prins and in situ pcr protocols

1 Oligonucleotide PRINS DNA Synthesis John R. Gosden and Diane Lawson 1. Introduction The technique for labeling chromosomes by annealing an oligonucleotide DNA primer to the denatured DNA of chromosome preparations on glass slides and extending it enzymatically in situ with the incorporation of labeled nucleotides was fust described by Koch et al. in 1989 (I). Since then, the technique has been greatly improved in reliability, sensitivity, and resolution, and now provides a viable, rapid alternative to conventional fluorescence in situ hybridization (FISH) for many investigations, particularly the identification of chromosome aneuploidy in metastatic tissues and antenatal diagnosis and the analysis of the human chromosome complement of somatic hybrid cell lines (Zd). 2. Materials 2.1. Primed In Situ Syf7thesis 1. Twin-Frost glass slides and 22 x 40 mm coverslips: The slides must be cleaned by soaking in ethanol to which a few drops of HCl have been added, followed by polishing with a clean piece of muslin, before the cells are deposited on the slide. Coverslips must be cleaned in the same way before use. 2. PRINS buffer (10): 500 mM KCl, 100 mil4 Tris-HCl, pH 8.3, 15 mA4 MgC12, 0.1% BSA. 3. 2’-Deoxyadenosine 5’-triphosphate (dATP): 100-W solution (Pharmacia Biotech, St. Albans, UK), diluted 1: 10 with sterile distilled HzO. 4. 2’-Deoxycytidine 5’-triphosphate (dCTP): 1 00-mM solution (Pharmacia Biotech) diluted 1: 10 with sterile distilled H20. 5. 2’-Deoxyguanosine S-triphosphate (dGTP): 100~mM solution (Pharmacia Biotech) diluted 1: 10 with sterile distilled H20. 6. 2’-Deoxythymidine 5’-triphosphate (dTTP): lOO-mJ4 solution (Pharmacia Biotech) diluted 1: 100 with sterile distilled H,O. From. Methods fn Molecular Biology, Vol 71 PRINS and In Situ PCR Protocols Ed&d by. J. R Gosden Humana Press Inc., Totowa, NJ 2 Gosden and Lawson 7. Biotin-16-2’-deoxyuridine-5’-triphosphate (Bio- 16-dUTP) (Boehrmger Mannheim, Lewes, Sussex, UK). 8. Digoxigenin-1 I-deoxyuridine-5’-triphosphate (Dig-l l-dUTP) (Boehrmger Mannherm). 9. FluoroRed (Amersham International, plc, Buckinghamshire, England). 10. FluoroGreen (Amersham International). 11. FluoroBlue (Amersham International). 12. Ohgonucleotide primer(s) at 250 ng/pL (see Note 1) 13 Tuq DNA polymerase (Taq [Boehrmger], AmpliTaq [Cetus], or ThermoprimePrus [Advanced Biotechnologies Ltd., Leatherhead, England]). 14 Rubber cement (vulcanizing solutron) (e.g., Tip-Top, Stahlgruber, DS-8011 Poing, Germany) (see Note 2). 15. Stop buffer (500 mM NaCl, 50 n1J4 EDTA). 16. Flat-bed thermal cycler (see Note 3). 17. Water bath at 65°C 2.2. Detection 1 Dried skimmed milk powder. 2. Avrdin-DCS-fluorescein isothiocyanate (Av-FITC) (Vector Labs, Burlin- game, CA). 3. Avidin-DCS-Texas red (Av-TR) (Vector Labs). 4. Antrdigoxigenin-fluorescem (anti-DIG-FITC) (Boehrmger Mannhelm). 5. Antrdigoxigenm-rhodamine (anti-DIG-rhodamine) (Boehrmger Mannheim). 6. Propidium iodide (20 pg/mL) (Sigma). 7. 4’,6-Dtamidino-2-phenylmdole 2 HCl (DAPI) (100 pg/mL) (Sigma). 8. VectaShreld (Vector Labs). 9. 20X SSC: 3.OMNaC1, 0.3OMtn-sodmm citrate, pH 7.3. 10. Wash buffer: 4X SSC (diluted from stock 20X SSC), 0.05% Tnton X-100. 11. Blocking buffer: wash buffer with the addition of 5% skimmed mrlk powder. 12. Incubator or water bath at 37’C and water bath at 45°C. 13. Microscope equipped for eprfluorescence (e g., Zeiss Axioskop or Leitz Ortholux II with Pleomopak filter system) 3. Methods 3.1. Standard PRINS 1. You will need cells or chromosomes, prepared from peripheral blood lym- phocytes (71, cultured cells (8), or frozen sections (see Speel et al., Chapter 8) (see Note 5). 2. Oligonucleotide primers are prepared on an Applied Biosystems (Foster City, CA) Model 38 1A DNA synthesizer according to the manufacturer’s instructions. Recommendations for some successful chromosome-specific primers are given in Table 1 (but see Note 4). 