Báo cáo Y học: The trans-sialidase from the African trypanosome Trypanosoma brucei potx

The trans -sialidase from the African trypanosome Trypanosoma brucei Georgina Montagna 1 , M. Laura Cremona 1 , Gasto ´ n Paris 1 , M. Fernanda Amaya 2 , Alejandro Buschiazzo 2 , Pedro M. Alzari 2 and Alberto C. C. Frasch 1 1 Instituto de Investigaciones Biotecnolo ´ gicas – Instituto Tecnolo ´ gico de Chascomu ´ s, Consejo Nacional de Investigaciones Cientı ´ ficas y Te ´ cnicas, Universidad Nacional de General San Martı ´ n, Provincia de Buenos Aires, Argentina; 2 Unite ´ de Biochimie Structurale, CNRS URA 2185, Institut Pasteur, Paris, France Trypanosoma brucei is the cause of the diseases known as sleeping sickness in humans (T. brucei ssp. gambiense and ssp. rhodesiense) and ngana in domestic animals (T. brucei brucei) in Africa. Procyclic trypomastigotes, the tsetse vector stage, express a surface-bound trans-sialidase that transfers sialic acid to the glycosylphosphatidylinositol anchor of procyclin, a surface glycoprotein covering the parasite sur- face. Trans-sialidase is a unique enzyme expressed by a few trypanosomatids that allows them to scavenge sialic acid from sialylated compounds present in the infected host. The only enzyme extensively characterized is that of the Ameri- can trypanosome T. cruzi (TcTS). In this work we identified and characterized the gene encoding the trans-sialidase from T. brucei brucei (TbTS). TbTS genes are present at a small copy number, at variance with American trypanosomes where a large gene family is present. The recombinant TbTS protein has both sialidase and trans-sialidase activity, but it is about 10 times more efficient in transferring than in hydro- lysing sialic acid. Its N-terminus contains a region of 372 amino acids that is 45% identical to the catalytic domain of TcTS and contains the relevant residues required for cata- lysis. The enzymatic activity of mutants at key positions involved in the transfer reaction revealed that the catalytic sites of TcTS and TbTS are likely to be similar, but are not identical. As in the case of TcTS and TrSA, the substitution of a conserved tryptophanyl residue changed the substrate specificity rendering a mutant protein capable of hydrolysing both a-(2,3) and a-(2,6)-linked sialoconjugates. Keywords: trans-sialidase; sialidase; T. brucei; procyclic trypomastigotes. African trypanosomiasis has re-emerged as a major health threat, with an epidemic resulting in more than 100 000 new infections per year. With 300 000 cases officially reported, human trypanosomiasis, or sleeping sickness caused by Trypanosoma brucei ssp. gambiense and ssp. rhodesiense,has now returned to the epidemic levels of the 1930s in many historic foci across Africa. T. brucei ssp. brucei causes the Ôngana diseaseÕ in domestic animals, which can reduce food production as much as 50%. The parasite, which lives and multiplies in the blood of the infected host, eludes the immune system by consecutively expressing structurally different forms of variant surface glycoproteins (VSG) [1]. The VSG coat from the bloodstream form is replaced by the invariant procyclin surface coat of the procyclic insect stage when entering the tsetse insect vector (Glossina sp.) These procyclins are a small family of very similar acid repetitive proteins [2,3] that might protect procyclic cells from digestion by the digestive enzymes in the fly [4]. Unable to synthesize sialic acids, trypanosomes use a specific enzyme, the trans-sialidase, to scavenge the mono- saccharide from host glycoconjugates and to sialylate acceptor molecules present on the surface of parasite plasma membrane [5]. Indeed, the presence of trans-sialidase activity is unique to a few trypanosomes, being absent in all other cell types tested so far. Trans-sialidase is a modified sialidase that instead of hydrolysing sialic acid, transfers the monosaccharide to another sugar moiety. The only trans- sialidase extensively studied is the one from Trypanosoma cruzi (TcTS). The enzyme is involved in sequestering sialic acid from sialoglycoconjugates present in the blood and other tissues in the infected vertebrate host. The sialic acid is transferred to terminal galactoses present in mucins, highly O-glycosylated proteins that cover the parasite surface [5]. Sialylated mucins have been suggested to be involved in invasion of the mammalian host cells and in protection against complement lysis [6–8]. In T. cruzi and T. rangeli (arelatedAmericanparasite which only displays sialidase activity), trypanosomal sialidases are encoded by a multigenic family [9,10]. In T. cruzi, there are about 140 genes, half of them encoding proteins that display enzymatic activity. The other mem- bers code for proteins lacking activity due to a mutation Correspondence to Instituto de Investigaciones Biotecnolo ´ gicas, Universidad Nacional de General San Martı ´ n, INTI, Avemida. Gral Paz s/n, Edificio 24, Casilla de Correo 30, 1650 San Martı ´ n, Pcia de Buenos Aires, Argentina. Fax: + 54 11 4752 9639, Tel.: + 54 11 4580 7255, E-mail: cfrasch@iib.unsam.edu.ar Abbreviations:TrSA,T. rangeli sialidase; TcTS, T. cruzi trans-sialidase; TbTS, T. brucei trans-sialidase; VSG, variant surface glycoproteins; IMAC, iminodiacetic acid metal affinity chromatography; MUNen5Ac, 2¢-(4-methylum- belliferyl)-a- D -N-acetylneuraminic acid; 3¢SL, sialyl-a-(2,3)-lactose; 6¢SL, sialyl-a-(2,6)-lactose; GSS, Genome Sequence Survey. (Received 10 January 2002, revised 26 April 2002, accepted 30 April 2001) Eur. J. Biochem. 269, 2941–2950 (2002) Ó FEBS 2002 doi:10.1046/j.1432-1033.2002.02968.x Y342H [11]. The overall structure of the TcTS comprises an N-terminal globular region of 642 amino acids carrying the catalytic activity (see below), followed by a C-terminal extension of tandemly repeated sequences named SAPA (shed acute phase antigen) that are not required for the enzymatic activity. SAPA is highly antigenic and is involved in the stabilization of the enzymatic activity once released in the blood of the infected host [12]. Members in the sialidase family of T. rangeli (TrSA) are about 70% identicaltoTcTS[13],andsomeofthemalsolack enzymatic activity. The crystal structures of several microbial sialidases have been determined. They share a similar catalytic domain that displays a typical six-bladed b propeller topology originally observed in influenza virus sialidase [14]. Some sialidases are multidomain proteins and include one or more noncatalytic domains, which may be involved in carbohydrate recognition, as for the enzymes from Vibrio cholerae [15] and Micromonospora viridifaciens [16]. The three-dimensional structure of TrSA [17] showed that trypanosomal enzymes fold into two distinct structural domains: the b propeller catalytic domain and a tightly associated C-terminal domain with the characteristic b barrel topology of plant lectins. These crystallographic studies also