green) conferring resistance to norflurazon is indicated in purple The map of pBS–pds short is presented with confirmed insertion options for transgenes 5′ and 3′ of the selection marker using the polylinker sequences bordering the pds cassette in pBS–pds pBS–pds long is of exactly the same structure with a 1000 bp promoter region longer B linear fragments of pds with insertion of Gene 1, Gene or both (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.) and blepGenDXbaIR PCR product was cut and cleaned from gel using the Bioneer AccuPrep Gel purification kit followed by ligation into pGem-Teasy and transformation into DH5α E coli cells Cells were cultivated on 100 μg × mL−1 ampicillin-LB agar plates Transformed colonies were verified by PCR with the above mentioned primers Extracted plasmids using the Bioneer AccuPrep Plasmid Mini extraction kit were used for restriction of the PsaD–ble cassette with BamHI–XbaI restriction enzymes Restricted PsaD–ble was ligated into BamHI–XbaI restricted pBS–pds S/L and transformed into DH5α cells and cultivated on solid LB agar media containing 100 μg × mL−1 ampicillin Transformed colonies were verified by restriction assays with EcoRI, BglII and DNA sequencing Transformed colonies were grown successfully for long time periods, both in the presence and absence of selection pressure in our lab 2.9 Transformation of H pluvialis 2.11 PCR and DNA sequencing H pluvialis was transformed using the PDS-1000/He particle delivery system (BioRad) according to the manufacturer's instructions μg plasmid or linear DNA was used to coat 0.6 μm gold particles (BioRad) Twofour days after diluting stationary H pluvialis culture (hereby, referred as 2–4 days old), 2–10 million cells, were plated onto TAP medium [13], 1.5% agarose and were bombarded from a distance of cm using 1350 psi rupture disks Two separate bombardments were conducted with each construct DNA was omitted from control and bombarded once After night of recovery, cells were removed from the bombarded plates using TAP medium, and divided into two TAP plates supplemented with either or μM norflurazon Transformed colonies started to appear after 8–28 days of incubation at optimal conditions of 20– 40 μmol photon × m−2 × s−1, 25°C On-Colony PCR was applied on norflorazon resistant colonies as follows: resistant colonies were picked and scraped from selection plates, mixed with ethanol and 5% Chelex®100 and then broken in Mini Beadbeater (Biospec products, OK, USA), using 2.5 mm glass beads for several rounds on ice Colonies were then lysed by incubation at 98°C for 10 min, centrifuged and used for PCR with primers corresponding to 500 bp region including the mutation site of pds sequence: F-AGCT TGCTCTGCTGTGCCAG, R-GCTATTGCACCACTGGCTGC PCR product was extracted from gel as described previously and sent for sequencing The same procedure, excluding sequencing, was applied for transformed colonies bombarded with the PsaD–ble cassette containing constructs with appropriate primers: F-CACACCTGCCCGTCTGCCTGA, RTGCCGTCCGTCCACTGACC for full PsaD–ble cassette and F-CCCCACTG 2.10 Isolation and quantification of total RNA Isolation of total RNA was performed using the SV Total RNA isolation kit (Promega USA) Approximately × 107 cells were pelleted from 10 mL culture (1500 g, 10 min) Cells were then broken in a Retsch MM400 Mixer Mill using mm metal beads for several rounds of 40 s, 25 Hz RNA samples were quantified using a Nano Drop (ND-1000, Thermo Scientific, USA) spectrophotometer and stored at −80°C R Sharon-Gojman et al / Algal Research 10 (2015) 8–15 11 CTACTCACAACA, R-TTAGTCCTGCTCCTCGGCCA for full 408 bp ble coding sequence (CDS) including the end of PsaD 5′ untranslated region (UTR) short and the long promoter versions were detected, though significantly higher efficiencies than with pPlat–pds were achieved (Table 2) 2.12 cDNA preparation 3.3 Molecular architecture of pBS–pds cDNA was synthesized from total RNA by the Verso cDNA synthesis kit (Thermo Scientific), according to the manufacturer's instructions including treatment with DNase This cDNA was used as template for PCR amplification with appropriate primers: F-TAGGACCCCACTGCTACTCA