Tóm tắt TA: Nghiên cứu PCR đa mồi trong chẩn đoán sớm tác nhân gây bệnh và hướng dẫn điều trị trong viêm phổi bệnh viện.

Nghiên cứu PCR đa mồi trong chẩn đoán sớm tác nhân gây bệnh và hướng dẫn điều trị trong viêm phổi bệnh viện.Nghiên cứu PCR đa mồi trong chẩn đoán sớm tác nhân gây bệnh và hướng dẫn điều trị trong viêm phổi bệnh viện.Nghiên cứu PCR đa mồi trong chẩn đoán sớm tác nhân gây bệnh và hướng dẫn điều trị trong viêm phổi bệnh viện.Nghiên cứu PCR đa mồi trong chẩn đoán sớm tác nhân gây bệnh và hướng dẫn điều trị trong viêm phổi bệnh viện.Nghiên cứu PCR đa mồi trong chẩn đoán sớm tác nhân gây bệnh và hướng dẫn điều trị trong viêm phổi bệnh viện.Nghiên cứu PCR đa mồi trong chẩn đoán sớm tác nhân gây bệnh và hướng dẫn điều trị trong viêm phổi bệnh viện.Nghiên cứu PCR đa mồi trong chẩn đoán sớm tác nhân gây bệnh và hướng dẫn điều trị trong viêm phổi bệnh viện.Nghiên cứu PCR đa mồi trong chẩn đoán sớm tác nhân gây bệnh và hướng dẫn điều trị trong viêm phổi bệnh viện.Nghiên cứu PCR đa mồi trong chẩn đoán sớm tác nhân gây bệnh và hướng dẫn điều trị trong viêm phổi bệnh viện.Nghiên cứu PCR đa mồi trong chẩn đoán sớm tác nhân gây bệnh và hướng dẫn điều trị trong viêm phổi bệnh viện.Nghiên cứu PCR đa mồi trong chẩn đoán sớm tác nhân gây bệnh và hướng dẫn điều trị trong viêm phổi bệnh viện.Nghiên cứu PCR đa mồi trong chẩn đoán sớm tác nhân gây bệnh và hướng dẫn điều trị trong viêm phổi bệnh viện.Nghiên cứu PCR đa mồi trong chẩn đoán sớm tác nhân gây bệnh và hướng dẫn điều trị trong viêm phổi bệnh viện.Nghiên cứu PCR đa mồi trong chẩn đoán sớm tác nhân gây bệnh và hướng dẫn điều trị trong viêm phổi bệnh viện.Nghiên cứu PCR đa mồi trong chẩn đoán sớm tác nhân gây bệnh và hướng dẫn điều trị trong viêm phổi bệnh viện.Nghiên cứu PCR đa mồi trong chẩn đoán sớm tác nhân gây bệnh và hướng dẫn điều trị trong viêm phổi bệnh viện.Nghiên cứu PCR đa mồi trong chẩn đoán sớm tác nhân gây bệnh và hướng dẫn điều trị trong viêm phổi bệnh viện.Nghiên cứu PCR đa mồi trong chẩn đoán sớm tác nhân gây bệnh và hướng dẫn điều trị trong viêm phổi bệnh viện.Nghiên cứu PCR đa mồi trong chẩn đoán sớm tác nhân gây bệnh và hướng dẫn điều trị trong viêm phổi bệnh viện.Nghiên cứu PCR đa mồi trong chẩn đoán sớm tác nhân gây bệnh và hướng dẫn điều trị trong viêm phổi bệnh viện.Nghiên cứu PCR đa mồi trong chẩn đoán sớm tác nhân gây bệnh và hướng dẫn điều trị trong viêm phổi bệnh viện.Nghiên cứu PCR đa mồi trong chẩn đoán sớm tác nhân gây bệnh và hướng dẫn điều trị trong viêm phổi bệnh viện.MINISTRY OF EDUCATION AND TRAINING MINISTRY OF HEALTH HANOI MEDICAL UNIVERSITY DINH THI THU HUONG MULTIPLEX REAL TIME PCR ROLE IN EARLY DIAGNOSIS OF PATHOGENS AND TREATMENT GUIDANCE IN HOSPITAL ACQUIR.

MINISTRY OF EDUCATION AND TRAINING MINISTRY OF HEALTH HANOI MEDICAL UNIVERSITY DINH THI THU HUONG MULTIPLEX REAL-TIME PCR ROLE IN EARLY DIAGNOSIS OF PATHOGENS AND TREATMENT GUIDANCE IN HOSPITAL ACQUIRED PNEUMONIA Specialism: Emergency, Critical Care Medicine and Toxicology Code : 9720103 ABSTRACT OF THESIS Ha noi - 2023 THE DISSERTATION HAS BEEN ACCOMPLISHED AT: HANOI MEDICAL UNIVERSITY Supervisors: Assoc Prof Đỗ Ngọc Sơn, MD, PhD Prof Bùi Vũ Huy, MD, PhD Opponent 1: Opponent 2: Opponent 3: The dissertation is defended ỉnfront of the University Commity at: Hanoi Medical University Vào hồi: phút, ngày tháng năm 202 The dissertations are found at: - National Library of Vietnam - Library of Hanoi Medical University THE LIST OF WORKS HAS PUBLISHED AND RELATED TO THE THESIS Dinh Thi Thu Huong, Bui Vu Huy, Do Ngoc Son (2019) "Evaluation of factors related to mortality in patients with ventilator-associated pneumonia Vietnam Medical Journal September 2019, Volume 482: 124 – 130 Dinh Thi Thu Huong, Bui Vu Huy, Do Ngoc Son (2019) The ability to detect bacteria causing common ventilatorassociated pneumonia by routine culture and multiplex realtime PCR Vietnamese medical journal December 2019, Volume 485: 202 – 205 Dinh Thi Thu Huong, Bui Vu Huy, Do Ngoc Son (2019) Effective treatment of ventilator-associated pneumonia caused by common pathogenic bacteria detected by multiplex real-time PCR Medical Research Journal No 132, Volume 8, November 2020: 157 - 165 Dinh Thi Thu Huong, Bui Vu Huy, Do Ngoc Son (2023) Role of multiplex realtime PCR in monitoring and treating ventilator-associated pneumonia Vietnamese medical journal January 2023, Volume 522: 345-352 INTRODUCTION Background Mechanical ventilation is one of the indispensable techniques in emergency resuscitation Although there have been many advances in the use of preventive measures, equipment