showed that they share a similar active site architecture, where several amino-acid residues critical for enzyme function, are strictly conserved. In T. cruzi and T. rangeli, a conserved tryptophan residue (W313) was recently shown to be implicated in the binding of the substrate and to be determinant for the specificity for a-(2,3) linkages [18]. Other residues in the surrounding of the active site differ when the structures of sialidase and trans-sialidase are compared. In particular, two residues from TcTS, Y119 and P284, were found to be critical for the transfer reaction and were proposed to modulate the substrate-binding cleft, providing trans-sialidase with the capacity for transferring the monosaccharide. We report here the first gene coding for a trans-sialidase belonging to African trypanosomes. The deduced trans- sialidase protein sequence is only 38% similar to the trans- sialidase of T. cruzi, but conserves all the amino-acid residues that are relevant for the enzymatic activity. Single point mutation at critical positions, revealed distinct features between trans-sialidase active sites in American and African trypanosomes. EXPERIMENTAL PROCEDURES Trypanosomes Procyclic forms of T. brucei brucei stock EATRO427 were cultivated axenically in SDM-79 as described previously [19]. The strain was kindly provided by F. R. Opperdoes (Christian de Duve Institute of Cellular Pathology, Brussels, Belgium). Nucleic acid isolation Total DNA from culture procyclic forms was isolated using a conventional proteinase K/phenol/chloroform method as described previously [20]. Total RNA was purified using TRIzol reagent following manufacturer’s instructions (Life Technologies Inc.). Southern blot analysis Total DNA was digested with the indicated restriction enzymes and 2.5 lg of the sample per line was electro- phoresed in 0.8% agarose gel and transferred for Southern blot on Zeta-Probe nylon membranes (Bio-Rad) as des- cribed previously [20]. PCR radiolabeling of probes was performed by substi- tuting the nonradioactive dCTP by 30 lCi of [a- 32 P]dCTP in a 30-cycle primer extension reaction after optimization of thetemplateandMgCl 2 concentration. The TbTS probe was made with oligonucleotide FRIP (5¢-ATAAGG TAGAGCGCACTGTGCA-3¢) using clone TbTS digested with EcoRV as template. Probe TbTS-like was made from clone pGEM-TbTS-like using oligonucleotide (5¢-CTT GCTAGCCTCTGCAGCCGACAT-3¢). The filters were hybridized with the probes described using hybridization solution containing 0.5 M NaH 2 PO 4 ,7%SDS,1m M EDTA and 1% BSA, at 62 °C. Cloning of trans -sialidase genes PCR was carried out using Vent DNA Polymerase (New England Biolabs) on 100 ng of parasite DNA. PCR primers contained restriction enzymes sites to facilitate the subsequent cloning steps in the expression vector. For TbTS the primers were as follows: AminoMet (5¢-AT GGAGGAACTCCACCAACAAAT-3¢, forward) and STOP (5¢-TAT AGATCTTCAAATCGCCAACACATA CAT-3¢, reverse, underlined is the BglII restriction site). For TbTS-like: TbTSIIamino (5¢-CTT GCTAGCATG CGCGTTGTATACCAG-3¢, forward, underlined is the NheI restriction site) and TbTSIIStop (5¢-AG AGATCT AGAACGCGTGGTCTGC-3¢, reverse, underlined is the BglII restriction site). Primer sequences for TbTS were obtained from Genome Sequence Survey (GSS) AQ661000 for AminoMet and AQ656761 for STOP. Primers for TbTS-like were obtained from a BAC clone: AC009463, which contains the complete ORF. The PCR products were cloned on pGEM-T Easy vector following the A-tailing procedure. The clones were called pGEM-TbTS and pGEM-TbTSlike. These clones were used as template for automated (AbiPrism) or manual (dideoxy-chain termination method with Sequenase-USB) sequencing or for subcloning in the expression vector. Cloning of TbTS 5¢ UTR First strand cDNA was prepared with the Superscript II system using an internal primer (5¢-TGAAAATCAACAG CAGTCTC-3¢) that binds to position 58–40 of TbTS ORF. RT-PCR was carried out with the primers for T. brucei mini-exon as forward (5¢-AACGCTATTATTAGAACA GTTTCTGTACT-3¢) and the one used for first strand synthesis as reverse, using Vent DNA polymerase. The product was cloned into pGEM-T Easy vector after A-tailing and sequenced using the dideoxy-chain termin- ation method with Sequenase (USB). Site-directed mutagenesis Site directed point mutagenesis was performed using the QuikChange Site-directed mutagenesis kit (Stratagene), 2942 G. Montagna et al. (Eur. J. Biochem. 269) Ó FEBS 2002 according to the manufacturer’s instructions. All clones were sequenced to confirm mutation of target sites. Expression of trans -sialidase genes in bacteria and protein purification The plasmid containing the complete ORF of the TbTS (pGEM-TbTS) was cut with EcoRI and the DNA fragment corresponding to TbTS gene was ligated into the expression vector pTrcHisC (Invitrogen). The His-tag encoded in the plasmid vector was used to purify the recombinant protein. A TbTS construct starting at the codon for leucine 28 was obtained by PCR on the pGEM-TbTS plasmid using the followings primers: LTSK (5¢-TAT GCTAGCTTGACT TCCAAGGCTGCGG-3¢, forward, underlined is the NheI restriction site) and STOP (see above). After digestion with the corresponding restriction enzymes, the fragment was ligated to pTrcHisC vector. A similar procedure was carried out for TbTS-like gene, but the PCR reaction was performed using pGEM-TbTS-like as template and the followings primers: TbTSIILCS (5¢-CTT GCTAGCCTC TGCAGCCGACAT-3¢, forward, underlined is the NheI restriction site) and TbTSIIcarboxi (5¢-TAG AGATCTTA CATAAATAGGGAATA-3¢, reverse, underlined is the BglII restriction site). The constructs were introduced in E. coli BL21 (DE3) pLysS cells by the calcium chloride method. Overnight cultures were diluted 1 : 50 in Terrific Broth and grown at 37 °CuptoD 600 0.8–1.0, with constant agitation at 250 r.p.m. Bacteria were induced to over express recombinant protein by adding 0.5 m M isopropyl thio-b- D -galactoside (Sigma) and induction was maintained at 18 °C for 12–16 h. Cells were harvested, washed with NaCl/Tris (20 m M Tris/HCl pH 7.6 and 50 m M NaCl) and frozen ()80 °C) until needed. After thawing, lysis was carried out in the presence of 20 m M Tris/HCl pH 7.6, 30 m M NaCl,0.5%TritonX-100,1m M phenyl- methylsulfonyl fluoride, 100 lgÆmL )1 DNAse I. Superna- tants were centrifuged at 21 000 g for 30 min and subjected to iminodiacetic acid metal affinity chromatography (IMAC) (HiTrap Chelating, Amersham Pharmacia Biotech AB) Ni 2+ -charged equilibrated in 20 m M Pipes pH 6.9 and 0.5 M NaCl (buffer IMAC). The column was washed with 30 m M imidazole in buffer IMAC. Elution was achieved using a linear gradient 30–250 m M imidazole in buffer IMAC. The activity peak was pooled, dialyzed against 20 m M Bistris pH 7.4 and further purified by FPLC anion exchange (Mono Q) equilibrated with the same buffer. The protein was eluted by applying a linear gradient of 0–250 