CAA, R-TGCCGTCCGTCCACTGACC specific to the PsaD 5′ and 3′ UTR covering the full PsaD–ble cassette sequence Results The pBS–pds vectors harboring mutated pds have been designed to contain several unique restriction sites for insertion of transgenes (Fig 1) Thus, a number of restriction sites, both at the 5′ and 3′ of the pds, allow insertion of additional transgenes for co-transformation using the mutated pds as selection marker (Fig 1A) The unique restriction sites provided at both sides of both inserts facilitate extraction of the linear DNA cassette consisting of transgenes and the endogenous DNA marker (Fig 1B) 3.1 Transformation with pPlat–pds 3.4 Transformation with pBS–pds and co-insertion of the PsaD–ble cassette Nuclear transformation of H pluvialis, with pPlat–pds vector harboring the mutated pds conferring resistance to norflurazon, was done according to the method described by Steinbrenner and Sandmann [37] and yielded approximately 380 resistant colonies out of 18 × 107 cells No resistant colonies were obtained in control experiments, in which the plasmid DNA was omitted Very high variability in number of transformed colonies per plate was observed, indicating a central role of cells' handling and recovery, such as: cultivation, plating, re-plating and incubation conditions during the recovery period on the apparent transformation efficiency Conditions applied were as described in Materials and methods Testing bombardment with different rupture disc calibers or bombardment distances yielded either equal or worse transformation frequencies The best relative transformation frequency was achieved with two days old cells plating × 106 per plate Transformed colonies were maintained through successive platings for more than 33 months and stable insertion of the mutated gene was verified by extended periods of cultivation both in the absence or presence of selective pressure, and subsequent PCR amplification and sequencing of the pds The usefulness of this concept was tested by inserting the PsaD–ble cassette under the control of the C reinhardtii PsaD promoter from pGenD–ble [10] This cassette was excised and added upstream of the mutated pds using the KpnI and XhoI restriction sites, or downstream of the selection marker using the BamHI and XbaI sites (Fig 2) Both versions were produced using the pBS–pds short (S) or long (L) versions (Figs and 2) Resulting plasmids were transformed successfully into H pluvialis, yielding norflurazon- resistant colonies, though yielding lower transformation frequency (Table 2) Successful incorporation of the PsaD–ble cassette was verified by PCR amplification using primers specific to the ble inserted at the end of the PsaD 5′ and at the end of the ble CDS as drawn in Fig All colonies derived from transformation with pBS–pds S–ble BamHI, XbaI; pBS–pds L–ble BamHI, XbaI; pBS–pds S–ble KpnI, XhoI; pBS–pds L–ble KpnI, XhoI; or with linear DNA fragments extracted from those plasmids, featured a PCR product corresponding to the size expected from the inserted ble with the possible exception of lane (Fig 3), while no signal was obtained with control H pluvialis DNA The 100% yield of co-insertion of ble observed indicates that additional genes linked to pds in pBS–pds can be transformed into H pluvialis with very high efficiency Also, insertion appears to occur very near to the end of the linear DNA fragments, since all resistant clones tested also featured the full size PsaD-ble cassette PCR product (conducted on extracted gDNA, not shown) WT (wild type) DNA yielded no PCR product for this gene while a positive control PCR yielded the expected product (Fig 3) The ble gene was weakly transcribed into RNA transcripts, as confirmed by PCR amplification of cDNA template synthesized from extracted RNA of transformed colonies (Fig 4) The PCR product includes 986bp corresponding to a partial 5' PsaD UTR, the full ble CDS (intronless), and PsaD 3' UTR PCR transcript Moreover, 3.2 Construction and testing of pBS–pds long and short An analysis of an approximately kb fragment of the promoter region of pds revealed that it contains several repetitive elements In order to examine whether these elements