3. The reaction mix is made up as follows: For each slide, put 1 pL of each of the diluted nucleotide triphosphates, plus 1 @L of the selected labeled dUTP (biotin, PRINS 3 Table 1 Examples of Chromosome-Specific Oligonucleotides and a Primer for All Human Centromeres F673 (20-mer) F60 (30mer) G33 (19-mer) 168 (17-mer) D16Z1, Satellite II D 172 1, alphoid D9Z 1, Satellite III CenP-B Box TTCTTTTCATACCGCATTCT ATTGCACTTCTTTGAGGAGTACCG TAGTAA AATCAACCCGAGTGCAATC CTTCGTTGGAAACGGGA digoxigenin, or a fluorochrome), 5 pL 10X PRINS buffer, and 1 pL of the appro- priate oligonucleotide pruner (see Note 6) mto a microcentrifuge tube, and add distilled water to 50 PI.,, 4. Mix thoroughly and add 1 U of your chosen DNA polymerase. Mix carefully and place 40 $ on a clean coverslip. 5. Pick the coverslip up with a slide (this spreads the reaction mix evenly, with the least risk of introducing air bubbles) and seal with rubber cement 6. Dry the seal (a cold air fan is quick and safe) and transfer the slides to the flat block of a thermal cycler. A suitable basic program for the Hybaid OmniGeneTM In Situ, or Hybaid OmniSlideTM is 93”C, 3 min; 60°C 5-10 min; 72”C, 15 min. 7. On completion of the program, remove the seal (it peels off easily by rubbing one comer) and transfer the slides for 1 min to a Coplin jar containing stop buffer at 65°C. Leave the coverslips in place, unless they come off readily with the seal; they will in any case fall off in the stop buffer. After 1 min, transfer the slides to a stain dish containing wash buffer. They may be held in this solution overnight if convenient (but see Note 7) 3.2. Detection It is important that the slides do not become dry at any time during this process. The following steps apply only to slides in which the PRINS reaction has been labeled with biotin or digoxigenin. Slides in which the reaction used a fluorochrome-dUTP as the label require no detection step, and are simply mounted (see step 6). 1. Prepare blocking buffer. The milk powder dissolves rapidly if the solution is warmed to 45“C for a few seconds. 2. Put 40 pL blockmg buffer on a clean coverslip, shake surplus wash buffer from the slide, and pick up the coverslip containing blocking buffer. Leave (unsealed) at room temperature for 5 min. 3. Dissolve reporter (avidin-fluorochrome or antidigoxigenin-fluorochrome) in block- ing buffer. For Av-FITC or Av-TR, 1:500 is a suitable dilution; anti-DIG FITC and anti-DIG rhodamine are better at 1: 100 dilution. Make sufficient buffer for a 40 &/slide. Spin in a microcentrifuge for 5 min. This precipitates any aggregates that may have formed during storage and can cause high and nonspecific background. 4 Go&en and Lawson 4. Remove the cover&p from the slide, shake surplus fluid off both the sltde and the coverslip, and add 40 pL of reporter solution to the same coverslip. Replace the slide and incubate in a moist chamber (e g., a sandwich box lmed with damp filter paper) at 37°C for 30 mm. 5. Warm a reagent bottle containing wash buffer to 45OC in a water bath. Remove covershps and wash slides 3 x 2 min in 50 mL wash buffer at 45°C. 6. After the final wash, shake off surplus fluid and mount slides in VectaShleld containing the appropriate counterstain: For slides labeled with rhodamine or Texas red, this should be DAPI (5 pg/lOO pL VectaShield, i e., 5 pL of DAPI stock/l00 pL VectaShleld); for slides labeled with FITC, this should be a propidium iodide/DAPI mixture (3.75 & of each stock/l00 pL VectaShield). Use 20-30 pL mountant/slide, blot surplus by covering slide and covershp with a tissue and pressing gently to expel excess mountant, and seal with rubber cement. Slides may be stored m the dark at 4°C for several months. If the stain shows signs of fading, simply peel off the sealant, soak the slide overnight in 4X SSC, 0.05% Triton X-100 (the covershp will fall off at this point), and remount as above Figure 1 shows some typlcal results. 