m M trisodium citrate. Purified proteins were analysed by SDS/PAGE under reducing conditions, stained with Coomasie Blue R250, and quantitated with Kodak 1 D 3.0 software using purified BSA as standard. Enzyme activity assays Enzyme activity assays were carried out using the purified proteins as described in the previous section. Neuraminidase activity was determined by measuring the fluorescence of 4-methylumbelliferone released by the hydrolysis of 0.2 m M 2¢-(4-methylumbelliferyl)-a- D -N-acetylneuraminic acid (MUNen5Ac, Sigma). The assay was performed in 50 lLin20m M Pipes pH 6.9. After incubation at 35 °C, the reaction was stopped by dilution in 0.2 M sodium carbonate pH 10, and fluorescence was measured with a DYNAQuant TM 200 fluorometer (Hoefer Pharmacia Inc). Trans-sialidase activity was measured in 20 m M Pipes pH 6.9, using 1 m M Neu5Ac-a-(2–3) lactose as sialic acid donor and 12 l M [ D -glucose-1- 14 C]lactose (55 mCiÆmmol )1 ) (Amersham) as acceptor, in 30 lL final volume at 35 °C. The reaction was stopped by dilution, and sialyl-[ 14 C]lactose was quantitated with a b-scintillation counter as described previously [21]. Suitable modifications were made to the standard reaction to obtain the kinetic constants. MUNen5Ac is an unspecific substrate and it does not allow a distinction between hydrolysis of a-(2,3)- and a-(2,6)- linked sialic acid. Therefore, in order to determine the substrate specificity of wild-type and mutant proteins, sialidase activity was measured using sialyl-a-(2,3)-lactose (3¢SL) or sialyl-a-(2,6)-lactose (6¢SL) as substrates. Quanti- tation of 3¢SL and 6¢SL hydrolysis was carried out by the thiobarbituric method [22]. Predefined quantities of wild- type or mutant proteins were incubated with 0.5 m M of either 3¢SL or 6¢SL and 50 m M Hepes pH 7.0, in a final volume of 20 lLfor30minat35°C. The enzymatic reactions were stopped by adding 15 lLof25m M NaIO 4 solution prepared in 125 m M sulfuric acid solution. The mixtures were vortexed and allowed to react in a water bath at 37 °C for 30 min. Samples were then neutralized with 13 lL of sodium arsenite 2% w/v in HCl (0.5 N) by slow addition of the reactive. Tubes were gently vortexed to complete the reduction reaction. After the total disappear- ance of yellow colour (5 min) 152 lL of thiobarbituric acid (36 m M , pH 9.0) were added and then incubated in a boiling water bath for 15 min Samples were then cooled in an ice- water bath for 5 min, followed by room-temperature colour stabilization. The samples were centrifuged, and 20 lLwere separated by high-performance liquid chromatography through a C 18 reverse phase column (Pharmacia Biotech) using 2 : 3 : 5 water/methanol/buffer (buffer: 0.2% phos- phoric acid; 0.23 M sodium perchlorate). Absorbance was measured at 549 nm. A sialic acid calibration curve was previously set, and absorbance values were always read in the linear range. RESULTS The T. brucei trans -sialidase primary sequence conserves most of the structurally relevant amino-acid residues of bacterial and protozoan sialidases BLAST searches were performed using sequences corres- ponding to the catalytic domain of TcTS (L26499, a member of family I of T. cruzi trans-sialidase/sialidase superfamily [23]) on the T. brucei Genome Project Database (Sanger Centre). The search identified six GSSs with a BLAST E value between 2.6 · 10 )36 and 0.73. When assembled, these fragments built up an open reading frame of 2316 bp. Because various sialidase amino-acid motifs such as FRIP and Asp box motifs were conserved in the deduced sequence, this open reading frame might code for a T. brucei sialidase-related protein. These data were used to design oligonucleotides for the amplification by PCR on genomic DNA to clone the gene coding for the complete TbTS. Eleven genes from independent PCRs were sequenced and organized into eight different groups according to their nucleotide sequence (Fig. 1). The differences among genes Ó FEBS 2002 The trans-sialidase of African trypanosomes (Eur. J. Biochem. 269) 2943 seem not to be randomly distributed, but rather, localized at nine positions. Combinations of mutations at these nine positions generated eight genes having from one to five differences. Five out of the nine differences are in the first and second codon positions, giving rise to a high proportion of nonconservative mutations. Most of the differences (seven out of nine) are located in the catalytic domain (see below), but they are placed at positions irrelevant for the enzymatic activity because the corresponding recombinant proteins displayed both sialidase and trans-sialidase activity (see next section). The deduced primary structure of the protein coded by these genes showed that TbTS is organized into three putative regions (Fig. 2). An N-terminal region of 100 amino acids, which is absent in TcTS, a middle region of 372 amino acids, which is 45% identical to the catalytic domain of the T. cruzi enzyme and a C-terminal region of 298 amino acids followed by an hydrophobic region likely to correspond to a GPI-anchor signal. TbTS is probably anchored by GPI to the surface membrane since native procyclic trans-sialidase can be released from the parasite by treatment with phospholipase D [24]. The 298 amino acids in the C-terminal domain are 30% identical to the TcTS lectin-like domain. TbTS does not have a repetitive domain at the C-terminus that is homologous to the T. cruzi SAPA domain. The catalytic region revealed the conservation of most of the structurally relevant residues displayed in bacterial and protozoan sialidases and trans-sialidases (Fig. 2), such as an arginine triad that binds to the carboxylate group common to all the sialic acid derivatives (R133, R346, R431), a glutamic acid (E473) that stabilizes one of the arginine side chains, a negatively charged group (D157) proposed as a possible proton donor in the hydrolytic reaction and two essential residues at the bottom of the site (E331, Y457), which are well positioned to stabilize a putative sialosyl cation intermediate [25]. This tyrosine residue was found to be a determinant for the catalytic activity of TcTS [11] The comparison of the crystal structure of TrSA with the homologous model of TcTS reveals a few amino acid changes close to the substrate-binding cleft that might modulate the sialyltransferase activity [17]. Most of these critical substitutions observed at the periphery of the cleft in TcTS are conserved in the deduced primary sequence of TbTS, including an aromatic residue (Y120 in TcTS) that was found to have a crucial role in the transfer reaction [17]. TbTS also conserves an exposed aromatic side chain (W400) that favours, in the case of microbial sialidases and trans- sialidases, the high specificity for sialyl-a-(2,3) substrates [18]. The TbTS genes present partially conserved the subterminal VTVxNVfLYNR motif (VIVRNVLLYHR in T. brucei) that in the case