interfere with, or reduce expression of the gene, pBS–pds long and pBS–pds short (Fig 1) were produced containing either ~ 2000 or ~ 1000 bp of the promoter region (GenBank accession numbers: KP869828 and KP869829), respectively Transformation of H pluvialis was tested carefully using both constructs, but no significant difference in transformation efficiency between the Table Transformation frequencies achieved with various constructs Only one bombarded spontaneously resistant colony grew on 2μM norflurazon Vector Description No of bombarded cells No of resistant coloniesa Frequency of resistant colonies Average no per plate + standard error No DNAb pPlat–pds pBS–pds S pBS–pds L pds S linear pds L linear pBS–pds S–ble BamHI, XbaI – Plasmid received from [37] pBS–pds with short (~1000 bp) promoter sequence pBS–pds with full-length (~2000 bp) promoter sequence pBS–pds S linearized with HindIII, EcoRI pBS–pds L linearized with HindIII, EcoRI pBS–pds S + PsaD–ble cassette at the 3′ end (BamHI, XbaI) of pds pBS–pds L + PsaD–ble cassette at the 3′ end (BamHI, XbaI) of pds pBS–pds S + PsaD–ble cassette at the 5′ end (KpnI, XhoI) of pds pBS–pds L + PsaD–ble cassette at the 5′ end (KpnI, XhoI) of pds pBS–pds S–ble linearized with KpnI, XbaI pBS–pds L–ble linearized with KpnI, XbaI × 106 18 × 107 × 106 × 106 × 106 × 106 × 106 380 94 111 61 88 29 3.3 × 10−7 × 10−6 1.57 × 10−5 1.85 × 10−5 1.02 × 10−5 1.47 × 10−5 4.83 × 10−6 0.5 ± 0.25 21.1 ± 7.24 23.5 ± 3.9 27.75 ± 2.8 15.25 ± 2.9 22 ± 5.5 7.25 ± 2.4 × 106 58 9.67 × 10−6 14.5 ± 1.25 pBS–pds L–ble BamHI, XbaI pBS–pds S–ble KpnI, XhoI pBS–pds L–ble KpnI, XhoIc pds S–ble KpnI, XhoI pds L–ble KpnI, XhoI a b c 6 × 10 × 106 × 106 × 106 39 18 25 −6 6.5 × 10 – × 10−6 4.17 × 10−6 9.75 ± 1.6 – 4.5 ± 0.6 6.25 ± 1.6 The number of resistant colonies is the total obtained by shootings and per selection plates totaling · 106 cells No DNA — one shooting was applied on control in which bombarded cells were divided into two selection plates pBS–pds L–ble KpnI, XhoI was excluded from analysis since one of the shooting yielded no resistant colonies in either selection plate, probably due to experimental error 12 R Sharon-Gojman et al / Algal Research 10 (2015) 8–15 ble psaD 5' UTR ( C reinhardtii ) amp amp pds pBS - pds S- ble Kpn I pBS - pds S- ble Bam H I 9393 bp 9397 bp psaD 5' UTR ( C reinhardtii ) Promoter short Promoter short pds ble Fig Map of pBS–pds S–ble KpnI, XhoI at the 5′ end/BamHI, XbaI at the 3′ end The ble CDS of pGenD–ble is designated in yellow; the C reinhardtii PsaD promoter and 3′ UTR are designated in pink Restriction sites are indicated Note that the ble cassette was inserted either at the 5′ of pds (KpnI, XhoI) or at the 3′end (BamHI, XbaI) PCR primers are indicated by F and R (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.) insertion of the PsaD–ble cassette did not result in noticeable resistance to zeocin in most of the clones checked, but rather resulted in a less fit, slow growing phenotype of H pluvialis This indicates that ble is not expressed sufficiently into a functional protein in those transformed cells possibly due to unsuitable codon use This is not an unexpected result considering that resistance was not originally selected for, and that zeocin resistance depends directly on the amount of protein expressed 3.5 Transformation of H pluvialis with linear constructs The inserts of pBS–pds S or pBS–pds L with the ble added 5′ or 3′ to the mutated pds selection marker gene, were extracted using restriction endonucleases and these linear DNA fragments were used to successfully transform H pluvialis at frequencies similar to circular plasmids (Table 2) Norflurazon-resistant colonies were isolated and analyzed The mutated DNA genotype was confirmed by PCR and DNA sequencing (data not shown) The transgene inserted was confirmed by PCR of the full-length CDS (Fig 3) and the full PsaD–ble cassette (data not shown) No significant differences in transformation efficiencies between the two fragments were observed, whether the PsaD–ble cassette was inserted 5′ or 3′ of pds (Table 2) In all transformed colonies the PsaD– ble cassette was inserted together with the mutated