and means of care, and update antibiotic regimens, accquired hospital pneumonia (HAP), pneumonia associated ventilation (VAP) is still an important cause of increased mortality and complicates the treatment of comorbidities diseases Treatment of HAP, VAP, the use of antibiotics as soon as possible, especially if there is septic shock, to improve prognosis, shorten the time of mechanical ventilation is a necessity The selection of antibiotics for the treatment of HAP and VAP is an extremely difficult problem when in fact, there is an alarming increase in drug-resistant bacteria in the intensive care units Occupying a high percentage commonly found in ICU are bacteria Acinetobacter baumannii, Klebsiella pneumoniae, Pseudomonas aeruginosa, Escherichia coli, Staphylococcus aureus Therefore, our research will focus on detecting common bacterial causes of this HAP, VAP In fact, it is necessary to use multiplex real-time PCR technique for the rapid diagnosis 5common types of bacteria causing HAP, VAP helps to orient the use of early antibiotics, suitable for this micro-technique has the advantages of high sensitivity, no need for a live bacteria, short response time However, so far, not many studies have specifically evaluated the role of multiplex real-time PCR in the diagnosis and treatment of HAP, VAP Stemming from the actual clinical need, we carried out the study “Multiplex real-time PCR role in early diagnosis of pathogens and treatment guidance in hospital acquired pneumonia " Objectives of the study: (1) Studying the value of multiplex real-time PCR in diagnosing the causative agent of HAP, VAP (2) Analysis of the role of multiplex real-time PCR in the treatment of HAP, VAP The urgency of the topic Patients who need to be hospitalized and maintained on mechanical ventilation are mostly very serious patients with many underlying diseases that require mechanical ventilation to maintain life and recover However, the resuscitators know that mechanical ventilation faces the risk of HAP, VAP and must accept it without having the right to choose There have been too many studies on the methods of prevention of VAP, the new generation of equipment, drugs and antibiotics, although the morbidity and mortality rates due to VAP have decreased but are still high On the other hand, in the current situation of drugresistant bacteria, it is extremely necessary to orientate the right and appropriate antibiotic use to save lives and reduce the rate of bacterial resistance Thus, it is still necessary to search for a method with sufficient sensitivity, short response time, to help orient the use of antibiotics suitable for pathogenic bacteria to help reduce mortality and reduce the risk of drug-resistant bacteria And that is the method of molecular biology multiplex real-time PCR So far, in the world as well as in Vietnam, there are very few or in other words, there have not been many studies comparing the ability to detect bacteria causing VAP between multiplex real-time PCR and classic culture methods; evaluate the effectiveness of treatment when using multiplex realtime PCR results oriented to use antibiotics in the treatment of VAP Therefore, this study is necessary Summary of novel findings of the research This is the first study in Vietnam using multiplex real-time PCR to detect common pathogenic bacteria in VAP The study was carried out on a very large number of patients, randomly selected, so the results are reliable The study showed that the ability of multiplex real-time PCR to detect common pathogens of VAP was much higher than that of routine culture in sputum and bronchial fluid samples On the other hand, the time to return multiplex real-time PCR results is much shorter than culture The study gives the sensitivity, specificity, positive predictive value, negative predictive value of multiplex real-time PCR technique in the diagnosis of HAP, VAP If the results of multiplex realtime PCR technique are applied, it will reduce the rate of inappropriate antibiotic use and reduce the risk of exposure to antibiotic resistance; reduce the time of mechanical ventilation, the length of stay in the intensive care unit (ICU), the hospital stay, which helps to reduce the cost of treatment, reduce the economic burden for each family and society Although it did not reduce the mortality rate from pneumonia when compared with the control group, the study also showed that the application of multiplex real-time PCR technique to patients will help reduce a patient's death due to VAP Dissertation structure