7. Multiple sequential PRINS reactions may be performed on the same sample in order to quantify a number of chromosomes. For details of the method, see Chap- ter 6 and ref. 6 8. The technique may also be combined with FISH. After the stop buffer, the shdes are passed through an ethanol series (70, 90, 100%) and air-dried before per- forming a normal FISH procedure, omitting any denaturation of the chromo- somal DNA. Detection of the PRINS product and the hybridized FISH probe is then performed simultaneously (9) This provides a rapid method for identifying the chromosomal target located by the FISH. 4. Notes 1. Oligonucleotide pnmers can be synthesized on an ABI DNA synthesizer and used without further purification other than alcohol preclpltatlon and washing. If this facility is not available, they may be obtained from commercial sources, but purification steps, such as HPLC, are not needed and only increase the cost of the product. 2. The requirement for a suitable seal is that it should be reasonably robust, provide a vapor-tight seal, and be easily and completely removed at the end of the proce- dure. We have found that Tip-Top fulfills all these parameters and is readily available from bicycle repair shops. 3. Thermal cyclers with a flat bed for microscope slides are not yet widely avall- able. Some of the products sold for this purpose are not altogether suitable, since they are ad hoc modifications of machines designed for PCR in microtubes, with a plate added to the heated block. Thermal transfer and temperature control m such a system are rarely satisfactory The procedure can be carried out by transferrmg slides through a series of water baths at appropriate temperatures, but this too means that temperature control cannot be precise, and the temperature drop during the PRINS Fig. 1. (see color plate number 1 after p. 82) Examples of PRINS reactions with the primers shown in Table 1. All reactions were labeled with biotin-16-dUTP, and the label detected with avidin-FITC. Chromosomes were counterstained with a mixture of DAPI and propidium iodide. (A) Chromosome 16. (B) Chromosome 9. (C) Chromo- some 17. (D) CenP-B box primer (labels all centromeres). transfer from water bath to water bath leads to high backgrounds. The most suitable purpose-built products are the OmniGene In Situ and OmniSlide made by Hybaid (Teddington, Middlesex, UK), which hold 4 and 20 slides, respectively. 4. As an alternative, complete systems for chromosome identification by PRINS are becoming available (e.g., Advanced Biotechnologies, Leatherhead, England). 5. Cell suspensions may be stored in fix (methanol:acetic acid [3: 11) at -20°C for several months. Slides are prepared fresh each week by gently centrifuging the suspension to precipitate the cells, resuspending in fresh fix, repeating this pro- cess, and finally resuspending in sufficient fix to give a suitable density and put- ting one drop on a clean slide, which is allowed to dry at room temperature. The balance of the suspension may then be diluted suitably with fix and returned to -2O’C. Using slides more than l-2 wk old can be successful, but may lead to reduced sensitivity and greater variability. 6. The majority of chromosome-specific alphoid sequences produce adequate sig- nal with a single primer at a concentration of 250 ng/50 l.tL reaction. In some Go&en and Lawson cases, a clearer signal with less background may be produced with paired pnm- ers, at the same concentration, whereas in others, the concentration of primer may be reduced, with a concomitant reduction in crossreaction to related chro- mosomal sequences. 7. Slides that have been labeled directly with fluorochromes may still be held m this solution overnight if convenient, but should be kept in the dark to prevent bleach- ing and fading of the label. References 1. Koch, J E., Kolvraa, S., Petersen, K. B., Gregersen, N., and Bolund, I (1989) Oligonucleotide-priming methods for the chromosome-specific labelling of alpha satellite DNA in situ. Chromosoma 98,259-265 2. Gosden, J., Hanratty, D., Starling, J., Fantes, J , Mitchell, A., and Porteous, D. (199 1) Oligonucleotide primed in situ DNA synthesis (PRINS): a method for chro- mosome mapping, banding and investigation of sequence organization. Cytogenet CeEZ Genet. 