pds selection marker as confirmed by PCR (Fig 3), and by confirming the presence of ble– mRNA after PCR amplification of cDNA from transformed colonies (Fig 4) This demonstrates that transgenes linked to the mutated pds selection marker gene are efficiently incorporated into the genomes of transformed colonies 3.6 Confirmation of transgene incorporation Transformed colonies were maintained for more than 16 months with periodically successive transfers and stable insertion of the mutated pds was verified by extended periods of cultivation both in the absence and presence of norflurazon The pds and ble were amplified by PCR and partial region of pds including the mutation site and ble were subjected to DNA sequencing (see Figs and for representative results) All the transformed norflurazon-resistant colonies revealed the DNA sequence of the donor plasmid derived from pPlat–pds The point mutation conferring norflurazon resistance was identified in all transformed colonies (GC instead of TG in position 5185–5186 in the mutated pds) (Fig 5A) Insertion of the foreign DNA was also confirmed by the presence of polymorphisms in the introns of the pds The sequence of pds in pPlat–pds was derived from H pluvialis strain NIES-144 [37] While pds of transformed strains showed a sequence similar to that of the pPlat–pds, the WT strain (1844 em Wille K-0084 (SCCAP)) pds (GenBank accession number: KP826910) and a spontaneous norflurazon-resistant strain showed a different sequence (Fig 5B) Moreover, sequencing of partial PsaD 5' UTR, full ble CDS, and 3' UTR of PsaD verified insertion of PsaD-ble cassette in all tested colonies (data not shown) In addition, Southern blot analysis using a ble specific 500 bp 500 bp Fig On-colony PCR of ble in several pBS–pds–ble or linear pds–ble transformed colonies 407 bp PCR product corresponding to the full CDS of ble and the end of PsaD 5′ UTR was found in all transformed colonies tested 1–17 — various transformed colonies containing the following constructs: 1, 2, 3, 4, — pBS–pds–L–ble BamHI, 6, 7, — pBS–pds–S–ble KpnI, 9, 10, 11 — pBS–pds–S–ble BamHI, 12, 13 — pds–S–ble KpnI (linear), 14, 15, 16, 17 — pds–L–ble KpnI (linear),18, 19 — pBS–pds–S–ble KpnI/BamHI plasmids, respectively, 20, 21 — pBS–pds–L–ble KpnI/ BamHI plasmids, respectively, 22 — H pluvialis gDNA, 23 — no DNA, M — marker R Sharon-Gojman et al / Algal Research 10 (2015) 8–15 13 kb kb Fig All transformed colonies except 14 exhibited the 986bp ble PCR transcript in moderate levels of expression cDNA served as template for PCR reaction 1–17 — various transformed colonies containing the following constructs: 17, 14–16 — pds–L–ble KpnI (linear),12, 13 — pds–S–ble KpnI (linear), 6–8 — pBS–pds–S–ble KpnI, 9–10 — pBS–pds–S–ble BamHI, 1–3 — pBS– pds–L–ble BamHI, 18 — H pluvialis gDNA, 19, 21 — pBS–pds–S–ble KpnI/BamHI plasmids, respectively, 20, 22 — pBS–pds–L–ble KpnI/BamHI plasmids, respectively, 23 — no DNA, M — marker probe (corresponding to the full ble CDS and the 3′ UTR region of the PsaD– ble cassette) was performed using isolated gDNA of transformed colonies digested by BamHI and BglII At least one clear ble copy was detected in the gDNA of six out of eight colonies tested (in three of them, additional copy was detected); WT and empty vector negative control colonies did not display a ble copy, as expected (data not shown) All together these results confirm the successful introduction of the pPlat–pds derived mutated gene into the genome This confirms the usefulness of the pBS–pds transformation vectors for stably inserting transgenes added both 3′ and 5′ to the selection marker into the genome of H pluvialis 3.7 Transformation frequencies with various constructs H pluvialis cells were bombarded with all DNA constructs described in Table 2; resistant colonies appeared 8–28 days after selection on norflurazon-TAP plates and were transferred onto fresh norflurazonTAP plates Transformation frequencies were determined based on the number of colonies per plate recognized by eye Between 18 and 111 resistant colonies were obtained per bombardment of × 106 cells as described in Materials and methods Transformation efficiencies of 3–18.5 × 10−6 