The study consists of 130 pages, including: Introduction (2 pages), Chapter 1: Background (37 pages), Chapter 2: Patients and methods (28 pages), Chapter 3: Results (28 pages) Chapters Discussion (32 pages) Conclusion (2 pages) References (20 pages) There are 40 tables, charts, diagrams and 145 references (9 in Vietnamese; 136 in English) Chapter BACKGROUND 1.1 Background of hospital-acquired pneumonia, ventilator-associated pneumonia 1.1.1 Incidence of hospital-acquired pneumonia, ventilator-associated pneumonia: Nosocomial pneumonia (HAP) in 2014 ranked second among the most common nosocomial infections in the US, only after urinary tract infections On the other hand, the study also showed that VAP occurs in 150,000-200,000 patients/year, 5-10 patients for every 1000 hospitalized patients VAP accounts for 25% of hospital infections, with intubation accounting for 9-27% VAP not related to mechanical ventilation is 3.63/1000 days of treatment According to the Centers for Disease Control and Prevention (CDC) in 2012, the incidence of VAP in the United States ranged from 0.0 to 4.4/1000 days of mechanical ventilation 1.1.2 Bacterial causes of hospital-acquired pneumonia, ventilator-associated pneumonia: The type of bacteria causing VAP and VAP often depends on the length of hospital stay and the duration of mechanical ventilation Early VAP (< days) The causative organism is usually antibiotic sensitive Late-onset VAP (≥ days) is usually due to multidrug-resistant bacteria and will be more difficult to treat The culprits causing HAP, late VAP include: Staphylococcus aureus resistant to Methicillin, Acinetobacter baumannii, Pseudomonas aeruginosa, and bacteria from the broad-spectrum ESBL-producing beta-lactamase-resistant enterobacteriaceae family, including Klebsiella pneumoniae and Eschericheria coli, are emerging Therefore, within the framework of research and economic conditions, we only focus on detecting these common pathogenic bacteria VAP can be caused by many types of bacteria, however, VAP caused by fungi and viruses has a very low rate, especially in people with normal immune systems 1.1.3 Mortality rate from hospital-acquired pneumonia, ventilator-associated pneumonia: The worst outcome was deaths from HAP, VAP, which increased steadily every year for low-income countries, with no decrease or slow decline during this decade in high-income countries According to the CDC (2012), the mortality rate for patients with acute lung injury on mechanical ventilation ranges from 24% in 15-19 years old to 60% in patients 85 years and older In Turkey (2017) in patients with VAP, the overall mortality rate was 39.8% Univariate analysis as well as multivariable regression analysis showed that factors such as length of stay in ICU, A.baumannii infection were identified as predictors of increased mortality In a study in China (2020), the 30-day mortality rate was 42.7% Factors associated with 30-day mortality from VAP are due to multi-resistant bacterial infections In the ICU department of Bach Mai Hospital, patients with VAP were identified, from 11/2015 to 5/2016, the mortality rate at day was 13% and at day 31 was 43.1% Patients infected with multidrug-resistant A.baumannii had a 31-day mortality rate for uninfected patients, 56.2% and 25%, respectively, with p=0.041, and also prolonged the duration of stay by 16 days and days with p= 0.024 1.2 Background of multiplex real-time PCR research to diagnose hospitalacquired pneumonia, ventilator-associated pneumonia 1.2.1 Background of multiplex real-time PCR This is a molecular biology technique The technical principle is based on the principle of DNA synthesis in cells, in which DNA is multiplied by a semiconservative mechanism To initiate DNA synthesis, two strands of DNA as a template are separated under the influence of heat Two oligonucleotide primers of 20-40 nucleotides will attach to complementary sites on the template DNA fragment Under PCR conditions, the two primers will be elongated to either side, creating a new DNA fragment that is complementary to the template fragment The amplification process occurs under the catalysis of the enzyme Taq polymerase, with a pair of primers specific to a certain DNA fragment that will be synthesized after each cycle of PCR Fluorescence can be added to the reaction mixture to fluoresce at any point in time of the reaction, the fluorescence intensity will help detect the initial sample DNA concentration (real-time PCR), as well as using multiple primer pairs in the same reaction helps to detect