Báo cáo Y học: The Saccharomyces cerevisiae type 2A protein phosphatase Pph22p is biochemically different from mammalian PP2A potx

Eur J Biochem 269, 3372–3382 (2002) Ó FEBS 2002 doi:10.1046/j.1432-1033.2002.02965.x The Saccharomyces cerevisiae type 2A protein phosphatase Pph22p is biochemically different from mammalian PP2A Piotr Zabrocki1, Wojciech Swiatek1, Ewa Sugajska1, Johan M Thevelein2, Stefaan Wera2 and Stanislaw Zolnierowicz1,* Cell and Molecular Signaling Laboratory, Intercollegiate Faculty of Biotechnology UG-MUG, Gdansk, Poland; 2Laboratorium voor Moleculaire Celbiologie, K.U Leuven, Leuven-Heverlee, Flanders, Belgium The Saccharomyces cerevisiae type 2A protein phosphatase (PP2A) Pph22p differs from the catalytic subunits of PP2A (PP2Ac) present in mammals, plants and Schizosaccharomyces pombe by a unique N-terminal extension of approximately 70 amino acids We have overexpressed S cerevisiae Pph22p and its N-terminal deletion mutant DN-Pph22p in the GS115 strain of Pichia pastoris and purified these enzymes to apparent homogeneity Similar to other heterologous systems used to overexpress PP2Ac, a low yield of an active enzyme was obtained The recombinant enzymes designed with an · His-tag at their N-terminus were purified by ion-exchange chromatography on DEAESephacel and affinity chromatography on Ni2+-nitrilotriacetic acid agarose Comparison of biochemical properties of purified Pph22p and DN-Pph22p with purified human · His PP2Ac identified similarities and differences between these two enzymes Both enzymes displayed similar specific activities with 32P-labelled phosphorylase a as substrate Furthermore, selected inhibitors and metal ions Reversible protein phosphorylation catalysed by protein kinases and phosphoprotein phosphatases is a major mechanism utilized by eukaryotic organisms to regulate various cellular processes [1] Protein kinases are apparently derived from one primordial gene In contrast, protein phosphatases are encoded by at least three unrelated gene families Based on primary and tertiary structure similarities, protein phosphatases are currently classified into PPP, Mg2+-dependent PPM (both PPP and PPM are specific against phosphoserine/phosphothreonine residues) and PTP (phosphotyrosine residues-specific) families [2,3] The PTP family comprises also dual-specificity phosphatases Correspondence to S Wera, Laboratorium voor Moleculaire Celbiologie, K.U Leuven, Kasteelpark Arenberg 31, B-3001 Leuven-Heverlee, Flanders-Belgium Fax: + 32 16 32 19 79, Tel.: + 32 16 32 15 00, E-mail: stefaan.wera@bio.kuleuven.ac.be Abbreviations: PP2A, protein phosphatase type 2A; PP2Ac, the catalytic subunit of PP2A; Pph21/22p, PP2Ac from Saccharomyces cerevisiae; PR65/A, the structural subunit of PP2A; KM71 and GS115, strains of Pichia pastoris; GSSG, glutathione disulfide; GSH, reduced glutathione Enzyme: protein phosphatase 2A (EC 3.1.3.16) *Note: deceased on 13 February 2001 (Received 31 January 2002, revised 15 April 2002, accepted 29 April 2002) affected their activities to the same extend In contrast to the mammalian catalytic subunit PP2Ac, but similar to the dimeric form of mammalian PP2A, Pph22p, but not DN-Pph22p, interacted strongly with protamine Also with regard to the effects of protamine and polylysine on phosphatase activity Pph22p, but not DN-Pph22p, behaved similarly to the PP2Ac–PR65 dimer, indicating a regulatory role for the N-terminal extension of Pph22p The N-terminal extension appears also responsible for interactions with phospholipids Additionally Pph22p has different redox properties than PP2Ac; in contrast to human PP2Ac it cannot be reactivated by reducing agents These properties make the S cerevisiae Pph22p phosphatase a unique enzyme among all type 2A protein phosphatases studied so far Keywords: Saccharomyces cerevisiae; protein phosphatase Pph22p; protein phosphatase 2A; heterologous expression, Pichia pastoris that are able to dephosphorylate all three phospho-residues [4] Mammalian type 2A protein phosphatase (PP2A), a member of the PPP family, displays a broad substrate specificity in vitro However, its in vivo substrate selectivity, enzymatic activity and subcellular