57, 100-l 04. 3. Gosden, J. and Lawson, D. (1994) Rapid chromosome identification by ohgo- nucleotide primed in situ DNA synthesis (PRINS). Hum. A401 Genet. 3,93 l-946. 4 Gosden, J and Lawson, D. (1995) Instant PRINS: a rapid method for chromo- some identification by detecting repeated sequences in situ. Cytogenet Cell Genet. 68,57-60. 5. Hindkjaer, J., Koch, J., Terkelsen, C., Brandt, C. A., Kolvraa, S., and Bolund, L. (1994) Fast, sensitive multicolour detection of nucleic acids by primed in situ labelling (PRINS). Cytogenet. Cell Genet. 66, 152-l 54. 6. Speel, E. J. M., Lawson, D., Hopman, A. H. N., and Gosden, J. (1995) Multi- PRINS: multiple sequential oligonucleotide primed in situ DNA synthesis reac- tions label specific chromosomes and produce bands. Hum. Genet. 95,29-33. 7. Spowart, G. (1994) Mitotic metaphase chromosome preparation from peripheral blood for high resolution, in Methods in Molecular Biology, vol 29. Chromosome Analyszs Protocols (Gosden, J. R., ed.), Humana, Totowa, NJ, pp. l-10. 8. Fletcher, J. (1994) Immortalized cells lines: chromosome preparation and bmd- ing, in Methods in Molecular Bzology, vol. 29: Chromosome Analyszs Protocols (Gosden, J. R., ed.), Humana, Totowa, NJ, pp. 51-57. 9. Warburton, P. E., Haaf, T., Gosden, J., Lawson, D , and Willard, H. F. (1996) Characterization of a chromosome-specific chimpanzee alpha satellite subset: evolutionary relationship to subsets on human chromosomes. Genomlcs 33,220-228 Chromosome-Specific PRINS Jean-Paul Charlieu and Franck Pellestor 1. Introduction The identification of mdlvidual chromosomes IS of great Importance in cytogenetics, in order to detect aneuploidies or chromosomal rearrangements associated with genetic diseases. This can be achieved by several techniques based either on the intrinsic staining properties of the chromosomes in produc- ing bands (the banding pattern being specific for each pair of chromosomes) (1) or the use of a DNA probe to detect specifically a region of the chromo- some by fluorescence in sztu hybridization (FISH) (2). The use of centromeric a satellite sequences as FISH probes is very popular because of the specificity of these sequences. cz Satellite (or alphoid) DNA 1s a family of tandemly repeated sequences present at the centromere of all human chromosomes (3). Subfamilies, some of them specific for one or a small group of chromosomes, can be identified within alphoid DNA both by the periodic distribution of restriction sites and the nucleotide sequence of the 171-bp basic motif (4). These chromosome-specific subfamilies can therefore be used as FISH probes. This approach is limited, however, since the DNA sequences of some subfami- lies are very close to each other, and crosshybridization can occur between the centromeric sequences of several pairs of chromosomes. This is the case with chromosomes 13 and 2 1, for example, which share 99.7% homology in their alphoid sequences (5,. The development of the primed in situ (PRINS) tech- nique of labeling DNA (68) introduced a solution to this problem. The PRINS procedure consists of the use of a small oligonucleotide (usually 18-22 nucle- otides) from the sequence of interest as a primer. The primer is annealed to the denatured DNA of a chromosome or cell preparation. An in situ DNA synthe- sis reaction is performed with the incorporation of a labeled precursor (biotin- dUTP or digoxygenin-dUTP), using a thermostable DNA polymerase. A single From Methods m Molecular B/otogy, Vol 71 PRlNS and In S~tu PCR Protocols Edlted by. J R Gosden Humana Press Inc., Totowa, NJ 7 8 Charlieu and Pellestor base mismatch between the target and the probe will produce a less stable