of T. cruzi, defines the trypanosome trans-sialidase/sialidase superfamily of surface proteins [26]. It has been recently shown that this sequence is involved in host cell binding during T. cruzi infection process [27]. Expression and properties of T. brucei recombinant trans-sialidase The entire ORF starting at the codon for the first methionine was identified by sequencing the 5¢ UTR of TbTS mRNA. A construct expressed from the codon for this first methionine produced a protein of approximately 84.4 kDa that lacked sialidase and trans-sialidase activities (data not shown). An analysis of the putative start of the mature protein N-terminus using the IPSORT program (Human Genome Center, Institute of Medical Sciences, University of Tokio), predicted the existence of a signal peptide that ends just before leucine 28. The insert was then designed to have this amino acid at position +1. The new construct, which includes an N-terminal extension of 10 amino acids expressing a His-tag, codes for a 745 amino- acidproteinwithapredictedmolecularmassof81.4kDa and displaying both sialidase and trans-sialidase activity (data not shown). All further work was performed with this protein. To perform kinetic studies, the protein was purified Fig. 2. Comparison of protein structure and sequence between TbTS and TcTS. (A) Primary structure of TbTS and TcTS. The positions of the FRIP, Asp boxes and TcTS superfamily motifs are underlined. (B) Amino-acid sequence of the conserved region of the catalytic do- main of TbTS and TcTS. The FRIP and the Asp boxes are underlined. The identity in amino acids between the two primary sequences are indicated with vertical bars and the boxes highlight the residues involved in the catalytic centre of the sialidases of known crystal structure. Fig. 1. Differences among TbTS clones. Eleven clones of TbTS were sequenced and analysed. They could be classified in eight distinct groups with differences in only nine positions. The nucleotide changes in the triplet sequence are indicated (uppercase). The mutations that cause amino-acid changes are boxed. 2944 G. Montagna et al. (Eur. J. Biochem. 269) Ó FEBS 2002 through passage on a iminodiacetic acid metal affinity column followed by FPLC anionic exchange (see Experi- mental procedures for details). After the anionic exchange column, the protein was > 95% pure (Fig. 3). MUNen5Ac was used as substrate to assay for sialidase activity, and a mix of Neu5Ac-a-(2,3) and Neu5Ac-a-(2,6)-lactose as sialic acid donor and lactose as acceptor for the trans-sialidase activity (Fig. 3). The affinity for sialyl-lactose as substrate of TbTS (2.27 m M ) and TcTS (4.3 m M ) were similar, as it was the turnover of both enzymes (apparent V max for sialyl-lactose is 51 161 nmolÆmin )1 Æmg )1 for TbTS and 32 692 nmolÆmin )1 Æmg )1 ) for TcTS (Fig. 3; [18]). As in the case of T. cruzi trans-sialidase [18], TbTS behaves as a very efficient sialyl-transferase: in excess of both the donor and acceptor substrates, the enzyme is 11.1 times more efficient in transferring than hydrolysing donor sialic acid, as can be concluded by comparing the V max of the hydrolysis and transference activities (Fig. 3). We have also measured the trans-sialidase-sialidase activity ratio in the native T. brucei brucei enzyme from procyclic forms, as described under Experimental procedures. This ratio was 8.9. Thus, there is a good agreement between values obtained with the recom- binant and native enzymes. Point mutations at critical amino-acid residues revealed features of the catalytic site of African trypanosomes trans -sialidase Based on the crystal structure of TrSA [17], mutants of TbTS at key positions involved in substrate binding and specificity were constructed and characterized. These mutants include (see Fig. 4A) the exposed aromatic side chain that favours the sialyl-a-(2,3) substrate specificity (W400 in TbTS mature protein), a tyrosine residue sugges- ted to be part of a second carbohydrate-binding site in the catalytic cleft (Y191 in TbTS), a proline residue that was found to increase the sialidase activity in TrSA (P371 in TbTS) and a tyrosine residue that is well positioned to stabilize a putative sialosyl cation intermediate (Y430 in TbTS) [17]. The mutant proteins were produced and purified with the same criteria described for the wild-type in the previous section. As shown in Fig. 4B, mutations at positions 371 and 430 of TbTS completely abolished both sialidase and II AB I 1/v (nmol sialic acid -1 .min.mg) x 10 -3 1/S (mM -1 ) 5.0 4.0 3.0 2.0 1.0 0 510152025 Km: 1.2mM Vmax: 4582 nmol. min -1 .mg -1 2.5 2.0 1.5 1.0 0.5 0 2.0 4.0 6.0 1/v (nmol sialic acid -1 .min.mg) × 10 -3 1/S (mM -1 ) Km: 2.27 mM Vmax: 51161 nmol. min -1 .mg -1 78 0 10 20 Elution (mL) 250 0 Citrate (mM) kDa 78 91011 66 97.4 45 Absorbance 280 nm 91011 Fractions Fractions Fig. 3. Purification of recombinant TbTS pro- tein. (A) TbTS protein was purified by anion- exchange chromatography (Mono Q) after IMAC chelating column. The elution profile of Mono Q is shown. Fractions were collected and analysed by SDS/PAGE as indicated in Experimental procedures. (B) Lineweaver– Burk plots of sialidase and trans-sialidase activities. I, the sialidase activity was measured varying the concentrations of MUNen5Ac as sialic acid donor (see Experimental proce- dures). II, the trans-sialidase activity was measured using sialyl-a-(2,3)-lactose and lac- tose as the sialic acid donor and acceptor substrates, respectively. The apparent con- stants were obtained using lactose fixed con- centration of 2 m M and varying the concentration of the sialyl lactose according to the experiment. Data are the mean of three independent experiments. Catalytic domain Lectin-like domain TcTS TbTS 1 642 119 283 312 342 YTWY 372 1 73 743 191 Y 371 400 430 TWY 461 TbTS wild type 8074.33 ± 691.52 (100) 100 933.8 ± 60.78 (100) 100 TbTS Y430-H 0000 TbTS T371-Q 0000 TbTS Y191-S 0 0.6 0 12.8 TbTS W400-A 00 0104.29 ± 8.3 (11.2) trans-sialidase activity TcTS a b TcTSsialidase activity A B Fig. 4. Site-directed mutagenesis on TbTS. (A) Relative positions of the site-directed mutagenesis on TbTS refer to the relevant amino acids for trans-sialidase activity on TcTS. (B) Recombinant proteins were expressed and purified as indicated in Experimental procedures. Sialidase activity was measured using MUNen5Ac as substrate and trans-sialidase activity was measured using sialyl-a-(2,3)-lactose and lactose as the sialic acid donor and acceptor, respectively. Activities are expressed as nmol sialic acid per min per mg (free sialic acid for sia- lidase activity; amount of sialic acid transferred to lactose for trans- sialidase acitivity). The percentage of activity referred to wild-type controls is indicated in parenthesis. The values are the mean and standard deviation of three independent determinations. The per- centage of trans-sialidase ( a ) and sialidase ( b ) activity of TcTS referred to wild-type controls. Ó FEBS 2002 The trans-sialidase of African trypanosomes (Eur. J. Biochem. 