were achieved, depending on the vector used (Table 2) This is more than an order of magnitude higher than previously reported frequencies of transformation of H pluvialis [37] Out of × 106 control cells plated onto selective medium, one spontaneously resistant mutant colony was obtained on TAP agar plates supplemented with norflurazon (Table 2) However, although this colony was spontaneously resistant to norflurazon, the partial pds sequence tested was identical to the WT strain, not exhibiting the GC to TG mutation (Fig 5A and B) Resistance is probably due to a different mechanism Transformation frequencies of short versus long and linear versus circular constructs were roughly the same However, addition of ble transgene lowered transformation frequency Improvement of transformation frequency was achieved by optimized cultivation and recovery procedures and the use of gold particles for bombardment instead of tungsten Discussion A large number of possible commercial applications for microalgae have been suggested and are being investigated However, algal strains and production processes for various pigments or PUFAs require significant improvements to compete successfully with currently used products Strain improvements by genetic engineering for higher product yields [11,22], and promoting the acceptability of transgenic algae in the market and with regulatory authorities [18] are key challenges in promoting the future success of microalgal biotechnology in the high value and bulk product markets In the specific case of H pluvialis, the specific challenge is reducing astaxanthin production costs by a factor of 3–4, for accessing the far larger aquaculture feed market with natural pigment This could be achieved by increasing astaxanthin accumulation, enhancing biomass productivity by means of genetic engineering and simultaneously reducing cultivation costs by moving to cheaper open pond production [22] Thus, adequate methods for genetic engineering of this commercially important species are required We have tested multiple approaches and DNA delivery techniques for establishing H pluvialis transformation Attempts using various vectors and selection marker genes using particle gun bombardment, electroporation or Agrobacterium tumefaciens-mediated genetic transformation (AtMGT) were all un-successful Neither transformation with pCambia 1301/2 (CAMV35S promoter and hyg selection marker), nor with pSP124S harboring the rbcS2 promoter and the Sh–ble selection marker gene with an rbcS2 introns [25], nor with pGenD–ble, harboring the PsaD promoter of C reinhardtii and the Sh–ble selection marker gene, was successful Attempts to reproduce the method reported by Kathiresan et al [20] using AtMGT were unsuccessful as well, possibly due to the difference in the strain Only testing the method described by Steinbrenner and Sandmann [37] using the mutated pds gene, conferring resistance to norflurazon, proved effective at the end However, the pPlat–pds plasmid, kindly provided by G Sandmann, proved unpractical for any genetic engineering approach, and long UTR's appeared to interfere with standard molecular genetics 14 R Sharon-Gojman et al / Algal Research 10 (2015) 8–15 A B Fig DNA sequence of 12 transformed colonies compared to the sequence of wild type and a spontaneous bombarded norflurazon resistant strain (bottom rows) and pPlat–pds (first upper row) A The mutation site conferring norflurazon resistance is marked by a red box (WT: TG; mutant: GC) B Successful integration of mutated pds into the genome is indicated by polymorphism in pds intron Various polymorphisms between the BGU strain (samples 13 and 19) and the mutated pds gene used for transformation [37] are marked with black frames on the lower panel A spontaneously resistant colony (no 19) does not contain the mutation; resistance is probably due to a different mechanism (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.) technologies, possibly due to the presence of repetitive DNA elements We therefore designed an advanced shuttle vector in the form of pBS– pds (Fig 1) featuring all requirements of an advanced shuttle vector for co-transformation of at least two