localization are regulated by the association with regulatory subunits [5,6] Thus, two different dimeric forms of PP2A are formed by the association of the catalytic subunit (PP2Ac) with PR65/A scaffolding subunit or a4 protein In addition, association of a third variable subunit derived from the unrelated protein families PR55/B, PR61/B¢ or PR72/B¢¢ to the PR65/A– PP2Ac dimer results in the formation of trimeric PP2A [6] In vivo substrates of PP2A in mammalian cells comprise protein kinases and transcription factors [7] However, the identity of many physiological substrates of PP2A still remains elusive In budding yeast Saccharomyces cerevisiae protein kinases and protein phosphatases regulate cell growth, cell cycle progression, bud formation and morphogenesis as well as nutrient- and pheromone-induced signalling [8] The number of protein kinases in yeast (119) is approximately four times higher than the number of protein phosphatases (31) [9] However, by association of a single catalytic subunit with different regulatory subunits, protein phosphatases can form several functional holoenzymes and thus match the complexity of protein kinases [2,3,5–7] All above listed families of protein phosphatases are encoded by the S cerevisiae genome and represented by 12 (PPP), Ó FEBS 2002 Characterization of protein phosphatase Pph22p (Eur J Biochem 269) 3373 (PPM) and 13 (PTP) members [8,9] In budding yeast Schizosaccharomyes pombe, PP2A is encoded by PPH21 and PPH22 [10] Both Pph21p and Pph22p are involved in actin cytoskeleton reorganization, bud morphogenesis and cell cycle progression from G2 to M [11–13] Pph21p and Pph22p are highly similar (87%) and apparently perform overlapping functions Deletion of both PP2A catalytic subunit genes in budding yeast results in very slow growth Additional deletion of the PP2A-related PPH3 gene is lethal [11,14] Four polypeptides, encoded by CDC55, TPD3, RTS1 and TAP42, form complexes with PP2A catalytic subunits in yeast [12,15–17] Cdc55p, Tpd3p, Rts1p and Tap42p correspond, respectively, to mammalian PR55/B, PR65/A, PR61/B¢ and a4 The corresponding genes are not essential but their mutation results in specific phenotypes Moreover, two genes (RRD1 and RRD2) encoding homologues of mammalian phosphotyrosine phosphatase activator (PTPA), a protein isolated from mammalian tissue based on its ability to stimulate PP2A activity against phosphotyrosine residues, are present in the budding yeast genome [18,19] All catalytic subunits of PP2A from various species are subject to diverse regulatory control mechanisms Carboxymethylation of Leu309 (Leu377 of S cerevisiae) influences PP2A activity of PP2A and is a signal for exchanging variable regulatory B family subunits [20–22] (reviewed in [23]) Phosphorylation of Tyr307 is dependent on insulin, epidermal growth factor, interleukin-1, tumour necrosis factor a (and some other pathways) and inactivation of phosphatase activity (reviewed in [24]) However no data are available concerning phosphorylation of Tyr375 in S cerevisiae PP2Ac is also phosphorylated on a threonine residue, but the role and site(s) of phosphorylation is unknown [25] PP2A interacts with second messenger C2-ceramide and phospholipids, which stimulate its activity (reviewed in [23,24,26]) Moreover, PP2A can potentially be regulated by changes in the redox state of the catalytic subunit [27,28] Both Pph21p and Pph22p differ from the catalytic subunits of PP2A (PP2Ac) of mammals, plants and Schizosaccharomyces pombe by the presence of a unique N-terminal extension of approximately 70 amino acids In order to assess the impact of this N-terminal extension on enzymatic properties of PP2A we expressed · His-tagged Pph22p and a mutant of Pph22p lacking the N-terminal extension (DN-Pph22p) in the yeast Pichia pastoris, purified the phosphatases to apparent homogeneity and compared their biochemical properties to that of purified · Histagged human PP2Ac expressed in Pichia MATERIALS AND METHODS Host strains, media and buffers The strain GS115 (his4, AOX1, AOX2) of P pastoris was used for the overexpression of S cerevisiae Pph22p, DN-Pph22p and N-terminus of Pph22p (first 77 amino acids) Human