269) 2945 trans-sialidase activities, as in TcTS. The change of the aromatic side chain (W400 A) that in the case of TrSA and TcTS lost the capability of hydrolysing MUNen5Ac [18], retained 11.6% of the sialidase activity when MUNen5Ac is used as substrate (Fig. 4B). The mutation at Y191S suppressed both activities, at variance with the American trypanosome trans-sialidase, where the substitution of Y120 practically abolishes the sialyltransferase activity while preserving some of the sialidase activity [17,18]. The differences observed in the effect of the mutations at these positions could arise from distinct organizations of the catalytic sites of both trans-sialidases. The trans-sialylation activity of TbTS W400A was lost as in TcTS W312A mutant (Fig. 4 and [18]), thus indicating that the transfer, but not the hydrolysis reaction requires a precise orientation of the bound substrate in both enzymes. The exposed tryptophan residue in TcTS and TrSA determined the high specificity of these enzymes towards sialyl-a-(2,3) substrates [18], which could be explained by unfavourable interactions of this aromatic side-chain with sialyl-a-(2,6)-linked oligosaccharides. To test if this is also the case of TbTS, the mutant protein W400A was obtained and assayed for activity using sialyl-a-(2,3)-lactose (3¢SL) and sialyl-a-(2,6)-lactose (6¢SL). The mutated enzyme was now capable of hydrolysing the a-(2,6) regioisomer, losing the strict specificity of the wild-type enzyme for the sialyl- a-(2,3) substrate (Fig. 5). The active sites of the T. brucei and T. cruzi trans -sialidases are highly conserved As expected from their similar function and common evolutionary origin, critical active site residues are largely conserved in all trypanosomal sialidases and trans-siali- dases. The 3D structure of the T. rangeli sialidase bound to 2,3-didehydro-2-deoxy-N-acetylneuraminic acid (Neu2- en5Ac, a sialidase inhibitor) [17] showed 33 amino acids that are positioned close to the inhibitor. They have at least one atom at less than 7 A ˚ from Neu2en5Ac. Among these positions, 26 amino acids (79%) are conserved between TcTS and TbTS, 24 (73%) are conserved between TbTS and TrSA, and 22 (67%) are conserved between TcTS and TrSA. These relative similarities differ significantly from those found when comparing the entire catalytic domains (Fig. 4), thus revealing a functional constraint on the evolution of trans-sialidases. All amino-acid residues that have been found to be important for the function in other viral and bacterial sialidases, are also conserved in the three trypanosomal enzymes(showninblueinFig.6):theargininetriad(R36, R246 and R315, TrSA numbering) that binds the carboxy- late group of sialic acid; the aspartic acid residue (D60) that could serve as the proton donor in the reaction; and two residues (E231, Y343) that probably serve to stabilize the transition state intermediate. Other amino-acid residues conserved in the active site of the three trypanosomal enzymes (but not necessarily in other sialidases) include R54 and D97, whose side chains make hydrogen bonding interactions with the bound inhibitor; W121, L(I)177 and Q196, all of which are part of the pocket that binds the N-acetyl group of sialic acid; D248 and E358, whose carboxylate groups make hydrogen bonds with two arginine side-chains of the triad; and W313 and Y365, are both favourably positioned to interact with the substrate. Of particular interest are seven positions that are invariant in the two trans-sialidases (T. brucei and T. cruzi), but differ in TrSA (shown in red in Fig. 6), suggesting that they could be important for transglycosylation activity. Two of these have been previously shown to be critical for trans- sialidase activity, namely TrSA S120 and Q284, substituted, respectively, by tyrosine and proline residues in the two trans-sialidases [17,18,28]. The presence of a tyrosine residue at position 120 was shown to be critical for TcTS activity [17], probably because this aromatic side-chain residue is involved in substrate binding. Also, the conservation of a sequence PGS at positions 284–286 of both trans-sialidases (substituted by the sequence QDC in TrSA, see Fig. 6) confirm previous findings of Smith & Eichinger [28], who studied the role of these residues using exchange mutagen- Fig. 5. Activity of 3¢SL and 6¢SL hydrolysis of the amino-acid substi- tution W400-A on TbTS. Sialidase activity of TbTS W400A mutant protein was measured using sialyl-a-(2,3)-lactose (3¢SL) and sialyl- a-(2,6)-lactose (6¢SL) as sialic acid donor substrates as described in Experimental procedures. Fig. 6. Amino-acid positions close to the inhibitor Neu2en5Ac (shown in yellow) in the crystal structure of TrSA-Neu2en5Ac complex [17]. Amino-acid side-chains shown in blue are strictly conserved in microbial sialidases, those shown in green are invariant in three trypanosomal enzymes (TrSA, TcTS and TbTS), and those shown in redareconservedinthetwotrypanosomaltrans-sialidases, but differ in TrSA, and could be important for transglycosylation (see text). 2946 G. Montagna et al. (Eur. J. Biochem. 269) Ó FEBS 2002 esis between TrSA and TcTS. Along similar lines, Paris et al. [18] demonstrated that the substitution Q284-P in TrSA increased significantly the hydrolytic activity of the enzyme. The three other positions in the neighbourhood of the active site that differ between trypanosomal sialidase and trans-sialidase are M96, F114 and V180 in TrSA, substituted by valine, tyrosine and alanine residues in the trans-sialidases, respectively (Fig. 6). Although it is difficult to assess the functional role of these substitutions in the absence of a crystal structure for trans-sialidase, they could contribute to modulation of specific protein–sialic acid interactions, which are important for the transfer reaction to occur. Genomic organization of TbTS genes Southern blot analysis of total DNA from T. brucei brucei strain probed with the catalytic region of the genes showed that TbTS genes are present in a small copy number (Fig. 7), a situation that is different from American trypanosomes where the trans-sialidase family genes comprises at least 140 members. Regarding the results obtained with enzymes that cut at least once on each gene unit (BssHII, EcoRV and HindIII, Fig. 7A, panel I), a minimum of two trans- sialidase-related genes can be estimated from the Southern blot analysis. It is likely that the TbTS genes are organized in tandem, as previous evidence from cloning and sequencing (see Fig. 1) suggested that several copies may exist. A BLAST search on the T. brucei Genome Project Database using the fragment corresponding to the putative catalytic domain of TbTS identified a BAC clone with a BLAST E value of 6 · 10 )45 that showed 30% similarity with TbTS. We decided