additional transgenes Transformation frequency using this vector was up to twenty-fold higher than transformation with pPlat–pds (Table and [37]) In addition, transformed strains displayed resistance due to introduction of the selection marker for long time periods (up to 33 months), indicating high nuclear stability of the developed vector The new vector is designed such that linear DNA fragments consisting of the endogenous selection marker and one or two linked transgenes can easily be excised and used for transformation (Fig 1), thus removing all plasmid backbone DNA (and possible antibiotic markers) for safe transformation Such a vector structure can also serve as a blue-print for successful manipulation of different high value microalgae, as the pds and its mutation leading to norflurazon resistance are essentially ubiquitous [23] One amino acid substitution in pds makes Chlorella zofingiensis resistant to norflurazon and enhances the biosynthesis of carotenoids including astaxanthin [23] As such, the technologies presented here represent a game-changing progress in addressing the challenges of advanced genetic engineering methods in microalgae, exemplified using the high value green alga H pluvialis In order to profit from possible benefits of transgenic microalgae, outdoor cultivation in open ponds must be applied Most recent advances in genetic engineering of microalgae are based on the use of bacterial antibiotic markers that can represent significant regulatory obstacles for cultivation and marketing of the resulting algal biomass Microalgae are not included in most current regulatory EU documents concerning genetic engineering For most matters of biological safety microalgae can be considered microorganisms, such that transgenic microalgae would fall under regulations in the “Guidance Document of the EFSA genetically modified organism (GMO) Panel on the risk assessment of genetically modified microorganisms and their derived products intended for food and feed use” (http://www.efsa.europa.eu/en/efsajournal/pub/ 374.htm) According to those guidelines, nontoxic non-pathogenic GMO require cultivation in contained enclosures Outdoor cultivation without a lengthy licensing and testing period is not permitted Accordingly, so far no transgenic algae are cultivated outdoors anywhere R Sharon-Gojman et al / Algal Research 10 (2015) 8–15 However, genetically modified microalgae may be used without restrictions if they are the product of mutagenesis, or self-cloning consisting in the removal of nucleic acid sequences from a cell of an organism followed by reinsertion of all or part of that nucleic acid sequence Therefore, the use of endogenous dominant selection markers, such as: genes for mutated acetohydroxyacid synthase (ahas) [21] or mutated pds ([37], this paper) for transformation of microalgae is an important prerequisite for the creation of safe and applicable transgenic microalgae We have demonstrated here that the cassette containing the selection marker and the associated transgene can be easily excised from the plasmid and used successfully for transformation and insertion of additional transgenes both 3′ and 5′ of the selection marker, to create self-cloned strains without foreign DNA inserted Thus in conclusion, the transformation vector and technologies presented here allow not only more efficient transformation of microalgae, but also the creation of self-cloned, safe transgenic algae by adding endogenous genes intended for overexpression 5′ and 3′ to the endogenous selection marker Such transformation technologies for metabolic engineering of high value product accumulation, TAG or biomass productivity are essential tools for enhancing the impact of algal biotechnology in the future Acknowledgments The research leading to these results has received funding from GIAV AP Programme of the European Union's Seventh Framework Programme (FP7) under REA grant agreement no 362044 This work was submitted for patenting, BGU-P-040-USP References [1] C Aflalo, Y Meshulam, A Zarka, S Boussiba, On the relative efficiency of two- vs one-stage production of astaxanthin by the green alga Haematococcus pluvialis, Biotechnol