PP2Aca and PR65a/Aa were overexpressed and purified using KM71 (his4, aox1, AOX2) as described previously [29] All strains were grown, transformed, and analyzed according to the manufacturer’s (Invitrogen) instructions Escherichia coli strains DH5a and Top 10F¢ were used for all plasmid constructions and propagations The following media were used to grow P pastoris: RDBagar: M sorbitol, 2% glucose, 1.34% yeast nitrogen base without amino acids, · 10)5% biotin, 2% agar; MD medium: 1.34% yeast nitrogen base without amino acids, · 10)5% biotin, 2% glucose; MM medium: 1.34% yeast nitrogen base without amino acids, · 10)5% biotin, 0.5% methanol; YPD: 1% yeast extract, 2% peptone, 2% glucose pH 5.8 adjusted with HCl; MGY medium: 1.34% yeast nitrogen base without amino acids, · 10)5% biotin, 1% glycerol The following buffers were applied to purify recombinant Pph22p and DN-Pph22p: SCED buffer: M sorbitol, 10 mM sodium citrate pH 7.5, 10 mM EDTA, 10 mM dithiothreitol; breaking buffer: 50 mM Tris/HCl pH 7.5, mM EDTA, 0.1% 2-mercaptoethanol, 10 mM NaCl, 5% glycerol, 10 mM phenylmethanesulfonyl fluoride and 20 mM benzamidine; buffer A: 20 mM Tris/HCl pH 7.5, 170 mM NaCl (150 mM for DN-Pph22p purification), 0.1 mM EDTA, 0.1% 2-mercaptoethanol, 5% glycerol, mM phenylmethanesulfonyl fluoride and mM benzamidine; buffer B: 20 mM Tris/HCl pH 7.5, 450 mM NaCl, 30 mM imidazole, 5% glycerol and 0.01% Triton X-100; buffer C: 20 mM Tris/HCl pH 7.5, 20% glycerol (± 0.5 mM dithiothreitol) Molecular cloning of the Pph22p expression constructs Genomic DNA of S cerevisiae strain W303 was obtained by the ammonium acetate method [30] and used as template to amplify the PPH22 open reading frame with Pfu DNA polymerase (Stratagene) using a standard protocol The following primers were used: sense (1), 5¢-CGGGATCC ACCATGCATCATCATCATCATCATCATCATGATA TGGAAATTGATGACCCTATG-3¢ (BamHI site underlined, · His-tag bold) and antisense (2), 5¢-CGGAA TTCTTATAAGAAATAATCCGGTGTCTTC-3¢ (EcoRI site underlined) For cloning of DN-Pph22p (Pph22p without first 77 amino acids) and the N-terminus of Pph22p (only the first 77 amino acids) we used: sense primer: 5¢-CGGGATCCACCATGCATCATCATCATCATCAT CATCATCTTGACCAATGGATTGAGCATTTG-3¢ (BamHI site underlined, · His-tag bold) and antisense: 5¢-CGGAATTCTTACTGATTTATATTTGTATTGGT CAG-3¢ (EcoRI site underlined) The PCR products were digested with EcoRI and BamHI and purified by agarose gel electrophoresis using the Geneclean III kit (BIO101) The isolated fragments were first subcloned into pBluescript, and the resulting plasmid amplified in Escherichia coli Subsequently, the Pph22p-encoding fragments were subcloned into the pPIC3.5K vector (Invitrogen) All plasmids used were sequenced with vector- and cDNA-specific primers Homologous recombination in KM71 and GS115 strains of Pichia pastoris Ten micrograms of plasmid DNA produced in E coli DH5a strain, was either used without restriction enzyme digestion or linearized with either SalI, NotI or BglII in the case of pPIC3.5K-PPH22 and SalI in the case of pPIC3.5K-DN-PPH22 and pPIC3.5K-Nterm (N-terminus of Pph22p) or not digested, and transformed by the spheroplast method into KM71 and GS115 strains of P pastoris Transformed yeast cells were plated on Ó FEBS 2002 3374 P Zabrocki et al (Eur J Biochem 269) RDB-agar plates and transformants were transferred to plates with either glucose (MD) or methanol (MM) medium as a carbon source Transformants that displayed the ability to grow on both carbon sources were selected for further evaluation The presence of cDNA encoding Pph22p, DNPph22p and N-terminus of Pph22p integrated into the yeast genome was confirmed by PCR analysis applying sense and antisense oligonucleotides to amplify the PPH22 gene (sequences listed above) Transformants obtained using undigested plasmid DNA in KM71 strain and those obtained after linearization of plasmid with both SalI and NotI in GS115 in case Pph22p were used for further evaluation In case DN-Pph22p and N-terminus of Pph22p transformants obtained from both kind of DNA (undigested and digested with the SalI) were used for further experiments In order to select transformants with the highest copy number of PPH22 genes