hybrid when using a primer than for a long FISH probe. In addition, if the mismatching nucleotide is located at the 3’-end of the PRINS primer, it will prevent any elongation by the DNA polymerase. We have developed several chromosome-specific a-satellite primers for PRINS, each of them carrying at least a chromosome-specific nucleotide at its 3’-end, and we describe in this chapter the use of two of them for the detection of human chromosomes 13 and 21. Other primers are available in the literature (9,ZO) or on request, but we are presenting only the conditions of use for the two most difficult, differing only at one position. 2. Material 2.1. Slides 1. Chromosome spreads are prepared from peripheral blood usmg standard meth- ods (fixation in methanol:acetic acrd 3: 1). 2. 20X SSC: 3M NaCl, 0.3M Nas-citrate (can be stored for several months at room temperature). 3. 70,90, and 100% ethanol. 4. Formamrde (Prolabo, Paris, France): Formamide must be deionized by mixing with Amberlite resm (Sigma, St. Louis, MO), allowing to stand for at least 1 h, and then filtering. Deionized formamide is stored at +4”C. 2.2. PRIM Reaction 1. Primers: Synthetic oligonucleotides are used as primers m the PRINS experi- ments. Their nucleotide sequences are as follows (11): 13A (chromosome 13): 5’-TGATGTGTGTACCCAGCT-3’ 21A (chromosome 21): 5’-TGATGTGTGTACCCAGCC-3’ Precipitate the primers by adding 10 vol of 1-butanol, vortex, and centrifuge for 1 mm at maximum speed in a bench-top microfuge. Dry the pellets under vacuum, and resuspend in 5 miV Tris-HCl, pH 8.0, to obtain a 50 @4 (50 pmol/pL) solu- tion. Store small aliquots (50 pL) at -2OT (see Notes 1 and 2). 2. 2’-Deoxyadenosine 5’-triphosphate (dATP) (Boehringer Mannheim, Meylan, France): Resuspend in Hz0 to obtain a 100-M stock solution (store at -2O’C). 3. 2’-Deoxycytosine 5’-triphosphate (dCTP) (Boehringer Mannheim): Resuspend to obtain a 100~mM stock solution (-2O’C). 4. 2’-Deoxyguanosine 5’-triphosphate (dGTP) (Boehringer Mannheim): Resuspend to obtain a 100~mM stock solution (-2OT). 5. 2’-Deoxythymidine 5’-triphosphate (dTTP) (Boehringer Mannheim): Resuspend to obtain a 100-n&f stock solution (-20°C). 6. Biotin-l&dUTP, 1 mM (Boehringer Mannheim) (-2O’C). 7. Glycerol 87% (Prolabo). 8. Tuq DNA polymerase (Boehringer Mannhetm). Store at -2O’C 9. 10X Taq buffer (provided with the enzyme) (-2O’C). Chromosome-Specific PRIM 9 10. Stop buffer: 500 n&f NaCl, 50 mM EDTA, pH 8.0 (can be stored at room tem- perature for several months). 11. Sterile, deionized, double-distilled water. 12. Water bath at 60°C. 13. Water bath at 72°C. 14. 1.5~mL microcentrifuge tubes (sterilized by autoclaving). 15. Coverslips (22 x 40). 16. Thermal cycling machine equipped with a flat block (e.g., Techne PHC3). 2.3. Detection 1. Washing solution: 4X SSC, 0.05% Tween 20. 2. Blocking solution: washing buffer plus 5% nonfat dry milk. Make fresh each time. 3. Fluorescein-avidin DCS (FITC-avidin) (Vector Laboratories, Burlingame, CA). 4. Propidium iodide (PI) (Sigma). 5. Antifade solution Vectashield (Vector Labs). 6. Staining Jars. 7. Microscope equipped for detection of FITC and PI fluorescence 3. Methods 3.1. Slides 1. Store slides prepared according to standard methods at room temperature for 5 d before use. 2. Just before the PRINS reaction, dehydrate the slides by passage through an etha- nol series (70,90, 100%) at room temperature, 3 min each step, and air-dry. 3. Denature the chromosomal DNA on the slides by immersing them in 70% formamide, 2X SSC, at 72°C for 2 min, dehydrating through an ice-cold ethanol series (70,90, lOO%), and an-drying (see Note 3). 