Báo cáo Y học: GNA33 from Neisseria meningitidis serogroup B encodes a membrane-bound lytic transglycosylase (MltA) pdf

GNA33 from Neisseria meningitidis serogroup B encodes a membrane-bound lytic transglycosylase (MltA) Gary T. Jennings 1 *, Silvana Savino 1 *, Elisa Marchetti 1 , Beatrice Arico ` 1 , Thomas Kast 2 , Lucia Baldi 1 , Astrid Ursinus 2 , Joachim-Volker Ho¨ ltje 2 , Robert A. Nicholas 3 , Rino Rappuoli 1 and Guido Grandi 1 1 I.R.I.S., Chiron S.p.A., Siena, Italy; 2 Max Planck Institute fur Entwicklungsbiologie, Abteilung Biochemie, Tubingen, Germany; 3 Department of Pharmacology, University of North Carolina at Chapel Hill, NC, USA In a previous study, we used the genome of serogroup B Meningococcus to identify novel vaccine candidates. One of these molecules, GNA33, is well conserved among Men- ingococcus B strains, other Meningococcus serogroups and Gonococcus and induces bactericidal antibodies as a result of being a mimetic antigen of the PorA epitope P1.2. GNA33 encodes a 48-kDa lipoprotein that is 34.5% identical with membrane-bound lytic transglycosylase A (MltA) from Escherichia coli. In this study, we expressed GNA33, i.e. Meningococcus MltA, as a lipoprotein in E. coli. The lipo- protein nature of recombinant MltA was demonstrated by incorporation of [ 3 H]palmitate. MltA lipoprotein was purified to homogeneity from E. coli membranes by cation- exchange chromatography. Muramidase activity was con- firmed when MltA was shown to degrade insoluble murein sacculi and unsubstituted glycan strands. HPLC analysis demonstrated the formation of 1,6-anhydrodisaccharide tripeptide and tetrapeptide reaction products, confirming that the protein is a lytic transglycosylase. Optimal muramidase activity was observed at pH 5.5 and 37 °Cand enhanced by Mg 2+ ,Mn 2+ and Ca 2+ . The addition of Ni 2+ and EDTA had no significant effect on activity, whereas Zn 2+ inhibited activity. Triton X-100 stimulated activity 5.1-fold. Affinity chromatography indicated that MltA interacts with penicillin-binding protein 2 from Meningo- coccus B, and, like MltA from E. coli, may form part of a multienzyme complex. Neisseria meningitidis is a Gram-negative, capsulated b-proteobacterium capable of causing severe meningitis and septicemia with a fatality rate of  10% [2]. The complete 2 272 351-bp genomic sequence of Meningococcus serogroup B (strain MC58) has been determined and used by us to identify novel vaccine candidates against this pathogenic organism [1,2]. We amplified, cloned and expressed in Escherichia coli selected ORFs encoding pro- teins with predicted surface exposure. Recombinant pro- teins were purified, immunized in mice, and the resultant sera analysed by FACS, ELISA, and bactericidal assay. GNA33 was positive in all three analyses and highly conserved (99.2± 0.7%) among 22 strains of Meningococ- cus B, nine strains from Meningococcus serogroups A, C, Y, X, Z, W135, and 95.8% conserved in Neisseria gonorrhoeae [1]. Further study revealed that GNA33 elicits protective antibodies to meningococci by mimicking a surface-exposed epitope on loop 4 of porin A in strains with serosubtype P1.2 [3]. The ORF of GNA33 encodes a protein 441 amino acids in length with an N-terminal 20-amino-acid lipopolypep- tide signal sequence (LPSS) with a consensus lipoprotein- processing site, LAAC [4]. Sequence comparison showed that GNA33 is 34.5% identical and 41.3% homologous with the 38-kDa membrane-bound lytic transglycosylase A (MltA) from E. coli (Fig. 1). In E. coli, four additional exo-specific lytic transglycoylases (MltB, MltC, MltD, and Slt70) have been identified and/or characterized [5–8]. These lytic transglycosylases exhibit no significant sequence homology with each other. With the exception of Slt70 (soluble lytic transglycosylase), they are all lipoproteins that attach to the outer membrane [7–10]. Homologues of all these lytic transglycosylases have been identified in Meningococcus B [2], which, like their E. coli counterparts, also exhibit little sequence conservation with each other. Lytic transglycosylases are a unique class of lysozyme-like enzymes that catalyze cleavage of the b-1,4-glycosidic bond between N-acetylmuramic acid (MurNAc) and N-acetyl glucosamine (GlcNAc). However, unlike lysozyme where the glycosyl moiety is transferred to H 2 O, cleavage by lytic transglycosylases is followed by an intramolecular transgly- cosylation [10]. In this reaction, the glycosidic linkage between the muramyl and glucosaminyl residues is trans- ferred to the C6 position of the muramyl residue to form terminal 1,6-anhydromuramic acid-containing products [10]. By virtue of their ability to cleave the polysaccharide backbone of the peptidoglycan layer, lytic transglycosylases are thought to play a role in synthesis and degradation of the murein sacculus. It has been proposed that lytic transglycosylases play important roles in cellular elongation, Correspondence to G. T. Jennings, Cytos Biotechnology AG, Wagistrasse 25, CH-8952 Zu ¨ rich-Schlieren, Switzerland. Fax: + 41 1 733 4659, Tel.: + 41 1 733 4642, E-mail: jennings@cytos.com Abbreviations: GNA, genome-derived Neisseria antigen; LPSS, lipo- polypeptide signal sequence; MipA, MltA-interacting protein; MltA, membrane-bound lytic transglycosylase A; PBP, penicillin-binding protein. *Note: these authors contributed equally to this work. (Received 29 March 2002, revised 14 June 2002, accepted 20 June 2002) Eur. J. Biochem. 