and mutants genes inserted into the Pichia genome, yeast colonies were transferred to YPD-agar plates or YPD-agar plates containing G418 (Calbiochem) added at and mgỈmL)1 The fastest growing colonies were selected from YPD-agar plates containing mgỈmL)1 G418 and those were selected for mini-scale expression studies Mini-scale expression of Pph22p and DN-Pph22p in P pastoris Recombinants obtained in the KM71 strain (His+MutS, slow methanol utilization) or in the GS115 strain (either His+Mut+ or His+MutS, fast and slow methanol utilization, respectively) were grown for 24 h in 10 mL of MGY to reach a D600 between and Yeast cells were centrifuged and resuspended in MM medium using 0.2 volume of starting culture volume for His+MutS or adjusting D600 to for His+Mut+ Methanol-induced cultures were grown at 30 °C in an Aquatron AI 15 incubator (Infors HT) with shaking set up to 280 r.p.m Methanol was added to 0.5% (v/v) every 24 h and the induction was carried out for days To determine the optimal time for protein expression, aliquots of the cultures were removed at 24-h intervals and analyzed for the presence of the heterologous protein by SDS/PAGE with Coomassie staining, immunodetection with Tetra-His antibodies (Qiagen) and phosphatase activity measurements Recombinant GS115 (His+Mut+) obtained after transformation of yeast with the NotI linearized plasmid displaying the highest level of Pph22p expression, was used for further experiments In case of DN-Pph22p and N-terminus for further experiments transformants GS115 (His+Mut+) obtained with plasmids linearized with the SalI were used Midi-scale expression of recombinant proteins in P pastoris For the midi-scale expression of proteins the selected GS115 (His+Mut+) strain was cultured in a 100-mL baffled flask in 25 mL of MGY medium at 30 °C with shaking at 205 r.p.m This yeast preculture reached an D600  after 24 h; then mL of the preculture was used to inoculate five portions of L each of MGY medium and grown in L flasks to D600 between and Cells were harvested, washed and resuspended in L of MM medium to induce overexpression of heterologous proteins These cultures were grown for 24 h at 30 °C with shaking set at 205 r.p.m After centrifugation at 2000 g for at room temperature the cell pellet was washed with ice-cold water and stored at )80 °C Purification of recombinant Pph22p and DN-Pph22p Methanol-stimulated GS115-PPH22 (or GS115-DNPPH22) cells (approximately 50 g) were resuspended in 100 mL of SCED buffer supplemented with 150 mg (84.7 mg)1) of yeast lyticase from Arthrobacter luteus (ICN) and incubated at 30 °C for 90 to achieve spheroplast formation The spheroplasts were harvested by centrifugation at 750 g for 10 at 25 °C and resuspended in 50 mL of ice-cold breaking buffer Acid-washed glass beads (size 450–500 lm) were added (1 : 1, v/v) and the mixture was vortexed (MS-1 minishaker, IKA) 10 times for each with 1-min intervals for cooling on ice The lysates were cleared by centrifugation at 30 000 g for 30 at °C Cell-free supernatants were combined and fractionated with ammonium sulfate added to obtain 45% saturation The precipitated protein was collected by centrifugation, dissolved in 20 mL of buffer A and dialysed against buffer A The dialysate was loaded at a flow rate of 15 mLỈh)1 onto a DEAE-Sephacel column (2 · 10 cm) equilibrated previously with buffer A The column was washed with 20 column volumes of buffer A and phosphatase activity was eluted with a linear gradient from 170 mM to 500 mM NaCl (in the case of DN-Pph22p from 150 to 700 mM NaCl) in buffer A collecting 3-mL fractions The fractions containing phosphatase activity were combined, dialysed against buffer B and loaded onto a Ni2+-nitrilotriacetate agarose (Qiagen) column (2 · cm) The column was washed with buffer B and protein eluted with a linear gradient of imidazole from 30 to 200 mM, collecting 2-mL fractions The fractions were analysed by immunodetection with Tetra-His antibodies and phosphatase activity assays Combined fractions corresponding to the peak of Pph22p activity were dialysed against buffer C with or without dithiothreitol and stored in small aliquots at )80 °C Protein concentration