3.2. PRINS Reaction 1. Prepare a 10X dNTPs mix: Dilute the stock solutions (100 r&f) of dATP, dCTP, dGTP, and dTTP l/l 0 in sterile, distilled water. In a sterile microcentrifuge tube, mix 10 & of each diluted dATP, dCTP, and dGTP, 0.25 pL of diluted dTTP, 25 pL of 1 m&f biotin-16 dUTP, and 55 pL of glycerol. Mix well and store at -2O’C. 2. Prepare the PRINS reaction mix in a sterile 1.5~mL microtube by mixing (for each slide) 4 pL of primer (200 pmol), 5 pL of 10X Tag polymerase buffer, 5 pL of 10X dNTPs mix (from step l), and 0.5 pL of Taq polymerase (2.5 U), and add sterile distilled water to a final volume of 50 pL. 3. Preheat the reaction mix at 60°C in a water bath. 4. Place the slide (prepared as in Section 3.1.) and a coverslip on the plate of the thermal cycler. 5. Set up the program for PRINS: 12 min at the annealing temperature (60°C for primer 13A, 61°C for primer 21A; see Note 4) and 30 min at 72’C. 6. When starting the program, heat the slide(s) and the coverslip at the anneal- ing temperature for 5 min. Then put the reaction mix onto the slide and cover 10 Char-lieu and Pellestor by the coverslip. Incubate the slide at the annealing temperature for a further 7 min; the temperature is automatically raised to 72°C at the beginning of the elongation step. 7. At the end of the elongation time, transfer the slide to 100 mL of preheated stop buffer (72°C) for 3 min to stop the PRlNS reaction and to remove the coverslip. Then transfer the slide to 100 mL of washing solution. The shdes can stay m thus buffer overnight at 4°C if convenient 3.3. Detection 1. Wash the slides twice for 3 min at room temperature in washing solution, with gentle agitation. 2. Drain the excess washing solution and apply 100 pL of blocking solution to each slide 3. Incubate for 10 min at room temperature under a coverslip. 4. Remove the covershp, dram excess fluid, and apply 100 pL of FITC-avldin diluted to 5 pg/mL in blocking solution to the slide. Cover with a new coverslip and incubate at 37°C for 30 min in a moist chamber. 5. Remove the coverslip and wash the slide three times (5 mm each) m washmg solution, at room temperature, with gentle agitation. 6 Drain excess fluid and mount the slide (22 x 40 coverslip) with Vectashleld antifade solution containing 0.5 l.tglmL propidium iodide. 7 Examine the shde by fluorescence microscopy (Fig. 1). 4. Notes 1. Chromosome-spectfic primers sometimes differ from each other by only one nucleotide at the 3’-end, as for the primers described here. It is therefore advtsable to purify the primers by HPLC to avoid contammation by shorter products am+ mg from premature stops during syntheses. Storage of the primers in small aliquots also prevents degradation of the primers by repeated cycles of freeze-thawing. 2. The concentration of the primers can be determined by using the Beer-Lambert equation: c = A26d%mi x L (1) where C is the concentration (M), A260 is the absorbance at 260 nm, E,,,~~ is the molar extinction coefficient (M-l), and L is the path length (cm) of the spectro- photometer cuvet. The molar extinction coefficient for an oligonucleottde can be determined as follows: & max = (number of A x 15,200) + (number of C x 7050) + (number of G x 12,010) + (number of T x 8400) M-l (2) 3. We describe here formamide denaturation, which gave more consistent results in our hands, but it is also possible to denature the chromosomes by heating the slide at 95“C for 3 min as part of the thermal cycle. In this case, omit step 3 of Section 3.1.) and run the following program on the PCR machine: 95°C for 3 min, [...]... counterstain the samples with hematoxylin, wash 1 x S min m tap water and 1 x 2 min in distilled water, and air-dry if you wish 9 Mount single-target PRINS samples in the embedding medium required for the used enzyme precipitate, as outlined in steps 7a-d and Table 3 Mount multiple-target PRINS samples m the embedding medmm required for the used enzyme precipitates, unless they need different mounting In. .. biotin/PO-DAB in a frozen tissue section of normal bladder epithelium after PRINS, hematoxylin counterstaining, and PBS/glycerol (1:9) embedding (E) Direct fluorescence detection of chromosome 9 centromeres with fluorored (red) in a frozen tissue section of normal bladder epithelium after PRINS and PBS/glycerol/DABCO embedding with DAPI counterstaining 2 Materials 2.1 PRINS DNA Labeling 1 Pepsin from porcine... slides for 5 min in washing buffer 3 For reactions using biotin- 16-dUTP: Dilute AvPO 1: 100 in blocking buffer and apply 50 pL under a coverslip Incubate slides for 30 min at 37’C in a humid chamber (Note 7) 4 For reactions using digoxigenin- 11-dUTP: Dilute SHADlgPO 1: 100 in blocking buffer and treat as in step 3 (Note 7) 5 Fluorescein-12-dUTP and fluorored-dUTP need no additional reporter and are simply... 