many types of bacteria (multiplex real-time PCR) The detection of bacteria in the respiratory tract does not mean that they are the culprit, they may also exist as resident bacteria Therefore, to be able to confirm the cause of the disease, it is necessary to quantify the number of etiological species present in the respiratory tract, thereby combining with clinical practice to be able to make an appropriate diagnosis Multiplex real-time PCR samples of DNA in bronchial swab samples of target bacteria can help to draw conclusions about pathogenic bacteria 1.2.2 Research situation of multiplex real-time PCR in HAP, VAP In 2016, Clavel (France) published a study comparing multiplex real-time PCR and culture in patients with suspected VAP Samples of bronchoalveolar lavage fluid (BAL) and endotracheal aspirate (ETA) were performed simultaneously with multiplex real-time PCR and routine bacterial culture Detection target is types of bacteria: Staphylococcus aureus, Pseudomonas aeruginosa and Haemophilus influenzae Consistent results for both BAL and ETA in routine culture and multiplex real-time PCR were 55.5% and 57.0% of all target bacteria, respectively Particularly for Staphylococcus aureus, the possibility of suitable results for culture is better than multiplex real-time PCR, 77.8% and 69.0% respectively Another study was conducted from May 2017 to November 2018 in France In which, multiplex real-time PCR detected 21 bacteria and 19 antibiotic resistance genes on BAL or protected brush (PTC) samples The average time for multiplex real-time PCR results is 4.6 hours; 104 samples were detected by multiplex real-time PCR, only 128 samples were detected by routine culture Multiplex real-time PCR results changed antibiotics in 66% of patients: early and effective antibiotic use in 21%; de-escalation by 39%; 3% optimization Compared with conventional culture, multiplex real-time PCR has 80% sensitivity (95% CI, 71-88%) and 99% specificity (95% CI, 99-100%); multiplex real-time PCR detects Gram-negative bacteria better than Gram-positive A study in Greece (2017) in the pediatric ICU, using conventional sputum aspiration through endotracheal tubes for quantitative culture and identification of pathogenic bacteria when the quantitative result is 10+cfu/ml; The results of the study: multiplex realtime PCR sensitivity 76%, specificity 97%, PPV 90%, NPV 93% compared with culture respectively 24%, 92%, 55%, 79% The advantage of multiplex real-time PCR is that the time for results is short, thereby reducing the need for inappropriate antibiotic prescribing And although the cost of multiplex real-time PCR is still high, but compared with the inappropriate use of antibiotics, prolonged treatment time and dependence on mechanical ventilation, multiplex real-time PCR still brings many advantages Chapter PATIENTS AND METHODS 2.1 Patients and study site 2.1.1 Patients: 2.1.1.1 Inclusion criteria: - Patients 18 years of age who were hospitalized and/or intubated or tracheostomy for 48 hours - Patients were diagnosed with HAP, VAP according to US CDC 2018 criteria 2.1.2 Exclusion criteria - Patients died within 48 hours after admission or after intubation and/or did not consent to participate in the study 2.1.1.3 Criteria for diagnosis of HAP, VAP of CDC 2018: Criteria for diagnosis of HAP: Patients were hospitalized for 48 hours and has the following signs: * Clinical: Have at least one of the following symptoms:  Fever (>38oC) with no other cause  Leukopenia ( weeks 2.1.2 Location: Bach Mai Hospital's Emergency Department, Thanh Nhan Hospital's ICU 2.1.3 Time of study: From August 2018 to February 2021 2.2 Study methods: 2.2.1 Study design: Interventional, prospective, comparative control study 2.2.2 Size: Apply the formula to calculate the size for the two proportions: In there:  n is number of patients in each study group  Zα/2 is the Z-value of the standard distribution for probability α/2 (α = 0.05 then Zα/2 = 1.96); Zβ is the Z value of the standard distribution for the probability β (β = 0.02, then Zβ = 0.842)  p2 is the death rate due to VAP that has been studied According to domestic and foreign studies up to now, we estimate this ratio to be p2 = 0.35  p1 is the death rate due to VAP in the desired study group We expect to reduce the mortality rate in this group of patients after the intervention by 17% (p1 = 0.18)  ∆ difference of p2 and p1 From that, the size for each group was calculated as n ≈ 105 patients Patients were randomly divided into groups: o Study group: was performed multiplex