269, 3722–3731 (2002) Ó FEBS 2002 doi:10.1046/j.1432-1033.2002.03064.x septation, recycling of muropeptides, and pore formation [7,10,11]. Current models of cell wall synthesis in Gram-negative bacteria predict the necessity for murein synthases and lytic enzymes to interact in a co-ordinated and controlled manner [10]. Indeed, interactions between lytic transgly- cosylases (MltA, MltB and Slt70), bifunctional transgly- cosylase-transpeptidases (PBP1A, PBP1B, PBP1C), transpeptidases (PBP2, PBP3), and endopeptidases (PBP4 and PBP7) of E. coli have been reported [12,13]. In particular, affinity chromatography and/or surface plasmon resonance have shown interactions between MltA, PBP1B, PBP1C, PBP2, PBP3 and a newly identi- fied scaffolding protein, MipA [14]. It is thought that, through such interactions, the enzymes required for cell wall metabolism associate and form a multienzyme complex [10,14]. An enzyme complex would not only provide a means for regulating peptidoglycan synthesis but would also provide a way to control the potentially autolytic activity of proteins such as MltA. To date, no evidence of these associations in Neisseria species has been reported. In this study we cloned GNA33 (MltA) from Meningo- coccus serogroup B. The recombinant lipoprotein was expressed in E. coli, purified, and assayed for its muram- idase and lytic transglycosylase activity. In addition, we used affinity chromatography to investigate the hypothesis that MltA associates with other enzymes involved in peptido- glycan metabolism and thus may be part of a multienzyme complex. EXPERIMENTAL PROCEDURES Vector construction Three versions of meningococcal mltA were amplified by PCR and cloned into the expression vector pET21b+ (Novagen) via 5¢ NdeIand3¢ XhoI restriction sites. These included a full-length form incorporating its endogenous 20-amino-acid LPSS, a form containing a 19-amino-acid LPSS from an unrelated Meningococcus B lipoprotein, GNA1946 [1], and a truncated form lacking any leader sequence (Fig. 1). Full-length mltA was amplified using a forward primer containing an NdeI restriction site (5¢-CGCGGATCCCA TATGAAAAAATACCTATTCCGC-3¢) incorporating the ATG start codon. The reverse primer (5¢-CCCGCTC GAGTTACGGGCGGTATTCGG-3¢) contained a XhoI restriction site and was used for all three constructs. The construct containing the GNA1946 LPSS was made using a forward primer (5¢-GGGAATTCCATATGAAAACCTT CTTCAAAACCCTTTCCGCCGCCGC GCTAGCGCT CATCCTCGCCGCCTGCCAAAGCAAGAGCATC-3¢) spanning the entire leader of GNA1946 and containing 18 nucleotides overlapping the mltA sequence. A conservative double nucleotide substitution (underlined) was made in a region of the primer encoding the GNA1946 LPSS. This substitution introduced an NheI restriction and was designed to allow the GNA1946 LPSS to be ligated into any of the meningococcus genes that we have previously expressed in pET-21b [1]. This restriction site was not used Fig. 1. Amino acid sequence of MltA from N. meningitidis serogroup B: comparison with MltA from E. coli. The amino-acid sequence of MltA from Meningococcus B (strain 2996) (NmMltA) was compared with MltA from E. coli (EcMltA) using the GAP program included in the Genetics Computer Group (GCG) Wisconsin Package version 10.0. The 20-amino-acid LPSS is underlined. The LPSS was identified using the program PSORT avail- able at http://psort.nibb.ac.jb. The 19-amino- acid LPSS from the Meningococcus Bgene GNA1946 (GNA1946L), was used to replace the MltA leader peptide and is shown above the meningococcal sequence. Amino acids are identified by the standard single letter code. Ó FEBS 2002 MltA from N. meningitidis serogroup B (Eur. J. Biochem. 269) 3723 in this study. The truncated gene lacking the 20-amino-acid leader peptide was amplifed using the forward primer, 5¢-CGCGGATCCCATATGCAAAGCAAGAGCATCC AAA-3¢. PCR was performed in a reaction volume of 100 lL comprising 10 m M Tris/HCl (pH 8.3), 50 m M NaCl, 1.5 m M MgCl 2 ,0.8 m M dNTPs, 40 l M each oligonucleotide primer, and 2.5 U TaqI DNA polymerase (PerkinElmer, Boston, MA, USA). Template DNA for the reaction was 200 ng genomic DNA from Neisseria meningitidis B 2996. The primary denaturation step was performed at 94 °Cfor 3 min and the remainder of the first five cycles with denaturation, annealing and polymerization conditions of 94 °Cfor40s,52°C for 40 s and 72 °Cfor1min, respectively. The annealing temperature was increased to 65 °C for the next 30 cycles, and a final 7 min extension at 72 °C completed the reaction. PCR products were purified using the Qiagen Gel Extraction Kit. Ligations and transformations into E. coli DH5 were performed as described by Sambrook et al. [15]. After selection, amplifi- cation and purification, the plasmids were used to transform E. coli BL21(DE3) (Novagen, Madison, WI, USA). The genomic sequence of Meningococcus B is known for the strain MC58 [2]. The nucleotide sequence of mltA from strain 2996 has 17 nucleotide substitutions (of which 16 are silent) with respect to mltA from strain MC58. Only one of these base changes results in an amino-acid substitution, Ser312 to Ala. Expression and purification of recombinant MltA E. coli BL21(DE3) cells harboring the three versions of pET21b-MltA (see above) were grown at 30 °CinLuria– Bertani medium containing 100 lgÆmL )1 ampicillin until the D 550 reached 0.6–0.8. Isopropyl thio-b- D -galactoside was added to a final concentration of 1.0 m M ,andthe culture shaken for an additional 3 h. Cells were collected by centrifugation at 8000 g for 15 min at 4 °C. All subsequent procedures were performed at 4 °C. For purification of lipidated MltA, cells were resuspend- ed in 25 mL 50 m M phosphate/300 m M NaCl, pH 8.0, containing complete protease inhibitor (Roche, Basel, Switzerland). Bacteria were disrupted by osmotic shock with two or three passages through a French Press (SLM Aminco). Unbroken cells were removed by centrifugation at 5000 g for 15 min, and membranes sedimented by centrifugation at 100 000 g for 45 min. The pellet was resuspended in 20 m M Tris/HCl (pH 8.0)/1.0 M NaCl containing complete protease inhibitor, and the suspension mixed for 2 h. After centrifugation at 100 000 g for 45 min, the pellet was resuspended in 20 m M Tris/HCl (pH 8.0) containing 1.0 M NaCl, 5.0 mgÆmL )1 Chaps, 10% (v/v) glycerol and complete protease inhibitor. The solution was stirred overnight, centrifuged at 100 000 g for 45 min, and the supernatant dialysed for 6 h against 20 m M Bicine (pH 8.5)/120 m M NaCl/5.0 mgÆmL )1 Chaps/10% (v/v) glycerol. The dialysate was cleared by centrifugation at 13 000 g for 20 min and applied to a Mono S FPLC ion- exchange column (Pharmacia, Uppsala, Sweden) at a flow rate of 0.5 mLÆmin )1 . Elution was performed using a stepwise NaCl gradient. The protein was also expressed and purified in a form lacking the LPSS. After expression and harvesting, cells were resuspended in 20 m M Bicine (pH 8.5)/20 m M NaCl/ 10% (v/v) glycerol containing complete protease inhibitor