was determined by the Bradford method using bovine serum albumin as standard Antibodies and immunodetection To detect recombinant His-tagged proteins monoclonal mice IgG1 Tetra-His antibodies (Qiagen) were applied as primary antibodies followed by goat anti-mouse horse radish peroxidase-coupled secondary antibodies (Santa Cruz Biotechnology Inc.) The colour reaction was developed in the presence of reduced form of NAD plus either nitro blue tetrazolium (Sigma) or 4-chloro-1-naphthol (Sigma) When goat anti-mouse alkaline phosphatase-coupled secondary antibodies were applied the colour reaction was developed in the presence of nitro blue tetrazolium and 5-bromo-4-chloro-3-indolyl phosphate (ICN) Phosphatase activity assays Protein phosphatase activity was measured with 32P-labelled phosphorylase a (10 lM) as substrate as described previously [31] When indicated, protamine (33 lgỈmL)1) and Ĩ FEBS 2002 Characterization of protein phosphatase Pph22p (Eur J Biochem 269) 3375 ammonium sulfate (16 mM), were included in the assay buffer The recombinant PR65/A subunit was preincubated with PP2Ac, Pph22p or DN-Pph22p in 20 mM Tris/HCl pH 7.4, 50 mM NaCl, 0.1 mM EDTA and 0.1% 2-mercaptoethanol for 10 at 30 °C before the reaction was started with 32P-labelled phosphorylase a To measure the effect of pH on PP2A activity the buffer containing 20 mM sodium acetate/acetic acid, 20 mM imidazole/HCl and 20 mM Tris/HCl covering pH from 5.0 to 10.0 was applied One unit of phosphatase activity corresponds to lmol of 32 Pi released from 32P-labelled phosphorylase a per at 30 °C For activity assays with lipids, reactions were carried out described previously [26] with minor changes Lipids and phosphatases were incubated on ice for 30 min, prior to the phosphatase activity assay Reactions were carried out for 15–30 at 30 °C The assay was terminated by addition of 0.1 mL mM KH2PO4 in M H2SO4 and 0.3 mL 2% ammonium molybdate After 10 of incubation a toluene/isobutyl alcohol mixture (1 : 1) was added, vortexed for 10 s and centrifuged for 10 Free 32Pi was determined from the radioactivity recovered in the organic phase 32P-Labelled phosphorylase a hydrolysis did not exceed 20% of total phosphorylase a in all samples All illustrated data represent the mean of at least two independent experiments a 10-min incubation at 30 °C by addition of 32P-labelled phosphorylase a Reactions were carried out for 30 under standard conditions RESULTS AND DISCUSSION Comparison of PP2A catalytic subunits from S cerevisiae and other species Phospholipids were solubilized in chloroform and after evaporation of chloroform were resuspended in 50 mM Tris pH 7.4, 0.1 mM EDTA, 0.1% 2-mercaptoethanol buffer by sonication under argon Sonication was carried out in an ice-bath for 10 with breaks (24 kHz) (BioMetra Ultrasonicator) Before use, liposomes were kept for h on ice to allow association of lipids S cerevisiae protein phosphatases encoded by PPH21 and PPH22 are homologues of mammalian PP2Ac Pph21p consists of 369 amino acids and Pph22p of 377 amino acids Both enzymes are hence larger than PP2Ac from mammals, plants and S pombe which are composed of 306–322 amino acids This difference in size results from the presence of an acidic stretch of approximately 70 amino acids (pI 3.78 and 4.07 for Pph21p and Pph22p, respectively) at the N-termini of Pph21/Pph22p (Fig 1) The role of this N-terminal extension present in budding yeast PP2Ac is currently unknown One may speculate that these regions are responsible for targeting Pph21p and Pph22p to intracellular compartments or to specific substrates, or fulfil a special regulatory function Interestingly, the N-terminal regions of Pph21p and Pph22p are quite divergent showing only 49.4% amino-acid sequence identity (the first N-terminal 42 amino acids of Pph22p display only 33.3% identity to the corresponding region in Pph21p) whereas the overall identity between enzymes equals 87% This might indicate that the N-termini of Pph21p and Pph22p may have distinct functions In order to determine whether the N-terminal extension present in Pph22p influences its biochemical properties we decided to overexpress this phosphatase and its deletion