real-time PCR for bacteria on sputum and/or tracheobronchial fluid: Acinetobacter baumannii, Klebsiella pneumoniae, Pseudomonas aeruginosa, Escherichia coli, Staphylococcus aureus o Control group: did not perform multiplex real-time PCR technique 2.3 Multiplex real-time PCR technique in the study 2.3.1 Materials: + Specimens: sputum, bronchial fluid, bronchoalveolar lavage fluid are stored cold and transported immediately to the laboratory Table 2.1 Primer sequence Target E coli K pneumoniae P aeruginosa A baumannii Staphylococci S aureus Kháng methicillin Name yccT-F yccT-R yccR-P gltA-F gltA-R gltA-P gyrB-F gyrB-R gyrB-P blaOXA-51 F primer blaOXA-51 R primer blaOXA-51 Probe tufSA-F tufSA-R tufSA-P nuc-F nuc-R nuc-P mecA-F mecA-R mecA-P Sequence (5'->3') ATCGTGACCACCTTGATT TACCAGAAGATCGACATC CATTATGTTTGCCGGTATCCGTTT AGGCCGAATATGACGAAT GGTGATCTGCTCATGAA ACTACCGTCACCCGCCACA CCTGACCATCCGTCGCCACAAC CGCAGCAGGATGCCGACGCC CCGTGGTGGTAGACCTGTTCCCAGACC Length 18 18 24 18 17 19 22 20 27 Tm 53.37 50.30 56 53.34 50.68 61.4 65.88 69.08 65.5 GC% 44.44 44.44 41.7 44.44 47.06 63.2 63.64 75.00 63.00 GAAGTGAAGCGTGTTGGTTATG 22 55.0 45.00 GCCTCTTGCTGAGGAGTAAT 20 55.0 50.00 GCCTCTTGCTGAGGAGTAAT 20 54.3 50 AAACAACTGTTACTGGTGTAGAAATG AGTACGGAAATAGAATTGTG TCCGTAAATTATTAGACTACGCTGAAGC CATCCTAAAAAAGGTGTAGAGA TTCAATTTTMTTTGCATTTTCTACCA TTTTCGTAAATGCACTTGCTTCAGGACCA GGCAATATTAMCGCACCTCA GTCTGCCASTTTCTCCTTGT AGATCTTATGCAAACTTAATTGGCAAATCC 26 20 28 22 26 29 20 20 30 53.8 47.3 56.5 49.7 51.6 60.7 54.1 54.9 56.5 34.6 35 39.3 36.4 25 41.4 47.5 50 33.3 + Bacterial samples: Table 2.2 List of bacteria used Sample type Sample source Standard bacteria strain Nation Institute of Hygiene A baumannii ATCC@19606 and Epidemiology P aeruginosa Bacteria solution Thanh Nhan hospital K pneumoniae Bacteria solution Thanh Nhan hospital E coli Bacteria solution Thanh Nhan hospital S.aureus Bacteria solution Thanh Nhan hospital + Amplicons: Synthesized by Integrated DNA Technologies Amplicon was diluted to lower concentrations by dilution order of 10 using 1X TE Name 10 (Plate setup), select the specific detection fluorescence color for each agent according to table 2.4 Declare the sample format for the positive control wells as Standard, declare the positive control DNA concentration on the machine when used for each target agent in turn according to E2-102, E3-103, E5-105, E7-107 Set up a thermal cycle as shown in table 2.5 2.3.3.Results and arguments: * Qualitative multiplex PCR real-time PCR reaction results and arguments Check the fluorescence signal curve of the samples in the following order: - The fluorescence signal of the PCR-positive control is above the threshold in all color channels The fluorescence signal of the extracted negative control and the PCR negative control is below threshold in all color channels - Read the results in the test sample according to the principle: turn on the signal to read the object corresponding to that signal (according to tables 2.6 and table 2.7) The result of the sample is the composite result from both reaction mixtures and Table 2.6 Analyze the results in the reaction mixture Mixture Cy5 HEX (K.pneumoniae) (IC) Type FAM (A.baumannii) ROX (E.coli) Type - - - - False negative, repeat the reaction from the extraction step Type - - - + Below detection threshold for all bacteria A.baumannii, E.coli, K.pneumoniae Type + - - +/- Positive with A.baumannii Real-time quantitative PCR with A.baumannii Type - + - +/- Positive with E.coli Real-time quantitative PCR with E.coli Type - - + +/- Type + + - +/- Type + - + +/- Type - + + +/- Type + + + +/- Conclusion Positive with K.pneumoniae Real-time quantitative PCR with K.pneumoniae Co-positive A.baumannii, E.coli Quantitative Real-time PCR with both bacteria A.baumannii, E.coli Co-positive A.baumannii, K.pneumoniae Quantitative Real-time PCR with both A.baumannii, K.pneumoniae Co-positive E.coli, K.pneumoniae Quantitative Real-time PCR with both E.coli, K.pneumoniae Co-positive for all agents A.baumannii, E.coli, K.pneumoniae Quantitative real-time PCR with all agents A.baumannii, E.coli, K.pneumoniae Type Type Type 11 Table 2.7 Analyze the results in the reaction mixture Mixture FAM ROX HEX Conclusion (P.aeruginosa) (S.aureus) (IC) False negative, repeat the reaction from the extraction step - - + Below the detection threshold of P.aeruginosa, S.aureus Positive for P.aeruginosa Real-time quantitative PCR with P.aeruginosa Positive for S.aureus Type + +/Real-time quantitative PCR with S.aureus Co-positive P.aeruginosa, S.aureus Perform quantitative