then to analyse the presence of TS-related genes on the genome of T. brucei,becausein American trypanosomes these genes are abundantly repre- sented in the parasite genome [5]. We designed primers based on the sequence of the BAC clone and performed a PCR on genomic DNA. These PCR resulted in a gene of 2109 bp that was called TbTS-like. The deduced primary sequence showed a partial conservation of the typical sialidase motifs (FRIP and Asp box), and the absence of the residues shown to be important for activity in the three- dimensional structure of bacterial and protozoan sialidases and trans-sialidases (data not shown). Southern blot analysis with a probe corresponding to the central part of this gene (Fig. 7B) demonstrated that it is present in one copy in T. brucei (Fig. 7A, panel II). We analysed TbTS-like gene with the IPSORT program to subcloning and tested its product for enzymatic activity. As expected, the new construct coded for a protein of 703 amino acids that displayed no sialidase/trans-sialidase activity when expressed in bacteria (Fig. 7B). DISCUSSION We are describing for the first time the gene coding for an active trans-sialidase of the African trypanosome Trypan- osoma brucei brucei. Both sialidase and trans-sialidase activities are mediated by the same protein, encoded by the gene identified here. The trans-sialidase in African trypanosomes is expressed in the procyclic form, the stage of the parasite that replicates in the tsetse fly midgut. Procyclic forms are characterized by the synthesis of a surface coat composed of procyclins (otherwise known as procyclic acid repetitive protein). Each cell is covered by approximately six million procyclin molecules [29] that are attached to the surface membrane by GPI anchors [4]. It has been shown that isolated de-sialylated procyclin can be sialylated by culture-purified trans-sialidase [30]. The unusual GPI anchor of procyclin was known to contain five sialic acid molecules on its structure, but it might be sialylated in regions other than the GPI anchor, because the number of sialic acid residues is about 10 per procyclin molecule [31]. The function of procyclins is unknown, although they contribute to the establishment of strong infections in the fly vector. Parasites that have no surface procyclin because of a defect in GPI synthesis are less efficient at establishing infection in flies [32]. Impairment of this process offers a possibility for controlling vector parasitemia (see below). Extensive work has been carried out on the molecu- larbiology, biochemistry and structure of the surface EcoRI KpnI SacII BssHII EcoRV HindIII EcoRI KpnI SacII BssHII EcoRV 9.4 23.1 6.6 4.4 kpb A I II 2.3 2.0 SxDxGxTW FRIP VIVxNVLLYNR 1 100 472 770 TbTS LTIxNAMLYNR 5/5 4/5 4/5 2/5 2/5 3/5 YRSP 683 1 TbTS like B 30% similarity TbTs probe TbTs like p robe Fig. 7. Southern blot analysis of TbTS and TbTS-like. (A) Genomic DNA of T. brucei digested with the indicated restriction enzymes, hybridized with a TbTS probe (I) and TbTS-like probe (II). The filter was washed at 65 °Cin0.1 · NaCl/Cit, 0.1% SDS. As controls, maize DNA digested with EcoR1 and T. cruzi DNA digested with PstIwere used. (B) Schematic representation of primary sequence of TbTS and TbTS-like. Catalytic (open box) and lectin-like domains (shaded box) are shown. The differences in FRIP, Asp boxes and trans-sialidase superfamily motifs are also indicated. Dark bars indicate the position of the region used as probe for Southern blot analysis. Ó FEBS 2002 The trans-sialidase of African trypanosomes (Eur. J. Biochem. 269) 2947 trans-sialidase of American trypanosome T. cruzi (reviewed in [5]), the agent of Chagas’ disease. Both American and African trans-sialidases are developmentally regulated sur- face glycoproteins [24,34]. They share a number of features that are unusual for the rest of microbial sialidases, such as a neutral optimum pH (6.9 for T. brucei,7.2forT. cruzi), the independence of divalent cations, a relative resistance towards the natural sialidase inhibitor Neu2en5Ac and the same substrate specificity [24,33]. In spite of not being closely related in their overall primary structure, TbTS conserves most of the amino acids relevant for the catalytic site of American trans-sialidase. The identity increases up to 45% in the region corresponding to the catalytic domain, but TbTS contains an extra region of 100 amino acids towards its N-terminal end. In its C-terminal region, the identity falls to 30% relative to the lectin-like domain of American trans-sialidase. The trans-sialidasegeneproducts of T. cruzi and T. brucei have a significant degree of structural and biochemical similarity to the sialidases found in bacteria and viruses (Fig. 8). The comparison of inferred gene trees with species trees made by alignment of the nucleotide and predicted amino-acid sequences of sialidases and trans-sialidase suggested that the genes encoding the T. cruzi trans-sialidase of mammalian forms might be derived from genes expressed in the insect forms of the genus Trypanosoma [35]. It was recently demonstrated by analysis of DNA sequences from 62 different species of this genus that there is evidence for a common ancestor for T. cruzi and T. brucei around 100 million years ago [36], an ancestor that could have carried the primitive trans-sialidase gene. The identity in the catalytic region of the two enzymes led us to investigate whether the same architecture of the active site is likely to be shared by both enzymes. There is growing evidence suggesting the existence of distinct donor- and acceptor-binding sites to account for the sialyl-transferase activity of T. cruzi enzyme, supported by recent crystallo- graphic data of enzyme–substrate analog complexes. An inhibitor contacting residue (Y119) and a shallow depres- sion (formed by P283, Y248 and W312) are favourably positioned in the T. cruzi enzyme to be involved in binding the acceptor molecule. P284 has been shown to be one of the essential amino-acid residues for trans-sialylation, as a TrSA-TcTS chimerical molecule displaying only sialidase activity was able to trans-sialylate after mutation of Q284 to a proline residue [28]. The mutation of the homologous residue, P371Q, seems to induce the same effect on the structure of the active site of African trans-sialidase. Our previous results on the T. cruzi enzyme indicate a crucial role for Y119 in binding the acceptor carbohydrate, since the single substitution YfiS strongly affects the transfer/hydrolysis ratio towards a more efficient hydrolase, while the inverse substitution in TrSA retains a significant sialidase activity [17]. The substitution of the homologous residue in TbTS, Y191, causes a dramatic effect on this enzyme, abolishing both sialidase and trans-sialidase activ- ities. Many microbial sialidases, such as the enzymes from Vibrio cholerae and influenza virus can cleave a-(2,3), a-(2,6) and