mutant without 77 N-terminal amino acids in P pastoris, purify these enzymes to apparent homogeneity and compare their enzymatic properties to those of human PP2Ac Determination of the influence of disulfides on yeast and mammalian recombinant PP2Ac Purification of S cerevisiae Pph22p expressed in P pastoris Pph22p, PP2Ac and DN-Pph22p were incubated with 20 mM dithiothreitol overnight at °C Mixtures were dialyzed extensively against buffer containing 50 mM Tris, pH 7.4, 0.1 mM EDTA and 20% glycerol Determination of the influence of glutathione disulfide (GSSG) and reduced glutathione (GSH) was carried out by mixing this redox agent with the purified phosphatase and incubation at 30 °C for 30 The phosphatase assay was initialized by adding 32P-labelled phosphorylase a The reaction buffer contained 20 mM Tris, pH 7.4, 0.1 mM EDTA and 10% glycerol We determined the growth curves of control GS115, recombinant GS115-PPH22, and GS115-DN-PPH22 strains in minimal medium containing methanol (data not shown) A lag period of approximately 100 h was observed in the case of the GS115-PPH22 and GS-115-DN-PPH22 strains cultured starting from a D600 of 0.05, but not in the wild-type control After this period the recombinant strains resumed growth and eventually reached a D600 similar to that of the wild-type strain Protein levels in both strains were similar, but phosphatase activity in GS115-DN-PPH22 lysates was lower than in lysates of GS115-PPH22; it is likely that more DN-Pph22p was in the insoluble state and this might also explain why the yield of purification was lower in case of DN-Pph22p Cultures in the stationary phase (high D600) showed less pronounced differences between the strains, but even under these conditions the strain overexpressing Pph22p grew somewhat slower Phosphorylase phosphatase activity was measured in cellfree extracts of all strains and its dependence on growth phase (reflected in D600 value) was analysed At stationary phase (high D600), both Pph22p and DN-Pph22p proteins were maximally overexpressed 24 h after methanol induction; amounts of active phosphatase decreased after this Preparation of liposomes Reactivation of PP2Ac and Pph22p activity Reactivation was carried out as described previously [27] with minor changes PP2Ac, Pph22p and DN-Pph22p were inactivated by incubation with 20 mM GSSG overnight at °C Mixtures were dialyzed extensively against buffer contained 50 mM Tris, pH 7.4, 0.1 mM EDTA and 20% glycerol Aliquots of the inactivated enzymes were mixed with dithiothreitol or 2-mercaptoethanol at various concentrations Phosphatase activity in samples was determined after 3376 P Zabrocki et al (Eur J Biochem 269) Ó FEBS 2002 Pph22_S.cerevisiae Pph21_S.cerevisiae ppa1_S.pombe PP2Ac/beta_rabbit PP2Ac/alfa_H.sapiens ppa2_pombe PP2Ac_2_A.thaliana Pph3_S.cerevisiae Pph22_S.cerevisiae Pph21_S.cerevisiae ppa1_S.pombe PP2Ac/beta_rabbit PP2Ac/alfa_H.sapiens ppa2_pombe PP2Ac_2_A.thaliana Pph3_S.cerevisiae Pph22_S.cerevisiae Pph21_S.cerevisiae ppa1_S.pombe PP2Ac/beta_rabbit PP2Ac/alfa_H.sapiens ppa2_pombe PP2Ac_2_A.thaliana Pph3_S.cerevisiae Fig Alignment of PP2A from S cerevisiae and other organisms Sequence alignment of PP2A catalytic subunits from S cerevisae (Pph21p, Pph22p, Pph3p), S pombe (ppa1), rabbit, Homo sapiens and Arabidopsis thaliana Conserved residues are coloured The N-terminal extension is only found in the S cerevisiae PP2A isoforms The region deleted in DN-Pph22p is framed time, as confirmed also by Western blotting analysis (data not shown) The long lag period in the growth of the GS115-PPH22 strain observed after transferring the cells to methanolcontaining medium is similar to that described for the strain overexpressing human PP2Ac [29] and might reflect effects of higher phosphatase activity on yeast growth or on the cell cycle Figure illustrates the purification of Pph22p and DN-Pph22p from P pastoris cells using ammonium sulfate fractionation, DEAE-Sephacel and Ni2+-nitrilotriacetic acid agarose, as described in the Materials and methods section The final preparation, stained with Coomassie Brilliant Blue, appeared to be homogeneous Purity was confirmed by gel filtration (data