real-time PCR Type + + +/reaction with both agents P.aeruginosa, S.aureus The DNA concentration of each target bacterium in each positive reaction mixture was calculated based on a standard curve constructed from known Standard positive control DNA concentrations and displayed on the processing software of the real-time machine used - Evaluation of the results of the study: The result is positive when the amount is ≥ 103 DNA/ml of bronchoalveolar lavage fluid; ≥ 104 DNA/ml sputum/fluid aspirated through endotracheal intubation/tracheostomy 2.4 Conduct research: 2.4.1 Research process:  Patients after hospitalization and/or intubation, mechanical ventilation ≥ 48 hours suspected of HAP, VAP will be: - Clinical examination found: Cough, fever, shortness of breath, purulent sputum or increased sputum volume, auscultation of the lungs may be seen with moist rales, tube murmurs - Perform tests: peripheral blood cells, liver and kidney function, arterial blood gases, chest X-ray, chest CT scan if necessary  Patients who meet the criteria and agree to participate in the study will be included in the study: * Study group: perform multiplex real-time PCR times - First time: after the clinical diagnosis of HAP, VAP Patients will be taken samples (sputum, endotracheal/bronchoalveolar aspirate or bronchoalveolar fluid) performed simultaneously: + Bacterial culture and routine antibiogram + And multiplex real-time PCR identified types of bacteria: A.baumannii, K.pneumonia, P.aeruginosa, E.coli, S.aureus Type + - +/- 12 When multiplex real-time PCR results (3-7 hours) are clinically relevant, patients will be treated according to the study's applicable regimen based on multiplex real-time PCR results (Table 2.8)  When there are results of culture and antibiogram (2-4 days): o Keep the current antibiotic regimen (if the results of VK culture and antibiogram are consistent with the results of multiplex real-time PCR being applied treatment) o Adjust antibiotic regimen according to the results of bacterial culture and antibiogram (if the treatment regimen according to multiplex real-time PCR results is not suitable for the patient) - Second time: days after the first time (for patients who are still being treated in the ICU, have not been able to remove the ventilator, have not removed the trachea)  The patient will be sent for the second time and perform at the same time: + Bacterial culture and routine antibiogram + And multiplex real-time PCR identified bacteria: A baumannii, K.pneumonia, P.aeruginosa, E.coli, S.aureus  The patient continued to adjust the regimen when having multiplex realtime PCR results, bacterial culture results and antibiogram as the first time until the ventilator was removed, intubated, transferred, discharged or died * Control group:  Patients will be taken samples (sputum, endotracheal aspirate/ bronchoalveolar lavage fluid or bronchoalveolar lavage) to perform bacterial culture and make routine antibiotics  Patients receiving empiric antibiotic therapy until culture results (2-4 days) are adjusted for these results  The patient will also be cultured (sputum or bronchial fluid) if necessary and monitored until the ventilator is removed, intubated, transferred, discharged or died  Patients will be collected data according to a unified medical record form, analyzed and processed by medical statistical software 2.4.2 Treatment protocols for HAP, VAP applied in the study When clinical and/or multiplex real-time PCR results suspect and/or confirm the diagnosis of HAP, VAP: - Antibiotic must be prescribed earliest (within the first hour if accompanied by septic shock) Antibiotic according to experience or according to table 2.8 protocol (when multiplex real-time PCR results or culture and antibiogram) - In addition, it is necessary to ensure comprehensive basic treatment in resuscitation: + Treatment of septic shock, ensuring blood oxygenation in acute respiratory distress syndrome (ARDS) according to the protocol + Dialysis is indicated to remove cytokines, metabolic acidosis, multi-organ failure + Coordinating treatment of underlying diseases + Water and electrolyte balance, alkaline-acid balance  13 + Caring for mechanically ventilated patients, prevention of thromboembolic complications + Ensure nutrition, prevent pressure ulcers, prevent stomach ulcers Table 2.8 Antibiotic selection is based on multiplex real-time PCR results Bacterial Early pneumonia, stable clinically status, no risk of multidrug resistant bacteria Acinetobacter baumannii Meropenem: 1g/8h IV or Doripenem 