10 min at room temperature (see Note l), and air-dry again 3 Wash slides for 5 min in PBS and 2 min in O.OlMHCl 4 Treat samples with 100 pg/mL pepsin in O.OlMHCl for 10 min at 37’C, wash for 2 min in O.OlMHCl at 37OC, and pass the slides through an ethanol series starting with 70% ethanol in O.OlM HCl (Note 2) 34 Speel et al 5 Postfix samples in 1% paraformaldehyde m PBS for 20 min at 4”C, wash in. .. Vol 71’ PRINS and In Situ PCR Protocols EdlIed by J R Gosden Humana Press Inc., Totowa, NJ 31 Fig 1 (see color plate number 2 after p 82) (C) Bright-field detection of chromosome 9 centromeres with biotin/PO-TMB in a frozen tissue section of normal colon epithelium after PRINS, hematoxylin counterstaining, and immersion oil embedding (D) Brightfield detection of chromosome 9 centromeres with biotin/PO-DAB... chromosome 9 and 7 centromeres with biotin/PO-DAB (brown) and digoxigenin/APase-fast red (red), respectively, in a human lymphocyte metaphase spread after double-target PRINS, hematoxylin counterstaining and PBS/glycerol (1:9) embedding (B) Brightfield detection of chromosome 9,7, and Y centromeres with biotin/PO-DAB (brown), digoxigenin/APase-fast red (red), and fluorescein/PO-TMB (green), respectively, in. .. heating block of the thermal cycler 7 Each PRINS reaction cycle consists of 5 min at the appropriate annealing temperature (see Note 3) and 15 min at 72°C for in situ primer extension 8 Stop the PRINS reaction by transferring the slides (after removal of the rubber solution seal) to 50 mL of PRINS stop buffer in a Coplin jar at 65OC for 1 min 9 For sequential PRINS reactions, it was found essential to... to three different PRINS- labeled DNA target sequences in contrasting colors in both interphase and metaphase cells (Fig lA,B) DNA sequences were detected by the precipitates of the horseradish peroxidasediaminobenzidine (PO-DAB, brown color), alkaline phosphatase-fast red From Methods m Molecular Biology, Vol 71 PRINS and In Situ PCR Protocols Edited by* J R Gosden Humana Press Inc , Totowa, NJ 13... 19,1179-l 182 PRINS DNA Synthesis on Frozen Tissue Sections Ernst J M Speel, Diane Lawson, Frans C S Ramaekers, John R Gosden, and Anton H N Hopman 1 Introduction Primed in situ (PRINS) labeling has become an alternative to in situ hybridization (ISH) for the localization of nucleic acid sequences in cell preparations (1-4) In the PRINS method, an unlabeled primer (restriction fragment, PCR product,... by PRINS technique Am J Med Genet 56, 393-397 9 Pellestor, F., Girardet, A., Andrea, B., Lefort, G., and Charlieu, J.-P (1994) The use of PRINS technique for a rapid in situ detection of chromosomes 13, 16, 18, 21, X and Y Hum Genet 95,12-17 10 Pellestor, F., Girardet, A., Lefort, G., And& o, B., and Charlieu, J.-P (1995) Selection of chromosome specific primers and their use in simple and double PRINS . diaminobenzidine (PO-DAB, brown color), alkaline phosphatase-fast red From Methods m Molecular Biology, Vol 71 PRINS and In Situ PCR Protocols Edited by* J. R Gosden Humana Press Inc ,. Mount single-target PRINS samples in the embedding medium required for the used enzyme precipitate, as outlined in steps 7a-d and Table 3. Mount mul- tiple-target PRINS samples m the embedding. achieved by several techniques based either on the intrinsic staining properties of the chromosomes in produc- ing bands (the banding pattern being specific for each pair of chromosomes) (1) or