not shown) Pph22p and DN-Pph22p proteins were purified with a yield of active protein of 80 and 60 lgỈL)1 of P pastoris culture, respectively, in intracellular overexpression The inclusion of Triton X-100 (0.01%) in the buffers used for chromatography on Ni2+-nitrilotriacetic acid agarose greatly enhanced recovery of active phosphatase from this column Similarly to mammalian PP2Ac, Pph22p and DN-Pph22p migrated as a doublet of two proteins Pph22p migrated on SDS/PAGE with a molecular mass of 52–53 kDa, different from its calculated molecular mass of 44 kDa DN-Pph22p migrated on SDS/PAGE at its theoretical molecular mass of 37 kDa The specific activity of the final Pph22p and DN-Pph22p appropriate preparations was 1.3 and 1.8 lmolỈmin)1Ỉmg protein)1 using phosphorylase a as substrate The specific activity of DN-Pph22p is similar to the 1.7 lmolỈmin)1Ỉmg protein)1 obtained for recombinant human PP2Ac [29], but the value for Pph22p is lower indicating an inhibitory effect of the N-terminus Characterization of purified Pph22p and DN-Pph22p Fig Purification of Pph22p and DN-Pph22p from overexpressing P pastoris cells Aliquots of Pph22p and DN-Pph22p overexpressed in P pastoris and purified by using three steps of purification (protein precipitation with ammonium sulfate, ion-exchange chromatography on DEAE-Sephacel and affinity chromatography on Ni2+-nitrilotriacetatic acid agarose were taken and analysed by polyacrylamide (10%) gel electrophoresis and staining with Coomassie Brilliant Blue St, molecular mass standard (kDa); lane 1, Pph22p; lane 2, DN-Pph22p PP2Ac was initially described as a metal-ion-independent protein phosphatase [32] In agreement with this, none of metal ions tested increased significantly the activity of Pph22p, DN-Pph22p or PP2Ac (Table 1) In contrast, several metal ions applied at a concentration of mM (Co2+, Ni2+, Fe2+, Fe3+ and Zn2+) inhibited Pph22p and PP2Ac activities with phosphorylase a as a substrate In order to exclude the latter effects being substrate dependent we confirmed the data from Table using kemptide as substrate (not shown) It remains to be determined whether the inhibitory effect of these high concentrations of metal ions reflect an interaction with SH groups exposed on the enzyme surface or formation of complexes with amino-acid Ó FEBS 2002 Characterization of protein phosphatase Pph22p (Eur J Biochem 269) 3377 Table The effects of metal ions on the activity of type 2A protein phosphatases Activities of purified human PP2Ac (PP2Ac, specific activity 1.7 lmolỈmin)1Ỉmg protein)1) and purified S cerevisiae Pph22p (Pph22p, specific activity 1.3 lmolỈmin)1Ỉmg protein)1) were measured against 10 lM 32P-labelled phosphorylase a 100% activity refers to activity measured in the absence of exogenous metal ions added Relative activity (%) Metal ions (mM) PP2Aca Pph22p 122 89 74 121 107 53 74 39 22 41 11 110 106 74 103 54 115 79 15 82 17 69 35 18 88 13 100 100 93 112 130 129 110 77 66 106 91 76 27 110 77 66 106 91 76 2+ Mn 0.1 0.3 Co2+ 0.1 0.3 Fe2+ 0.1 0.3 Fe3+ 0.1 0.3 Ni2+ 0.1 0.3 Mg2+ 0.1 0.3 Ca2+ 0.1 0.3 Zn2+ 0.1 0.3 Cu2+ 0.1 0.3 residues involved in catalysis Some metal ions, e.g Co2+ and Ni2+, might interact with the N-terminal His-tag, but this is unlikely to explain the effect on phosphatase activity, because even (nonrecombinant) PP2A purified from rabbit skeletal muscle is inhibited by  20–30% by these ions at a concentration of 0.75 mM (data not shown) Mammalian PP2Ac is inhibited by several naturally occurring compounds in a way that allows this enzyme to be distinguished from PP1 [33] In contrast, more recently discovered protein phosphatases such as PP4 and PP6, which are present in mammalian cells in much smaller quantities, are inhibited similarly to PP2A Figure presents inhibition of purified Pph22p by okadaic acid, nodularin, cantharidin and endothall The IC50 values calculated at nM concentration of Pph22p were 0.2, 0.5, Fig Inhibition of Pph22p activity by okadaic acid, nodularin, cantharidin and endothall Purified Pph22p applied at nM was incubated with the indicated concentration of inhibitor at 30 °C for 10 before the reaction was initiated with 32P-labelled phosphorylase