0.5g/6h-8h IV And/or Amikacin 15mg-20mg/kg/24h IV infusion once Klebsiella pneumonia Meropenem: 1g/8h IV infusion And Amikacin 15mg-20mg/kg/24h IV infusion once or Gentamycin 57mg/kg/24h IV infusion once or Tobramycin 5-7mg/kg/24h IV infusion once Eschecheria coli Ceftazidime/ or Cefepim: 2g/8h IV or Piperacillin/tazobactam 4.5g/6h IV And Ciprofloxacin 400mg/8h/ or Amikacin 15-20mg/kg/24h IV infusion time Pseudomonas aeruginosa Piperacillin/tazobactam 4.5g/6h-8h IV or Ceftazidime or Cefepim: 2g/8h IV And Amikacin 15-20mg/kg/24h IV infusion once or Levofloxacin 750mg- 1000mg/24h IV infusion Staphylococus aureus Piperacillin/tazobactam 4.5g/6h-8h IV or cefepime: 2g/8h IV And/or Levofloxacin 750mg/24h IV Late pneumonia, septic shock, ARDS, risk of multidrug resistant bacteria Meropenem: 2g/8h or Doripenem 1g/8h IV infusion lasting 3h And Colistin loading dose 5mg/kg x time; maintenance dose 2.5mg x (1.5 x creatinine clearance x 30)/12h IV infusion lasting 3h And/or Ampicillin/sulbactam: 3g/6h-8h IV over 3h And/or Amikacin 15-20mg/kg/24h IV infusion once Meropenem: 2g/8h Doripenem 1g/8h IV infusion lasting 3h) And Colistin loading dose 5mg/kg x time; maintenance dose 2.5mg x (1.5 x creatinine clearance x 30)/12h IV infusion lasting 3h or Ertapenem 1g/24h IV infusion 30 minutes And/or Amikacin 15-20mg/kg/24h IV infusion time And/or Fosfomycin 6-8g/8h IV infusion lasting 2h Eschecheria coli Ceftazidime/ or Cefepim: 2g/8h IV Imipenem: 500mg/6h or 1g/8h IV or Meropenem 1-2g/8h IV lasting 3h Or Piperacillin/tazobactam 4.5g/6h IV And Ciprofloxacin 400mg/8h or Amikacin 1520mg/kg/24h IV infusion once Or Colistin loading dose 5mg/kg x time; maintenance dose 2.5mg x (1.5 x creatinine clearance x 30)/12h IV infusion lasting 3h Imipenem: 500mg/6h or 1g/8h IV or Meropenem 1-2g/8h IV lasting 3h And Colistin loading dose 5mg/kg x time; maintenance dose 2.5mg x (1.5 x creatinine clearance x 30)/12h IV infusion lasting 3h Or Amikacin 15-20mg/kg/24h IV infusion Or Ciprofloxacin 400mg/8h Or Levofloxacin 750mg- 1000mg/24h IV Vancomycin: loading dose 25–30 mg/kg, maintenance 15mg/kg/12h IV infusion lasting 12 hours; Or Teicoplanin: loading dose 12mg/kg/12h x times, maintenance 6–12mg/kg/24h IV infusion once; Or Linezolid: 600mg/12h IV infusion 2.5 The evaluation criteria of the study: 2.5.1 Objective 1: To study the value of multiplex real-time PCR in the diagnosis of HAP, VAP 14 - Compare the ability to detect common bacteria causing HAP, VAP between routine culture and multiplex real-time PCR - Comparison of results return time between multiplex real-time PCR and routine culture - Consensus comparison between multiplex real-time PCR results and positive cultures - Diagnostic value of multiplex real-time PCR: sensitivity, specificity, positive predictive value, negative predictive value, positive likelihood index, negative likelihood index, Kappa index 2.5.2 Objective 2: Analyze the role of multiplex real-time PCR to monitor treatment of HAP, VAP - Compare of appropriate antibiotic using between the two groups - Compare the duration of mechanical ventilation, the length of stay in the ICU and the length of hospital stay - Compare the overall mortality rate, the mortality rate due to VAP - Evaluate the effectiveness of treatment by indicators of relative risk reduction RRR, absolute risk reduction ARR, number of patients needing to use multiplex real-time PCR technique (NNT) to reduce one patient's death due to VAP 2.6 Standards and definitions: - Ventilator dependence: the patients cannot be removed from the ventilator - Inappropriate antibiotic treatment (the use of antibiotics to which the causative organism was resistant) or appropriate antibiotic therapy (the use of antibiotics sensitive to pathogenic bacteria cultures’ results) - Mortality: includes all died at the hospital and seriously ills to die at home - Overall mortality: all deaths occurred during treatment - Mortality rate caused by pneumonia: death due the acute respiratory distress syndrome, septic shock 2.7 Ethical issues: Ethics in the research was approved by the Ethical Council of Hanoi Medical University No.187 on February 20th, 2016 Chapter RESULTS From October 2018 to February 2021, there were 242 patients eligible to enroll in the study and divided equally into two groups 3.1 General characteristics of studied patients 3.1.1 General characteristics at hospital admission The average age of the studied patients was 67.94 ± 16.59, the percentage of men was 71.1% and the average body mass index (BMI) was 20.58 ± 3.39 The main reason for