Bioeng 98 (2007) 300–305, http://dx.doi.org/10.1002/bit [2] Botsch K, Szyjka S, Levine W, Curran A, O'Neill B, Mendez M, A system for transformation of the chloroplast genome of Scenedesmus sp and Dunaliella sp [patent] 2011, WO2011034863A1 [3] S Boussiba, Carotenogenesis in the green alga Haematococcus pluvialis: cellular physiology and stress response, Physiol Plant 108 (2000) 111–117 [4] S Boussiba, C Aflalo, An insight into the future of microalgal biotechnology, Innov Food Technol 28 (2005) 37–39 [5] S Boussiba, E Sandbank, G Shelef, Z Cohen, A Vonshak, A Ben-Amotz, S Arad, A Richmond, Outdoor cultivation of the marine microalga Isochrysis galbana in open raceways, Aquaculture 72 (1988) 247–253 [6] S Boussiba, A Vonshak, Astaxanthin accumulation in the green alga Haematococcus pluvialis, Plant Cell Physiol 32 (1991) 1077–1082 [7] S Boussiba, A Vonshak, Z Cohen, Y Avissar, A Richmond, Lipid and biomass production by the halotolerant microalga Nannochloropsis salina, Biomass 12 (1987) 37–47 [8] S Boussiba, A Vonshak, Z Cohen, A Richmond, A procedure for large-scale production of astaxanthin from Haematococcus, 1997 WO 97/28274 [9] Z Cohen, H.A Norman, Y.M HeImer, Microalgae as a source of omega-3 fatty acids, World Rev Nutr Diet 77 (1995) 1–31 [10] N Fischer, J.D Rochaix, The flanking regions of PsaD drive efficient gene expression in the nucleus of the green alga Chlamydomonas reinhardtii, Mol Genet Genomics 265 (2001) 888–894, http://dx.doi.org/10.1007/s004380100485 [11] D.R Georgianna, S.P Mayfield, Exploiting diversity and synthetic biology for the production of algal biofuels, Nature 488 (2012) 329–335, http://dx.doi.org/10 1038/nature11479 [12] M Goldschmidt-Clermont, Transgenic expression of aminoglycoside adenine transferase in the chloroplast: a selectable marker of site-directed transformation of Chlamydomonas, Nucleic Acids Res 19 (1991) 4083–4089 [13] D.S Gorman, R.P Levine, Cytochrome F and plastocyanin: their sequence in the photosynthetic electron transport chain of Chlamydomonas reinhardtii, Proc Natl Acad Sci U S A 54 (1965) 1665–1669 [14] S Guo, X Zhao, Y Tang, C Wan, M Alam, S Ho, F Bai, J Chang, Establishment of an efficient genetic transformation system in Scenedesmus obliquus, J Biotechnol 163 (2013) 61–68 [15] C.L Gutiérrez, C Escobar, S.H Marshall, Chloroplast genetic tool for the green micralgae Haematococcus pluvialis (Chlorophyceae, Volvocales), J Phycol 48 (2012) 976–983, http://dx.doi.org/10.1111/j.1529-8817.2012.1178-11-028.x [16] M.L Hamilton, R.P Haslam, J.A Napier, O Sayanova, Metabolic engineering of Phaeodactylum tricornutum for the enhanced accumulation of omega-3 long chain polyunsaturated fatty acids, Metab Eng 22 (2014) 3–9, http://dx.doi.org/10.1016/ j.ymben.2013.12.003 View publication stats 15 [17] J.L Harwood, I.A Guschina, The versatility of algae and their lipid metabolism, Biochimie 91 (2009) 679–684, http://dx.doi.org/10.1016/j.biochi.2008.11.004 [18] W.J Henleya, R.W Litakerb, L Novoveskáa, C.S Dukec, H.D Quemadad, R.T Sayree, Initial risk assessment of genetically modified (GM) microalgae for commodityscale biofuel cultivation, Algal Res (2013) 66–77 [19] Q Hu, M Sommerfeld, E Jarvis, M Ghirardi, M Posewitz, M Seibert, A Darzins, Microalgal triacylglycerols as feedstocks for biofuel production: perspectives and advances, Plant J 54 (2008) 621–639, http://dx.doi.org/10.1111/j.1365-313X.2008 03492.x [20] S Kathiresan, A Chandrashekar, G.A Ravishankar, R Sarada, Agrobacterium-mediated transformation in the green alga Haematococcus pluvialis (Chlorophyceae, Volvocales), J Phycol 45 (2009) 642–649 [21] M Lapidot, D Raveh, A Sivan, S.M Arad, M Shapira, Stable chloroplast transformation of the unicellular red alga Porphyridium species, Plant Physiol 129 (2002) 7–12, http://dx.doi.org/10.1104/pp 011023 [22] S Leu, S Boussiba, Advances in the production of high value products by microalgae, Ind Biotechnol 10 (2014) 169–183 [23] J Liu, Y Zhong, Z Sun, J Huang, Y Jiang, G Sandmann, F Chen, One amino acid substitution in phytoene desaturase makes Chlorella zofingiensis resistant to norflurazon and enhances the biosynthesis of astaxanthin, Planta 232 (2010) 61–67 [24] R.T Lorenz, G.R