even a-(2,8)-linked sialic acid conjugates [14,37]. Both trypanosome sialidase and trans-sialidases, as well as Salmonella typhimurium (StSA) [25] and Macrobdella decora [38] sialidases, display a high specificity for a-(2,3)-linked sialic acid conjugates. We have demonstrated that a conserved tryptophan residue in American trypanosome sialidase and trans-sialidase is directly involved in the binding of sialic acid donor substrates, as the single point mutant W fi A allowed a looser accommodation of the donor substrate, broadening their substrate specificity [18]. On the other hand, a significant decrease of hydrolytic activity against the fluorogenic substrate MUNen5Ac was shown in the case of T. cruzi: hydrolysis was undetectable in the TcTS mutant. In TbTS mutant, the activity falls 10-fold relative to the activity of the wild-type towards this substrate. It has been shown recently that the lectin-like domain of a trans-sialidase-related protein is involved in host cell binding activity during the T. cruzi cell invasion process [27,39]. The binding site to cytokeratin 18 colocalizes with the trans- sialidase/sialidase superfamily motif (VTVxNVfLYNR) [27]. Because this motif is conserved in TbTS, it is possible that a cell binding activity in the lectin-like domain of TbTS could play a role in T. brucei infection in tsetse flies. Efforts to develop inhibitors based on the structure are currently being made for the trans-sialidase of American trypomastigoteTcTS procyclic form TbTS StSA SxDxGxTW FRIP Trypanosoma epimastigoteTrSA bacteria catalytic domain lectin-like domain lectin-like domain (wing-2) lectin-like domain (wing-1) VcSA 44 % 43 % 27% 23 % 31 % 33 % Fig. 8. Structural similarity between sialidases and trans-sialidases of different origins. Comparison of the primary structures of the different domains (catalytic in light grey bars, lectin-like in black bars) of sialidases and trans-sialidases from trypanosomes (TrSA, T. rangeli sialidase GenBank accession number U83180; TcTS, T. cruzi trans-sialidase, L26499; TbTS, T. brucei trans-sialidase, AF310232) and sialidases of bacterial origin (StSA, Salmonella typhimurium sialidase, M55342; VcNA, Vibrio cholerae neuraminidase, M83562). Numbers indicate the percentage of identity. The developmental stage where the proteins are present, in the case of Trypanosoma species, is indicated on the left. The consensus Asp-box sequence and FRIP motif are shown with vertical bars. 2948 G. Montagna et al. (Eur. J. Biochem. 269) Ó FEBS 2002 trypanosomes as new alternatives for chemotherapy. These compounds are needed urgently, because the available drugs are only effective in 50% of the acute infections and their usefulness for parasitological cure in chronic infections is controversial [40,41]. Since the first years of the 20th century, human and animal trypanosomiasis have been recognized as a cause of morbidity and mortality through- out sub-Saharan Africa and a major constraint on the use of livestock. There has been extensive international collabor- ation and considerable expenditure on mechanisms to control the disease and its vector [42]. Given the limited range and effectiveness of the drugs available as resistance has emerged, modulating tsetse vector infection appears to be an important strategy in reducing the incidence of this disease. Major advances being made by molecular biologi- cal and genomic research will eventually lead to the development of new approaches to control disease trans- mission by insect vectors. Although not demonstrated here, trans-sialidase might have a relevant function for the survival of T. brucei inthetsetsevector.Infact,thesame enzymatic activity has a relevant function for the survival of T. cruzi. Furthermore, the gene encoding this enzyme might have been generated millions of years ago and have been conserved, probably as a result of its important function. Further work will demonstrate if TbTS is indeed an essential enzyme for the parasite. If so, treatment of cows with a putative inhibitor could be used to prevent infection in the tsetse fly and its dissemination. A similar approach to that proposed by vaccination in Plasmodium infections, the so-called transmission blocking malaria vaccines [43]. ACKNOWLEDGEMENTS We would like to thank Graciela Gotz for revising the manuscript. This work was supported by grants from the World Bank/UNDP/WHO Special Program for Research and Training in Tropical Diseases (TDR), ECOS-SeCyT (France-Argentina), the Human Frontiers Science Program, the Institut Pasteur and the Agencia Nacional de Promocio ´ nCientı ´ fica y Tecnolo ´ gica, Argentina. The research from ACCF was supported in part by an International Research Scholars Grant from the Howard Hughes Medical Institute and a fellowship from the John Simon Guggenheim Memorial Foundation. REFERENCES 1. Borst, P. & Ulbert, S. (2001) Control of VSG gene expression sites. Mol. Biochem. Parasitol. 114, 17–27. 2. Mowatt, M.R., Wisdom, G.S. & Clayton, C.E. (1989) Variation of tandem repeats in the developmentally regulated procyclic acidic repetitive proteins of Trypanosoma brucei. Mol. Cell. Biol. 9, 1332– 1335. 3. Roditi, I., Schwarz, H., Pearson, T.W., Beecroft, R.P., Liu, M.K., Richardson, J.P., Buhring, H.J., Pleiss, J., Bulow, R., Williams, R.O.& et al. (1989) Procyclin gene expression and loss of the variant surface glycoprotein during differentiation of Trypanoso- ma brucei. J. Cell. Biol. 108, 737–746. 4. Ferguson, M.A., Murray, P., Rutherford, H. & McConville, M.J. (1993) A simple purification of procyclic acidic repetitive protein and demonstration of a sialylated glycosyl-phosphatidylinositol membrane anchor. Biochem. J. 291, 51–55. 5. Frasch, A.C. (2000) Functional diversity in the trans-sialidase and mucin families in Trypanosoma cruzi. Parasitol. Today 16, 282–286. 6. Tomlinson, S. & Raper, J. (1998) Natural immunity to trypano- somes. Parasitol. Today 14, 354–359. 7. Schenkman, S., Jiang, M.S., Hart, G.W. & Nussenzweig, V. (1991) A novel cell surface trans-sialidase of Trypanosoma cruzi generates a stage-specific epitope required for invasion of mammalian cells. Cell 65, 1117–1125. 8. Schenkman, S. & Eichinger, D. (1993) Trypanosoma cruzi trans- sialidase and cell invasion. Parasitol. Today 9, 218–225. 9. Buschiazzo,A.,Campetella,O.&Frasch,A.C.(1997)Trypano- soma rangeli sialidase: cloning, expression and similarity to T. cruzi trans-sialidase. Glycobiology 7, 1167–1173. 10. Cremona, M.L., Campetella, O., Sanchez, D.O. & Frasch, A.C. (1999) Enzymically inactive members of the trans-sialidase family from Trypanosoma cruzi display beta-galactose binding activity. Glycobiology 9, 581–587. 11. Cremona, M.L., Sanchez, D.O., Frasch, A.C. & Campetella, O. (1995) A single tyrosine differentiates active and inactive Trypa- nosoma cruzi trans-sialidases. Gene 160, 123–128. 