intubation accounted for the highest rate: respiratory failure (42.4%) coma (32.2%) Only 2.1% had HAP The most common comorbidities were cardiovascular disease, followed by cerebrovascular diseases, diabetes, and chronic obstructive pulmonary 15 3.1.2 Some clinical and subclinical characteristics at the time of diagnosis of HAP, VAP Table 3.1 Clinical features Two groups Study group Control group p Characteristics (n = 242) (n= 121) * (n= 121) ** (*-**) n (%) n (%) n (%) 0,05 characteristics Purulent (1,7%) (0,0%) (3,3%) Unclear 15 (6,2%) (6,6%) (5,8%) ≥ 380 43 (17,8%) 21 (17,4%) 22 (18,2%) 0,866 Temperature (O C) < 360 0 Late VAP 126 (52,1%) 64 (52,9%) 62 (51,2%) 0,797 Septic shock 75 (31,0%) 31 (25,6%) 44 (36,4%) 0,071 Comments: There was no difference in Glasgow score, increased bronchial secretions, temperature, late VAP and septic shock between the two groups Table 3.2 Characteristics of blood tests Two groups Study group Control group p Characteritics (n = 242) (n= 121) * (n= 121) ** (*-**) n (%) n (%) n (%) Mean ± SD 15,26 ± 7,27 16,03 ± 8,04 14,49 ± 6,38 0,204 White blood cell 12 88 (36,4) 47 (65,3) 41 (56,9) Polymorphonuclear /monocyte 21,86 ± 23,49 ± 33,09 25,08 ± 33,59 0,458 leukocyte ratio (Mean ± SD) 32,62 Ure (mmol/l) 12,33 ± 8,61 11,23 ± 6,57 13,48 ± 10,22 0,053 (Mean ± SD) Albumin (g/l) (Mean ± SD) 26,68 ± 4,67 25,38 ± 4,45 28,11 ± 4,49 10 29 (12,0) 16 (28,6) 13 (22,4) Lactat (mmol/ml) 2,2- 41 (22,2) 17 (18,9) 24 (25,3) 0,351 Comments: The average white blood cell count was high in both groups, the blood procancitonil concentration, the blood lactate concentration did not differ between the two groups Particularly, the blood albumin concentration and blood urea/albumin ratio were different between the two groups with p < 0.05 16 Table 3.3 Arterial blood gas characteristics Index ≤ 7,15 < 7,20 < 7,35 ≤ 240 < 200 < 100 pH PaO2/FiO2 PO2 < 60mmHg Mean ± SD ≥ 50 > 100 A-aDO2 (mmHg) Two groups (n = 242) n (%) (2,5) 40 (16,5) 45 (22,8) 85 (45,0) 56 (29,6) (4,2) 13 (7,0) 157,17 ± 103,21 Study group (n= 121) * n (%) (3,2) 12 (9,9) 15 (16,0) 40 (42,6) 24 (25,5) (3,2) (8,2) 151,04 ± 95,20 162 (91,0) 131 (73,6) 84 (94,4) 63 (70,8) Control group (n= 121) ** n (%) (1,9) 28 (23,1) 30 (29,1) 45 (47,4) 32 (33,7) (5,3) (5,7) 163,30 ± 110,85 78 (87,6%) 68 (76,4) p (*-**) > 0,05 0,506 0,220 0,508 0,430 0,116 0,395 Comments: Arterial blood gas at the time of diagnosis of pneumonia between the two groups was not statistically significant p>0.05 Table 3.4 Results of the chest X-ray/CT Result Injured on chest X-ray Infiltrate Cave Injured on chest CT Combination Unclear Upper lobe right Middle lobe right Lower lobe right Right lung Injured sites Upper lobe left Lower lobe left Left lung both lungs Two groups (n = 242) n (%) 114 (47,1) 115 (47,5) (0,8) 115 (47,5) 127 (52,5) 42 (17,4) 28 (11,6) 65 (26,9) 87 (36,0) 40 (16,5) 58 (24,0) 77 (31,8) 63 (26,0) Study group (n= 121) * n (%) 52 (43,0) 70 (57,9) (0,8) 70 (57,9) 51 (42,1) 24 (19,8) 15 (12,4) 41 (33,9) 51 (42,1) 25 (20,7) 37 (30,6) 46 (38,0) 38 (31,4) Control group (n= 121) ** n (%) 62 (51,2) 45 (37,2) (0,8) 45 (37,2) 76 (62,8) 18 (14,9) 13 (10,7) 24 (19,8) 36 (29,8) 15 (12,4) 21 (17,4) 31 (25,6) 25 (20,7) p (*-**) 0,198 0,001 0,001 0,962 0,643 0,211 0,044 0,445 0,203 0,038 0,057 Comments: Mainly infiltrative and pulmonary lesions, almost no cavernous lesions The site of injury is common in both the right lung or the left lung Table 3.6 Results of microbial culture of respiratory tract Bacteria E coli K pneumoniae A baumannii P aeruginosa S aureus S marcressens Enterobacter cloacae Nấm candidas Others Two groups n= 242 Study group (*) n= 121 (2,9%) 42 (17,4%) 83 (34,3%) 29 (12,0%) (3,3%) (2,1%) (0,4%) 17 (7,0%) 13 (5,4%) (1,7%) 23 (19,0%) 41 (33,9%) 17 (14,0%) (4,1%) (0,8%) (0,0%) (5,8%) (5,0%) Control group (**) n= 121 (4,1%) 19 (15,7%) 42 (34,7%) 12 (9,9%) (2,5%) (3,3%) (0,8%) 10 (8,3%) (5,8%) p (*-**) 0,446 0,497 0,892 0,322 0,722 0,370 0,450 0,776 17 Comment: The highest rate causing pneumonia was still the group of bacteria, respectively A.baumannii, K.pneumoniae, P.aeruginosa, E.coli, S.aureus A small part is other bacteria, fungi 3.2 Multiplex real-time PCR value in diagnosis of HAP, VAP Table 3.7 Comparing the ability to detect bacterias between multiplex realtime PCR and culture Results Positive First n= 121 73 (60,3) Time for result (Mean ± SD)(Hour) Culture n (%) Second Both n= 28 n= 149 19 (67,9) 92 (61,7) Multiplex real-time PCR n (%) First Second Both n= 121 n= 28 n= 149 106 27 133 (89,3) (87,6) (92,9) 52,82 ± 11,70 8,20 ± 3,37 P