Cysewski, Commercial potential for Haematococcus microalgae as a natural source of astaxanthin, Trends Biotechnol 18 (2000) 160–167 [25] V Lumbreras, R.D Stevens, S Purton, Efficient foreign gene expression in Chlamydomonas reinhardtii mediated by an endogenous intron, Plant J 14 (1998) 441–447 [26] T Lundquist, I Woertz, N Quinn, J Benemann, A realistic technology and engineering assessment of algae biofuel production, Energy Biosciences Institute University of California, Berkeley, CA, 2010 [27] S.P Mayfield, S.E Franklin, R.A Lerner, Expression and assembly of a fully active antibody in algae, Proc Natl Acad Sci U S A 100 (2003) 438–442, http://dx.doi.org/ 10.1073/pnas.0237108100 [28] E Peled, S Leu, A Zarka, M Weiss, U Pick, I Khozin-Goldberg, S Boussiba, Isolation of a novel oil globule protein from the green alga Haematococcus pluvialis (Chlorophyceae), Lipids 46 (2011) 851–861, http://dx.doi.org/10.1007/s11745011-3579-4 [29] N Poulsen, P.M Chesley, N Kröger, Molecular genetic manipulation of the diatom Thalassiosira pseudonana (Bacillariophyceae), J Phycol 42 (2006) 1059–1065, http://dx.doi.org/10.1111/j.1529-8817.2006.00269.x [30] I Priyadarshani, B Rath, Commercial and industrial applications of micro algae — a review, J Algal Biomass Util (2012) 89–100 [31] O Pulz, W Gross, Valuable products from biotechnology of microalgae, Appl Microbiol Biotechnol 65 (2004) 635–648, http://dx.doi.org/10.1007/s00253-0041647-x [32] J.M Rochaix, M Mayfield, M Goldschmidt-Clermont, J Erickson, Molecular biology of Chlamydomonas, in: C.H Shaw (Ed.), Plant Molecular Biology, A Practical Approach, Oxford University Press, UK 1988, pp 253–275 [33] L Rodolfi, G.C Zittelli, N Bassi, G Padovani, N Biondi, G Bonini, M.R Tredici, Microalgae for oil: strain selection, induction of lipid synthesis and outdoor mass cultivation in a low-cost photobioreactor, Biotechnol Bioeng 102 (2009) 100–112 [34] B Schoefs, N Rmiki, J Rachadi, Y Lemoine, Astaxanthin accumulation in Haematococcus requires a cytochrome P450 hydroxylase and an active synthesis of fatty acids, FEBS Lett 500 (2001) 125–128 [35] S.A Scott, M.P Davey, J.S Dennis, I Horst, C.J Howe, D.J Lea-Smith, A.G Smith, Biodiesel from algae: challenges and prospects, Curr Opin Biotechnol 21 (2010) 277–286, http://dx.doi.org/10.1016/j.copbio.2010.03.005 [36] J Sheehan, T Dunahay, J Benemann, P Roessler, Look back at the U.S department of energy’'s aquatic species program: biodiesel from algae; close-out report Midwest Research Institute, Golden, Colorado, 1998.http://dx.doi.org/10.2172/15003040 [37] J Steinbrenner, G Sandmann, Transformation of the green alga Haematococcus pluvialis with a phytoene desaturase for accelerated astaxanthin biosynthesis, Appl Environ Microbiol 72 (2006) 7477–7484 [38] E.M Trentacoste, R.P Shrestha, S.R Smith, C Glé, A.C Hartmann, M Hildebrand, Metabolic engineering of lipid catabolism increases microalgal lipid accumulation without compromising growth, Proc Natl Acad Sci U S A 110 (2013) 19748–19753, http://dx.doi.org/10.1073/pnas.1309299110/-/DCSupplemental www.pnas.org/cgi/doi/10.1073/pnas.1309299110 [39] G Van-Ooijen, K Knox, K Kis, F.Y Bouget, A.J Millar, Genomic transformation of the picoeukaryote Ostreococcus tauri, J Vis Exp 65 (2012) 1–5, http://dx.doi.org/10 3791/4074 [40] B Wang, A Zarka, A Trebst, S Boussiba, Astaxanthin accumulation in Haematococcus pluvialis (Chlorophyceae) as an active photoprotective process under high irradiance, J Phycol 39 (2003) 1116–1124 [41] R.H Wijffels, M.J Barbosa, An outlook on microalgal biofuels, Science 329 (2010) 796–799, http://dx.doi.org/10.1126/science.1189003 [42] M Zhekisheva, S Boussiba, I Khozin-Goldberg, A Zarka, Z Cohen, Accumulation of oleic acid in Haematococcus pluvialis (Chlorophyceae) under nitrogen starvation or high light is correlated with that of astaxanthin esters, J Phycol 38 (2002) 325–331 [43] M Zhekisheva, A Zarka, I Khozin-Goldberg, Z Cohen, S Boussiba, Inhibition of astaxanthin synthesis under high irradiance does not abolish triacylglycerol accumulation in the green alga Haematococcus pluvialis (Chlorophyceae), J Phycol 41 (2005) 819–826, http://dx.doi.org/10.1111/j.1529-8817.2005.00101.x