and disrupted with a Branson Sonifier 450. The sonicate was centrifuged at 8000 g for 30 min to remove unbroken cells, and MltA was precipitated from the supernatant by the addition of saturated (NH 4 ) 2 SO 4 solution. MltA was precipitated between 35% and 70% saturation and was collected by centrifugation at 8000 g for 30 min. The pellet was dissolved in 20 m M Bicine (pH 8.5)/20 m M NaCl/10% (v/v) glycerol and dialysed against this buffer overnight. The dialysate was centrifuged at 13 000 g for 20 min, and the supernatant was applied to an FPLC Mono S ion-exchange column at a flow rate of 0.5 mLÆmin )1 . The protein was eluted from the column with a stepwise NaCl gradient. Purifications were analysed by SDS/PAGE [16], and protein concentration determined by the Bradford method. West- ern-blot analysis was performed using polyclonal antisera as described previously [1]. Palmitate labelling Palmitate incorporation by recombinant MltA was con- firmed as described by Kraft et al. [17]. Briefly, E. coli BL21(DE3) harbouring one of the three pET21b-MltA constructs were grown at 30 °C in Luria–Bertani medium containing 100 lgÆmL )1 ampicillin and 5 lCiÆmL )1 [ 3 H]palmitate (Amersham) until the D 550nm reached 0.4–0.8. Expression of recombinant protein was induced for 1 h by the addition of isopropyl b- D -thiogalactoside (final concentration 1 m M ), and the bacteria harvested by centrifugation at 3000 g for 15 min. Cells were washed twice with cold NaCl/P i , suspended in 20 m M Tris/HCl (pH 8.0)/ 1m M EDTA/1.0% (w/v) SDS, lysed by boiling for 10 min, and centrifuged for 10 min at 13 000 g. Cold acetone was added to the supernatant, and, after 1 h at )20 °C, protein was collected at 13 000 g for 10 min. Protein was resus- pended in 1.0% (w/v) SDS, boiled with SDS/PAGE sample buffer, and subjected to SDS/PAGE using a 12.5% separating gel. Gels were fixed for 1 h in 10% (v/v) acetic acid, and soaked for 30 min in Amplify solution (Amer- sham). The gel was vacuum-dried under heat and exposed to Hyperfilm (Kodak) overnight at )80 °C. Assay for muramidase activity Purified, recombinant MltAs expressed with the GNA1946 LPSS or without an LPSS were assessed for their ability to degrade insoluble murein sacculi into soluble muropeptides by the method of Ursinus & Holtje [18]. Murein lysis activity was determined using peptidoglycan radiolabelled with meso-2,6-diamino-3,4,5-[ 3 H]pimelic acid as substrate. Enzyme (3–10 lg total) was incubated for 45 min at 37 °C in a total volume of 100 lL comprising 10 m M Tris/maleate (pH 5.5), 10 m M MgCl 2 , 0.2% (v/v) Triton X-100 and [ 3 H]diaminopimelic acid-labelled murein sacculi ( 10 000 c.p.m.). The assay mixture was placed on ice for 15 min with 100 lL1.0%(w/v)N-cetyl-N,N,N-trime- thylammonium bromide, and the precipitated material separated by centrifugation at 10 000 g. The radioactivity in the supernatant was measured by liquid-scintillation counting. The E. coli lytic transglycosylase Slt70 was used as a positive control for the assay, and the negative control comprised the above assay solution without enzyme. 3724 G. T. Jennings et al.(Eur. J. Biochem. 269) Ó FEBS 2002 Assay for lysis of poly(MurNAc-GlcNAc) glycan strands The ability of MltA to utilize purified glycan strands as substrate was determined by the method described by Ursinus & Holtje [18]. Poly(MurNAc-GlcNAc) n>30 , labelled with N-acetyl- D -1-[ 3 H]glucosamine, was incubated with 3 lgMltAin10m M Tris/maleate (pH 5.5)/10 m M MgCl 2 /0.2% (v/v) Triton X-100 for 30 min at 37 °C. The reaction was stopped by boiling for 5 min, and the pH of the sample adjusted to 3.5 by addition of 10 lL 20% (v/v) phosphoric acid. The components of the assay were then separated by RP-HPLC on a Nucleosil 300 C 18 column as described by Harz et al. [19]. The E. coli lytic transglycos- ylase MltA was used as a positive control in the assay. A negative control was performed in the absence of enzyme. Analysis of reaction products The nature of the reaction products resulting from the digestion of unlabelled E. coli murein sacculus were deter- mined by RP-HPLC as described by Glauner [20]. Murein sacculi digested with the muramidase Cellosyl were used to calibrate and standardize the Hypersil ODS column. Gel filtration The molecular masses of the recombinant proteins were estimated using either FPLC Superose 12 (H/R 10/30) or Superdex 75 gel-filtration columns (Pharmacia). The buf- fers were 20 m M Bicine (pH 8.5) with and without 5.0 mgÆmL )1 Chaps, respectively. In addition, each buffer contained 150–200 m M NaCl and 10% (v/v) glycerol. Proteins were dialysed against the appropriate buffer and applied in a volume of 200 lL. Gel filtration was performed with a flow rate of 0.5–2.0 mLÆmin )1 and the eluate monitored at 280 nm. Fractions were collected and analysed by SDS/PAGE. Blue Dextran 2000 and the molecular-mass standards ribonuclease A, chymotryp- sin A, ovalbumin A, and BSA (Pharmacia) were used to calibrate the columns. The molecular mass of the sample was estimated from a calibration curve of K av vs. log (molecular mass) of the standards. Preparation of membrane extracts for affinity chromatography A detergent-solubilized membrane extract was prepared from an acapsulated N. meningitidis strain, M7. An over- night culture of strain M7 was inoculated into 2 L Muller- Hinton broth containing 0.25% (w/v) glucose, and grown at 37 °C in an atmosphere of 5.0% CO 2 . When the D 550 reached 0.6, the culture was cooled on ice and harvested by centrifugation at 8000 g; all the following steps were performed at 4 °C. The pellet was resuspended in 10 m M Tris/HCl (pH 8.0) containing complete protease inhibitor and DNase (10 lgÆmL )1 ), and the cells were disrupted with a French Press. Membranes were spun down at 100 000 g for 45 min and resuspended in 10 m M Tris/maleate (pH 6.8) containing 2.0% (v/v) Triton X-100, 10 m M MgCl 2 , 150 m M NaCl and EDTA-free complete protease (buffer I). After stirring overnight, membrane debris was removed by centrifugation (100 000 g for 45 min), and the supernatant containing solubilized protein stored at )20 °C. Affinity chromatography Purified leaderless MltA (10 mgÆmL )1 gel) was coupled to CNBr-activated Sepharose 4B (Pharmacia) according to the manufacturer’s protocol. CNBr-activated Sepharose 4B prepared without protein and where the functional groups were neutralized with Tris was used as a control for nonspecific binding to the resin. Disposable columns containing either control or MltA-coupled resin were prepared and equilibrated with 20 col. vol. buffer I. Solu- bilized membrane extract was applied to both columns at a flow rate of 0.25 mLÆmin )1 , then washed with 5 · 1.0 mL buffer I. Retained proteins were eluted by increasing the NaCl concentration in a stepwise fashion. Salt concentra- tions of 300 m M , 600 m M and 1.0 M in buffer I were applied in 5 · 1.0 mL aliquots, and the eluates retained for analysis by SDS/PAGE, penicillin-binding assay, and Western blot. Penicillin-binding assay Penicillin-binding proteins (PBPs) were identified using the 125 I-labelled Bolton–Hunter derivative of ampicillin pre- pared as described previously [21]. Briefly, 4 lL(2.4lg total) of the labelled ampicillin derivative was incubated for 30 min at 37 °Cwith40lL of the fractions eluted from control and MltA-coupled affinity columns. The reaction was stopped by the addition of 4 lL penicillin G (60 mgÆmL )1 ), and the reaction complexes separated by SDS/PAGE and visualized by autoradiography. Preparation of antisera to PBP2 Recombinant PBP2 from N. gonorrhoeae was purified as a soluble, active form. PBP2 was expressed in the cytoplasm of E. coli as a fusion protein to maltose-binding protein (MBP) with a His 6 tag at its N-terminus. Codons 44–581, which encode the entire periplasmic domain of PBP2, were fused in-frame to the C-terminus of MBP via an interven- ing tobacco etch virus (TEV) protease site. The fusion protein was overexpressed in E. coli, purified on a Ni 2+ / nitrilotriacetate column, and cleaved with His 6 –TEV protease (fusion protein/TEV protease, 20 : 1, w/w) in 50 m M Tris/HCl (pH 8.0)/500 m M NaCl/10% glycerol. After digestion, PBP2 was again purified by metal chelate affinity chromatography to remove uncut fusion protein, His 6 –MBP and the protease. PBP2 was not eluted in the flow through, which contained unrelated contaminant proteins, but was eluted from the column with 10 m M imidazole. Purified PBP2 was judged to be at least 95% pure by SDS/PAGE. The protein was concentrated to 6mgÆmL )1 and stored at )80 °C. Purified PBP2 was used to immunize mice, and antisera were collected as described byPizzaet al.[1]. Western blot Fractions eluted from the MltA-coupled affinity column were separated by discontinuous SDSPAGE using a 12.5% separating gel [15]. Proteins were electroblotted onto a nitrocellulose membrane and probed with antisera to PBP2 diluted 1 : 1000. Immunoreactive proteins were detected using the enhanced chemiluminescent method (Amersham, Chicago, IL, USA) and fluorography. Ó FEBS 2002 MltA from N. meningitidis serogroup B (Eur. J. Biochem. 269) 3725 RESULTS Cloning and expression in E. coli Expression of MltA in E. coli was observed when the gene was cloned with either its own 20-amino-acid LPSS or the 19-amino-acid LPSS from an unrelated Meningo- coccus lipoprotein, GNA1946. However, the level of expression was much lower when the native leader peptide was used (result not shown). Hence, for purposes of purification and characterization, we used the clone incorporating the LPSS from GNA1946. MltA cloned without a leader peptide was expressed very efficiently and represented about 20% of total cellular protein as judged by densitometry. This truncated, soluble form of the protein was used for affinity chromatography (see below). MltA incorporating the LPSS from GNA1946 was routinely expressed at 30 °C because expression of the recombinant protein at 37 °C resulted in lysis of host cells. Lysis at 37 °C was observed within 60 min of induction of expression and could be prevented by the addition of 12% (w/v) sucrose and 10 m M MgSO 4 . Overexpression of E. coli MltA also results in formation of spheroplasts and cell lysis [9]. However, in contrast with our results, lysis due to overexpression of E. coli MltA occurs at 30 °C, but not at 37 °C. With E. coli MltA, this effect is due to the temperature sensitivity of its muramidase activity, which exhibits maximum activity at 30 °C and a 93% reduction in activity at 37 °C. It also has been reported that a 55-fold overexpression of E.coli lytic transglycosylase MltB resulted in rapid cell lysis at 37 °C [8]. Similar to our observation with Meningococcus MltA, autolysis induced by overexpression of E. coli MltB was also prevented by osmotic protection during growth. Purification of recombinant proteins Recombinant MltA lipoprotein was purified from the membrane fraction of E. coli as described in Experimen- tal Procedures. Analysis of the purification by SDS/ PAGE showed that MltA lipoprotein was localized in the membrane fraction (Fig. 2, lane 2). Western-blot analysis with polyclonal sera raised against MltA failed to detect MltA in any of the soluble fractions obtained before Chaps extraction, demonstrating exclusive local- ization of the lipoprotein to the membrane fraction (result not shown). After solubilization of MltA with Chaps, it was necessary to maintain NaCl at a minimum concentration of 120 m M to prevent the lipoprotein from precipitating. The predicted pI for MltA is 10.5. The basic nature of the protein enabled FPLC cation- exchange chromatography to be performed under condi- tions that allowed almost complete removal of contam- inating proteins in a single step (Fig. 2, lane 4). Similarly, this property was exploited to perform a simple two-step procedure for the purification of the truncated version of MltA, which involved salting out and cation exchange. The leaderless form is found exclusively in the cytosolic fraction of E. coli and was purified to homogeneity as judged by SDS/PAGE with Coomassie blue staining (Fig. 2, lane 5). Molecular mass The molecular masses of the lipoprotein and truncated forms of MltA were determined under denaturing condi- tions by SDS/PAGE (Fig. 2). The two forms of the protein migrate to the same position in the gel (Fig. 2), and, from a calibration plot of log mass vs. relative mobility of protein standards, the masses of both forms