12. Buscaglia, C.A., Alfonso, J., Campetella, O. & Frasch, A.C. (1999) Tandem amino acid repeats from Trypanosoma cruzi shed anti- gens increase the half-life of proteins in blood. Blood 93, 2025– 2032. 13. Buschiazzo, A., Cremona, M.L., Campetella, O., Frasch, A.C. & Sanchez, D.O. (1993) Sequence of a Trypanosoma rangeli gene closely related to Trypanosoma cruzi trans-sialidase. Mol. Bio- chem. Parasitol. 62, 115–116. 14. Colman, P.M., Varghese, J.N. & Laver, W.G. (1983) Structure of the catalytic and antigenic sites in influenza virus neuraminidase. Nature 303, 41–44. 15. Crennell, S., Garman, E., Laver, G., Vimr, E. & Taylor, G. (1994) Crystal structure of Vibrio cholerae neuraminidase reveals dual lectin- like domains in addition to the catalytic domain. Structure 2, 535–544. 16. Gaskell, A., Crennell, S. & Taylor, G. (1995) The three domains of a bacterial sialidase: a beta-propeller, an immunoglobulin module and a galactose-binding jelly-roll. Structure 3, 1197–1205. 17. Buschiazzo, A., Tavares, G.A., Campetella, O., Spinelli, S., Cremona, M.L., Paris, G., Amaya, M.F., Frasch, A.C. & Alzari, P.M. (2000) Structural basis of sialyltransferase activity in trypa- nosomal sialidases. EMBO J. 19, 16–24. 18. Paris, G., Cremona, M.L., Amaya, M.F., Buschiazzo, A., Giambiagi, S., Frasch, A.C. & Alzari, P.M. (2001) Probing molecular function of trypanosomal sialidases: single point mutations can change substrate specificity and increase hydrolytic activity. Glycobiology 11, 305–311. 19. Brun, R. & Schonenberger, M. (1979) Cultivation and in vitro cloning or procyclic culture forms of Trypanosoma brucei.asemi- defined medium. Acta Trop. 36, 289–292. 20. Sambrook, J., Fritsch, E.F. & Maniatis, T. (1989) Molecular Cloning: a Laboratory Manual, 2nd edn. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY. 21. Buschiazzo, A., Frasch, A.C. & Campetella, O. (1996) Medium scale production and purification to homogeneity of a recombinant trans-sialidase from Trypanosoma cruzi. Cell. Mol. Biol. (Noisy-le-Grand) 42, 703–710. 22. Romero, E.L., Pardo, M.F., Porro, S. & Alonso, S. (1997) Sialic acid measurement by a modified Aminoff method: a time-saving reduction in 2-thiobarbituric acid concentration. J. Biochem. Biophys. Methods 35, 129–134. 23. Campetella, O., Sa ´ nchez,D.,Cazzulo,J.J.&Frasch,A.C.C. (1992) A superfamily of Trypanosoma cruzi surface antigens. Parasitol. Today 8, 378–381. 24. Engstler, M., Reuter, G. & Schauer, R. (1992) Purification and characterization of a novel sialidase found in procyclic culture forms of Trypanosoma brucei. Mol. Biochem. Parasitol. 54, 21–30. 25. Crennell, S.J., Garman, E.F., Laver, W.G., Vimr, E.R. & Taylor, G.L. (1993) Crystal structure of a bacterial sialidase (from Salmonella typhimurium LT2) shows the same fold as an influenza virus neuraminidase. Proc. Natl Acad. Sci. USA 90, 9852–9856. Ó FEBS 2002 The trans-sialidase of African trypanosomes (Eur. J. Biochem. 269) 2949 26. Cross, G.A. & Takle, G.B. (1993) The surface trans-sialidase family of Trypanosoma cruzi. Annu. Rev. Microbiol. 47, 385–411. 27. Magdesian, M.H., Giordano, R., Ulrich, H., Juliano, M.A., Juliano, M., Schumacher, R.I., Colli, W. & Alves, M.J.M. (2001) Infection by Trypanosoma cruzi. Identification of a parasite ligand and its host cell receptor. J. Biol. Chem. 276, 19382–19389. 28. Smith, L.E. & Eichinger, D. (1997) Directed mutagenesis of the Trypanosoma cruzi trans-sialidase enzyme identifies two domains involved in its sialyltransferase activity. Glycobiology 7, 445–451. 29. Pays, E. & Nolan, D.P. (1998) Expression and function of surface proteins in Trypanosoma brucei. Mol. Biochem. Parasitol. 91, 3–36. 30. Engstler, M., Reuter, G. & Schauer, R. (1993) The devel- opmentally regulated trans-sialidase from Trypanosoma brucei sialylates the procyclic acidic repetitive protein. Mol. Biochem. Parasitol. 61, 1–13. 31. Pontes de Carvalho, L.C., Tomlinson, S., Vandekerckhove, F., Bienen, E.J., Clarkson, A.B., Jiang, M.S., Hart, G.W. & Nussenzweig, V. (1993) Characterization of a novel trans-sialidase of Trypanosoma brucei procyclic trypomastigotes and identifica- tion of procyclin as the main sialic acid acceptor. J. Exp. Med. 177, 465–474. 32. Nagamune, K., Nozaki, T., Maeda, Y., Ohishi, K., Fukuma, T., Hara,T.,Schwarz,R.T.,Sutterlin,C.,Brun,R.,Riezman,H.& Kinoshita, T. (2000) Critical roles of glycosylphosphatidylinositol for Trypanosoma brucei. Proc. Natl Acad. Sci. USA 97, 10336– 10341. 33. Ferrero-Garcia, M.A., Trombetta, S.E., Sanchez, D.O., Reglero, A., Frasch, A.C. & Parodi, A.J. (1993) The action of Trypanosoma cruzi trans-sialidase on glycolipids and glycoproteins. Eur. J. Biochem. 213, 765–771. 34. Affranchino, J.L., Pollevick, G.D. & Frasch, A.C. (1991) The expression of the major shed Trypanosoma cruzi antigen results from the developmentally-regulated transcription of a small gene family. FEBS Lett. 280, 316–320. 35. Briones, M.R., Egima, C.M., Eichinger, D. & Schenkman, S. (1995) Trans sialidase genes expressed in mammalian forms of Trypanosoma cruzi evolved from ancestor genes expressed in insect forms of the parasite. J. Mol. Evol. 41, 120–131. 36. Gibson, W. (2001) Sex and evolution in trypanosomes. Int. J. Parasitol. 31, 643–647. 37. Taylor, G., Vimr, E., Garman, E. & Laver, G. (1992) Purification, crystallization and preliminary crystallographic study of neur- aminidase from Vibrio cholerae and Salmonella typhimurium LT2. J. Mol. Biol. 226, 1287–1290. 38. Luo, Y., Li, S.C., Chou, M.Y., Li, Y.T. & Luo, M. (1998) The crystal structure of an intramolecular trans-sialidase with a NeuAc alpha2 fi 3Gal specificity. Structure 6, 521–530. 39. Villalta, F., Smith, C.M., Ruiz-Ruano, A. & Lima, M.F. (2001) A ligand that Trypanosoma cruzi uses to bind to mammalian cells to initiate infection. FEBS Lett. 505, 383–388. 40. Keiser, J., Stich, A. & Burri, C. (2001) New drugs for the treatment of human African trypanosomiasis: research and development. Trends Parasitol. 17, 42–49. 41. Geerts, S., Holmes, P.H., Eisler, M.C. & Diall, O. (2001) African bovine trypanosomiasis: the problem of drug resistance. Trends Parasitol. 17, 25–28. 42. Allsopp, R. (2001) Options for vector control against trypano- somiasis in Africa. Trends Parasitol. 17, 15–19. 43. Carter, R. (2001) Transmission blocking malaria vaccines. Vaccine 19, 2309–2314. 2950 G. Montagna et al. (Eur. J. Biochem. 269) Ó FEBS 2002 . protect procyclic cells from digestion by the digestive enzymes in the y [4]. Unable to synthesize sialic acids, trypanosomes use a specific enzyme, the trans-sialidase, to scavenge the mono- saccharide. that the substitution Q284-P in TrSA increased significantly the hydrolytic activity of the enzyme. The three other positions in the neighbourhood of the active site that differ between trypanosomal. primitive trans-sialidase gene. The identity in the catalytic region of the two enzymes led us to investigate whether the same architecture of the active site is likely to be shared by both enzymes. There