of MltA were calculated to be 44.5 kDa. This is in agreement with the molecular mass of 45 869 Da predicted from the amino- acid composition of the protein excluding the first 19-amino-acids of the leader peptide. As the lipoprotein expressed with its 2138-Da leader sequence migrates to the same position as leaderless MltA, it is reasonable to conclude that the signal peptide is cleaved when this clone is expressed. The presence of detergent in the purification prevented an accurate estimation of molecular mass for MltA lipoprotein using molecular exclusion chromatogra- phy. As truncated MltA lacking its LPSS was purified in the absence of detergent, we determined the native molecular mass using this form of the protein (see Experimental Fig. 2. SDS/polyacrylamide gel showing the purification and molecular mass of recombinant forms of MltA. Proteins were separated by SDS/ PAGE on a 12.5% separating gel and stained with Coomassie Brilliant Blue. Lane M, molecular-mass standards; lane 1, bacterial lysate after expression; lane 2, membrane fraction after 100 000 g centrifugation; lane 3, soluble fraction after extraction of membrane fraction with 0.5% CHAPS; lane 4, an aliquot from the peak fraction from Mono S FPLC ion-exchange chromatography; lane 5, truncated MltA (expressed without the LPSS) after Mono S FPLC ion-exchange chromatography. 3726 G. T. Jennings et al.(Eur. J. Biochem. 269) Ó FEBS 2002 procedures). Truncated MltA was eluted with a K av corresponding to a molecular mass of 31 600 Da. This value is low compared with that of the denatured protein suggesting either an interaction with the column or a smaller than expected Stokes’ radius. Nevertheless the native molecular mass of the truncated form of MltA is more indicative of a monomer than a dimer. Confirmation that MltA is a lipoprotein To test if recombinant MltA expressed with either its endogenous LPSS or GNA1946 LPSS was lipidated, the ability of the proteins to incorporate [ 3 H]palmitate was examined. Proteins extracted from cells grown in the presence of the radiolabel were examined by SDS/PAGE and autoradiography (Fig. 3). A labelled band with a molecular mass of 44 kDa was observed for MltA cloned with either its own leader or the leader from GNA1946. The radiolabel was not incorporated when MltA lacking an LPSS was expressed. MltA is a muramidase Both the purified lipoprotein and truncated form of MltA showed muramidase activity when assayed for their ability to degrade murein sacculi to soluble muropeptides. How- ever, the activity observed with the lipoprotein form was 21.6-fold higher than the activity of the truncated form. For this reason, the lipoprotein was chosen for further kinetic analyses. The activity of MltA lipoprotein was enhanced 5.1-fold by the addition of 0.2% (v/v) Triton X-100 to the assay, whereas Triton X-100 had no measurable effect on the activity of the truncated soluble form of the protein. Biochemical and kinetic properties of the enzyme The effect of pH on muramidase activity was determined in Tris/maleate buffer over the pH range 5.0–8.0. The optimal pH for the reaction was determined to be 5.5 (data not shown). The optimum pH for lytic transglycosylase activity byMltAfromE. coli is 4.5 [18]. Enzyme activity was measured over the temperature range 18–42 °C. Maximum activity was observed at 37 °C (data not shown). As we observed that MltA has 77% of the activity at 30 °Casit does at 37 °C, the stability of cells expressing Meningococcus MltA at 30 °C is unlikely to be due solely to a temperature- dependent decrease in murein lytic activity as previously described for E. coli MltA (see above). The effect of ions on muramidase activity was determined by performing the reaction with a variety of bivalent cations, at a final concentration of 10 m M .Maximum activity was found with Mg 2+ , which stimulated activity 2.1-fold. Mn 2+ and Ca 2+ stimulated enzyme activity to a similar extent, whereas Ni 2+ and EDTA had no significant effect on activity. In contrast, Zn 2+ significantly inhibited enzyme activity (data not shown). Initial-rate kinetic analyses were performed with sub- strate concentrations ranging from 2.6 to 52.0 mgÆL )1 .An analysis of the Michaelis–Menten curve (data not shown) showed that the enzyme exhibits typical first-order and zero- order kinetics. As the substrate for the reaction is insoluble, it is not possible to determine the K m for the reaction in molar terms [18]. However, the apparent K m of 8.2 mgÆL )1 determined from a double-reciprocal Lineweaver–Burk plot is slightly lower than the value (52.6 mgÆL )1 )obtained previously for MltA from E. coli [18]. Substrate specificity and reaction product The ability of MltA to lyse isolated glycan strands comprising poly(MurNAc-GlcNAc) n>30 was demonstrated when we separated 1,6-anhydrodisaccharide subunit reac- tion products from the oligosaccharide substrate by HPLC (Fig. 4). The same elution profile was observed when we assayed E. coli MltA in a control experiment (result not shown). The use of isolated glycan strands as a substrate further demonstrates homology with E. coli MltA, which is also capable of utilizing both murein sacculi and isolated glycan strands [18,22]. HPLC analysis of the digestion products after incubation of MltA with murein sacculi showed two major peaks eluted with retention times of 52.4 and 68.9 min (Fig. 5). By comparing the elution profile of the calibration standard, it was determined that these major reaction products Fig. 3. Demonstration that MltA is a lipoprotein. E. coli BL21(DE3) harbouring pET21b-MltA cloned with its own LPSS, with the LPSS from GNA1946, or without a leader sequence were grown in the presence of [ 3 H]palmitate. Expression of recombinant protein was induced for 1 h at 30 °C by the addition of 1 m M isopropyl b- D - thiogalactoside. Cells were then washed, lysed and protein precipitated as described in Experimental Procedures. Proteins were separated by SDS/PAGE using a 12.5% separating gel, and the labelled proteins were visualized by autoradiography. Lane 1, MltA cloned without an LPSS; lane 2, MltA cloned with its own LPSS; lane 3, MltA cloned with the LPSS from GNA1946. Molecular masses of marker proteins are indicated on the left and the position of MltA is indicated by an arrow. Ó FEBS 2002 MltA from N. meningitidis serogroup B (Eur. J. Biochem. 269) 3727 corresponded to 1,6-anhydrodisaccharide tripeptide and tetrapeptide, respectively. The formation of the 1,6-anhydro intramolecular bond within the muramic acid moiety confirms that the enzyme is indeed a lytic transglycosylase (Fig. 5). MltA–Sepharose affinity chromatography of membrane proteins The leaderless form of MltA was expressed, purified and covalently bound to CNBr-activated Sepharose. This col- umn was used to isolate MltA-interacting proteins from a membrane fraction of Meningococcus B. Proteins were eluted with a stepwise NaCl gradient and assayed for penicillin-binding activity by incubation with 125 I-labelled ampicillin. PBPs were visualized by SDS/PAGE and auto- radiography (Fig. 6). A control column prepared without MltA was used to assess the specificity of binding. The most intensely labelled band at 62 kDa observed in the starting material was retained by MltA–Sepharose during loading and washing, but was completely eluted with 300 m M NaCl. In contrast, the intensely labelled 46-kDa band observed in the starting material was not retained by the column and was eluted in the flow through. Vollmer et al. [14] reported that 400 m M NaCl was sufficient to completely disrupt binding of PBPs to E. coli MltA. When the autoradiograph and Coomassie blue-stained gel were overlaid, it was not possible to see a protein band corresponding to the 62-kDa radioactive band. This is characteristic of PBPs, which are typically of low abundance; for example, E. coli PBP2 is present at only  50 copies per cell [23,24]. To date, four PBPs have been identified in Meningococcus B: PBP1, PBP2, PBP3 and PBP4. These proteins have predicted molecular masses of 88.9 kDa, 63.6 kDa 50.5 kDa and 34.1 kDa, respectively [25,26]. Hence we reasoned that the 62-kDa PBP specifically retained during affinity chromatography is PBP2. To confirm this hypothesis, we analysed affinity- chromatography fractions by Western-blot analysis using polyclonal antisera raised against PBP2 from Gonococcus (Fig. 7). Gonococcal PBP2 has 98% sequence identity with PBP2 from Meningococcus serogroup B. Immunoblots showed an immunoreactive band with a molecular mass of 62 kDa in the starting material and in the fraction obtained after elution with 300 m M NaCl. Moreover, this band migrated to the same position as purified gonococcal PBP2. The 88-kDa immunoreactive band observed in the starting material was not retained by the MltA affinity column. Taken together these results demonstrate an interaction involving MltA and PBP2. DISCUSSION A genomics-based approach to vaccine discovery previ- ously identified GNA33 as a potential vaccine candidate Fig. 5. HPLC analysis of muropeptides after digestion of murein sacculi with MltA. Isolated murein sacculi were digested with purified MltA and reduced with sodium borohydride. The resulting muropeptides were separated by RP-HPLC on a Hypersil ODS column. Elution was performed with a linear gradient from 50 m M sodium phosphate (pH 4.32) to 50% methanol in 50 m M sodium phosphate (pH 4.95). The column was calibrated and standardized with murein sacculi digested with the muramidase Cellosyl. Fig. 4. HPLC analysis demonstrating hydrolysis of isolated glycan strands. Poly(MurNAc-GlcNAc) n>30 was incubated without (A) or with (B) MltA as described in Experimental procedures. At the com- pletion of the incubation, the sample was passed over a Nucleosil 300 C 18 column to which was applied 0.1 m M sodium phosphate buffer (pH 2), 5% acetonitrile for 5 min, 100% methanol for 5 min, and again starting buffer. The radioactivity of the eluate was monitored. The peak eluted between 20.2 and 22.2 min corresponds to intact glycan strands. In a control assay in which MltA was replaced with E. coli MltA, the same elution profile as seen in (B) was observed (data not shown). 3728 G. T. Jennings et al.(Eur. J. Biochem. 269) Ó FEBS 2002 against meningococcal infection. Sequence comparison predicted that GNA33 encodes a lipoprotein homologous to the lytic transglycosylase MltA from E. coli.To definitively identify and characterize GNA33, we cloned and expressed the ORF of GNA33 in E. coli with and without an LPSS. Although the level of expression of the truncated form was 20-fold higher than of the lipoprotein form, incorporation of an LPSS in MltA increased specific activity by 22-fold. Incorporation of 3 [H]palmitate, cleavage of the leader peptide, and localization of the protein to the membrane fraction all suggest that recom- binant MltA is correctly processed as a lipoprotein in E. coli. Moreover, purification of enzymatically active protein and lysis of host cells during expression confirmed the fidelity of the heterologous expression system. When MltA was expressed with its own LPSS, the level of expression was low. The level of expression was increased significantly by fusing codons 21–441 of MltA to an LPSS from an unrelated Meningococcus B lipoprotein, GNA1946. This LPSS in combination with MltA is obviously efficiently processed by the lipoprotein-process- ing machinery of E. coli. We demonstrated that recombinant MltA is capable of lysing murein sacculi, confirming that the protein is a muramidase. The lipoprotein produced two major reac- tion products, 1,6-anhydrodisaccharide tripeptide and tetrapeptide, confirming that the protein is indeed a lytic transglycosylase. Of the four exo-specific lytic transglycos- ylases in E. coli studied to date, only MltA is capable of utilizing unsubstituted murein glycan strands as substrate [18]. The ability of meningococcal MltA to also utilize the unsubstituted substrate shows a functional similarity between the two homologues. Furthermore, in many of the biochemical parameters assessed, such as pH opti- mum, K m and requirement for bivalent cations, the N. meningitidis and E.coli enzymes are similar [9,18]. These results confirm the sequence-based prediction that GNA33 is a homologue of E. coli lytic transglycosylase MltA. For these reasons, we assigned the name MltA to GNA33. In this study, we used affinity chromatography to demonstrate an association between meningococcal MltA and PBP2. The ability to interact with a PBP is a characteristic common to MltA from N. meningitidis and E. coli and is the first description of such an association beyond that reported for E. coli. E. coli MltA is thought to form part of an enzyme complex composed of murein synthases and muramidases. This association is believed to facilitate the co-ordinated action of different enzymes involved in enlargement and septation of the murein sacculus [10]. Reconstitution experiments with E. coli Fig. 6. PBP assay of proteins fractionated by affinity chromatography on MltA-sepharose. Aliquots of fractions obtained from the elution of the meningococcal membrane extract from either a MltA–Sepharose or control column were assayed for the presence of PBPs with 125 I-labelled ampicillin as detailed in Experimental Procedures. The labelled fractions were subjected to SDS/PAGE on a 10% separating gel and visualized by autoradiography after 100 h exposure. SM is membrane extract before addition to the column. C indicates eluates obtained from the control column, and T represents eluates from the MltA–Sepharose column. Shown are the first two fractions from the wash with buffer I (150 m M NaCl) and each of the elution steps in 300 m M NaCl, 600 m M NaCl and 1 M NaCl. The position of molec- ular-mass markers is indicated. Fig. 7. Western blot of proteins fractionated by affinity chromatography on MltA–Sepharose. Aliquots of fractions obtained after elution of the meningococcal membrane extract from the MltA–Sepharose column were analysed by immunoblotting with anti-PBP2 sera. Immunore- active bands were detected by enhanced chemiluminesence as described in Experimental procedures. Lane 1, purified gonococcal PBP2; lane 2, membrane extract from meningococcus before addition to the column; lane 3, fraction obtained after elution with 300 m M NaCl. The positions of molecular-mass markers are shown. Ó FEBS 2002 MltA from N. meningitidis serogroup B (Eur. J. Biochem. 269) 3729 MltA and PBP1B demonstrated the necessity for the structural protein MipA, and it has been proposed that this enzyme serves as a scaffold for assembly of the multienzyme complex [14]. We performed an extended homology search of the Meningococcus B genome but failed to identify a homologue of MipA. A similar situation exists for Haemophilus influenzae, which contains a homologue of MltA but not MipA [14]. A BLAST search showed that N. meningitidis PBP2 and E. coli PBP3 have 39% identity and 59% homology over a 541- amino-acid overlap and revealed that meningococcal PBP2 is more homologous to E. coli PBP3 than PBP2. In fact, Meningococcus does not have a homologue of E. coli PBP2, which is involved in maintaining the characteristic rod shape of the bacterium. Interestingly, it is the presence of either PBP2 or PBP3 in the enzyme complex of E. coli that confers a specific function to the complex [14]. In E. coli, PBP2 is known to be responsible for cell elongation, whereas PBP3 is involved in septum formation [27,28]. It will be interesting to determine if such an enzyme complex exists in Meningococcus,the nature and composition of the protein components, and in particular the function of the association between MltA and PBP2. We initially reported that antibodies raised against GNA33 are bactericidal, a property known to correlate with protective effects in humans [1]. It was subsequently discovered that antibodies elicited by vaccination with GNA33 are bactericidal because MltA is an effective mimetic antigen of the PorA epitope P1.2 [3]. In its own right, MltA may be a useful vaccine for the prevention of disease caused by P1.2 strains. Furthermore, it has been suggested that substituting strain specific PorA loops into MltA or its subdomains may generate immunogenic mimetics of other serotype PorA epitopes [3]. The ease of expression and purification demonstrated in this work further suggests the great potential that MltA offers as a recombinant vaccine candidate against meningococcal infection. A direct role for lytic transglycosylases in meningococcal disease is suggested by an investigation of genes required for bacteraemic disease. In an infant rat model of N. meningitidis infection, Sun and co-workers [29] used insertional mutagenesis to identify genes essen- tial for pathogenesis, one of which was the gene encoding MltB. A further role for lytic transglycosylases in disease may be associated with their reaction products. The 1,6- anhydrodisaccharide-containing metabolites, such as those shown here to be produced by meningococcal MltA, have been shown to have diverse biological activities. For instance, the cytopathology of respiratory epithelium that is characteristic of Bordetella pertussis infection is caused by 1,6-anhydromuramic acid-contain- ing products [30]. The same compounds are also capable of inducing sleep and arthritis [31,32]. Perhaps most importantly is the potential of 1,6-anhydromuramyl peptides to induce meningeal inflammation [33]. Hence lytic transglycosylases such as MltA may be directly involved in the pathogenesis associated with meningoc- cocal infection. The potential that lytic transglycosylases offer as targets for disease intervention combined with their importance in growth, septation, recycling of peptidoglycan, and pore formation makes them worthy of further investigation. ACKNOWLEDGEMENTS We would like to thank Vega Masignani and Maria Scarselli for sequence comparisons and database searches, and Mariagrazia Pizza for many helpful discussions. We are also grateful to Giorgio Corsi for preparing the figures and to Catherine Mallia for formatting and submitting the manuscript. REFERENCES 1. Pizza, M., Scarlato, V., Masignani, V., Giuliani, M.M., Arico, B., Comanducci, M., Jennings, G.T., Baldi, L., Bartolini, E., Capecchi, B. et al. (2000) Identification of vaccine candidates against serogroup B meningococcus by whole-genome sequencing. Science 287, 1816–1820. 2. Tettelin, H., Saunders, N.J., Heidelberg, J., Jeffries, A.C., Nelson, K.E.,Eisen,J.A.et al. (2000) Complete genome sequence of Neisseria meningitidis serogroup B strain MC58. Science 287, 1809–1815. 3. Granoff, D.M., Moe, G.R., Giuliani, M.M., Adu-Bobie, J., Santini, L., Brunelli, B., Piccinetti, F., Zuno-Mitchell, P., Lee, S.S., Neri, P. et al. (2001) A novel mimetic antigen eliciting protective antibody to Neisseria meningitidis. J. Immunol. 167, 6487–6496. 4. Hayashi, S. & Wu, H.C. (1990) Lipoproteins in bacteria. J. Bioenerg. Biomemb. 22, 451–469. 5. Betzner, A.S. & Keck, W. (1989) Molecular cloning, over- expression and mapping of the slt gene encoding the soluble lytic transglycosylase of Escherichia coli. Mol. Gen. Genet. 219, 489–491. 6. Dijkstra, A.J., Hermann, F. & Keck, W. (1995) Cloning and con- trolled overexpression of the gene encoding the 35 kDa soluble lytic transglycosylase from Escherichia coli. FEBS Lett. 366, 115–118. 7. Dijkstra, A.J. & Keck, W. (1996) Identification of new members of the lytic transglycosylase family in Haemophilus influenzae and Escherichia coli. Microb. Drug Resist. 2, 141–145. 8. Ehlert, K., Holtje, J V. & Templin, M.F. (1995) Cloning and expression of a murein hydrolase lipoprotein from Escherichia coli. Mol. Microbiol. 16, 761–768. 9. Lommatzsch, J., Templin, M.F., Kraft, A.R., Vollmer, W. & Holtje, J V. (1997) Outer membrane localization of murein hydrolases: MltA, a third lipoprotein lytic transglycosylase in Escherichia coli. J. Bacteriol. 179, 5465–5470. 10. Holtje, J V. (1998) Growth of the stress-bearing and shape- maintaining murein sacculus of Escherichia coli. Microbiol. Mol. Biol. Rev. 62, 181–203. 11. Holtje, J V. & Tuomanen, E.I. (1991) The murein hydrolases of Escherichia coli: properties, functions and impact on the course of infections in vivo. J. Gen. Microbiol. 137, 441–454. 12. vonRechenberg, M., Ursinus, A. & Holtje, J V., (1996) Affinity chromatography as a means to study multienzyme complexes involved in murein synthesis. Microb. Drug Resist. 2, 155–157. 13. Romeis, T. & Holtje, J V. (1994) Specific interaction of penicillin- binding proteins 3 and 7/8 with soluble lytic transglycosylase in Escherichia coli. J. Biol. Chem. 269, 21603–21607. 14. Vollmer, W., von Rechenberg, M. & Holtje, J V. (1999) Demonstration of molecular interactions between the murein polymerase PBP1B, the lytic transglycosylase MltA, and the scaffolding protein MipA of Escherichia coli. J. Biol. Chem. 274, 6726–6734. 15. Sambrook, J., Fritsch, E.F. & Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual, 2nd edn. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. 16. Laemmli, U.K. & Favre, M. (1973) Maturation of the head of bacteriophage T4. I. DNA packaging events. J. Mol. Biol. 80,575– 599. 17. Kraft, A.R., Templin, M.F. & Holtje, J V. (1998) Membrane- bound lytic endotransglycosylase in Escherichia coli. J. Bacteriol. 180, 3441–3447. 3730 G. T. Jennings et al.(Eur. J. Biochem. 269) Ó FEBS 2002 18. Ursinus, A. & Holtje, J V. (1994) Purification and properties of a membrane-bound lytic transglycosylase from Escherichia coli. J. Bacteriol. 176, 338–343. 19. Harz, H., Burgdorf, K. & Holtje, J V. (1990) Isolation and separation of the glycan strands from murein of Escherichia coli by reversed-phase high-performance liquid chromatography. Anal. Biochem. 190, 120–128. 20. Glauner, B. (1988) Separation and quantification of muropeptides with high-performance liquid chromatography. Anal. Biochem. 17, 451–464. 21. Schwarz, U., Seeger, K., Wengenmayer, F. & Strecker, H. (1981) Penicillin-binding proteins of Eschericia coli identified with a 125 I-labelled derivative of ampicillin. FEMS Microbiol. Lett. 10, 107–109. 22. Romeis, T., Vollmer, W. & Holtje, J.V. (1993) Characterization of three different lytic transglycosylases in Escherichia coli. FEMS Microbiol. Lett. 111, 141–146. 23. Dougherty, T.J., Kennedy, K., Kessler, R.E. & Pucci, M.E. (1996) Direct quantitation of the number of individual penicillin- binding proteins per cell in Escherichia coli. J. Bacteriol. 178, 6110– 6115. 24. Spratt, B.G. (1977) Properties of the penicillin-binding proteins of Escherichia coli K12. Eur. J. Biochem. 72, 341–352. 25. Ropp, P.A. & Nicholas, R.A. (1997) Cloning and characterization of the ponA gene encoding penicillin-binding protein 1 from Neisseria gonorrhoeae and Neisseria meningitidis. J. Bacteriol. 179, 2783–2787. 26. Zhang, Q.Y. & Spratt, B.G. (1989) Nucleotide sequence of the penicillin-binding protein 2 gene of Neisseria meningitides. Nucleic Acids Res. 17, 5383. 27. Park, J.T. & Burman, L. (1973) FL-1060: a new penicillin with a unique mode of action. Biochem. Biophys. Res. Commun. 51, 863–868. 28. Schmidt, L.S., Botta, G. & Park, J.T. (1981) Effects of furazlocillin, a beta-lactam antibiotic which binds selectively to penicillin-binding protein 3, on Escherichia coli mutants deficient in other penicillin-binding proteins. J. Bacteriol. 145, 632–637. 29. Sun, Y.H., Bakshi, S., Chalmers, R. & Tang, C.M. (2000) Func- tional genomics of Neisseria meningitidis pathogenesis. Nat. Med. 6, 1269–1273. 30. Cookson, B.T., Tyler, A.N. & Goldman, W.E. (1989) Primary structure of the peptidoglycan-derived tracheal cytotoxin of Bor- detella pertussis. Biochemistry 28, 1744–1749. 31. Krueger, J.M., Pappenheimer, J.R. & Karnovsky, M.L. (1982) Sleep-promoting effects of muramyl peptides. Proc. Natl. Acad. Sci. USA 79, 6102–6106. 32. Fleming, T.J., Wallsmith, D.E. & Rosenthal, R.S. (1986) Arthropathic properties of gonococcal peptidoglycan fragments: implications for the pathogenesis of disseminated gonococcal disease. Infect. Immun. 52, 600–608. 33. Tuomanen, E., Hengstler, B., Zak, O. & Tomasz, A. (1986) Induction of meningeal inflammation by diverse bacterial cell walls. Eur. J. Clin. Microbiol. 5, 682–684. Ó FEBS 2002 MltA from N. meningitidis serogroup B (Eur. J. Biochem. 269) 3731 . GNA33 from Neisseria meningitidis serogroup B encodes a membrane-bound lytic transglycosylase (MltA) Gary T. Jennings 1 *, Silvana Savino 1 *, Elisa Marchetti 1 , Beatrice Arico ` 1 , Thomas. with each other. Lytic transglycosylases are a unique class of lysozyme-like enzymes that catalyze cleavage of the b- 1,4-glycosidic bond between N-acetylmuramic acid (MurNAc) and N-acetyl glucosamine. their ability to cleave the polysaccharide backbone of the peptidoglycan layer, lytic transglycosylases are thought to play a role in synthesis and degradation of the murein sacculus. It has been