a as substrate 130 and 210 nM, respectively, and were very similar to those obtained for DN-Pph22p (data not shown) For PP2Ac applied at a similar concentration (4 nM) IC50 values were very similar, 0.5, 0.6, 140 and 300 nM for okadaic acid, nodularin, cantharidin and endothall, respectively Thus, both Pph22p and PP2Ac are similarly affected by a panel of inhibitors reflecting the high degree of conservation of the catalytic core between these two enzymes and ruling out the involvement of the N-terminal extension in binding to these inhibitors As can be expected from the presence of a stretch of acidic amino acids, the pH optimum of Pph22p (pH 7.5) is slightly different from the pH optimum of PP2Ac (pH 7) Unique properties of Pph22p In vivo PP2Ac associates with the scaffolding PR65/A subunit to form dimers, which can further associate into trimers by association with a variable B subunit Homologues of the PR65/A subunit and of various B subunits are present in yeast (reviewed in [23]) A classical biochemical approach to distinguish between PP2Ac and the dimer makes use of protamine It has been described that this compound inhibits the activity of the isolated catalytic subunit, but stimulates activity of the dimer [34] Unexpectedly, however, protamine (both in the absence and in the presence of ammonium sulfate) stimulated the phosphatase activity of purified Pph22p (Fig 4A) At 66 lgỈmL)1, protamine (and 16 mM ammonium sulfate) an 11-fold activation of Pph22p was observed Protamine, in the presence of the same concentration of ammonium sulfate, had little effect on human PP2Ac and on DN-Pph22p (Fig 4A) In contrast, 33 lgỈmL)1, protamine together with 16 mM ammonium sulfate stimulated the activity of the PP2Ac-PR65/A dimer about 12-fold and that of the DN-Pph22p-PR65/A dimer around fourfold (Fig 4B) Hence, with respect to protamine stimulation of phosphatase activity, the yeast catalytic subunit Pph22p behaved similarly to the PP2Ac-PR65/A dimer, but mutant DN-Pph22p behaved like PP2Ac As can be seen in Fig 4B, addition of PR65/A subunit to Pph22p increased the protamine activation a further 1.8-fold 3378 P Zabrocki et al (Eur J Biochem 269) Ó FEBS 2002 Fig Pph22p responds to protamine in a similar way as the mammalian PP2Ac-PR65/A dimer (A) Phosphatase activity of 0.5 nM Pph22p (squares), 0.5 nM DN-Pph22p (triangles) and 0.5 nM PP2Ac (circles) was assayed using 32P-labelled phosphorylase a as a substrate in the presence of the indicated concentrations of protamine and in the absence (open symbols) or presence (closed symbols) of 16 mM ammonium sulfate (SA) (B) Phosphatase activity of 0.5 nM Pph22p (squares), 0.5 nM DN-Pph22p (triangles) and 0.5 nM PP2Ac (circles) was assayed using 32P-labelled phosphorylase a as a substrate in the presence of the indicated concentrations of purified PR65a/A subunit and in the absence (open symbols) or presence (closed symbols) of 33 lgỈmL)1 protamine and 16 mM ammonium sulfate (C) Phosphatase activity of the indicated concentrations of Pph22p (squares), DN-Pph22p (triangles) and PP2Ac (circles) was assayed using 32P-labelled phosphorylase a as a substrate in the absence (open symbols) or presence (closed symbols) of nM purified PR65a/A subunit (D) Binding of PP2Ac, DN-Pph22p and Pph22p to protamine-agarose Immunodetection of Pph22p/DN-Pph22p/PP2Ac was carried out on a Western blot after separation of protein fractions on 10% SDS-polyacrylamide gel Lanes and 2, material loaded to the column; lane 3, flow-through; lanes 4, and 6, material eluted with 50 mM, 500 mM and M NaCl, respectively; lane 7, material eluted with · SDS/PAGE buffer The observation that in the absence of protamine PP2Ac, Pph22p and DN-Pph22p are inhibited by increasing the PR65/A subunit concentration (Fig 4C), indicates the efficient formation of PP2Ac-PR65/A, DN-Pph22p-PR65/A and Pph22p-PR65/A dimers We have shown previously [29] that protamine exerts its effect on PP2Ac activity via an interaction with the PR65/A subunit, which interacts much more strongly with protamine-agarose than PP2Ac itself Here we have confirmed these data, but we also showed that, in agreement with the protamine stimulation of Pph22p, this enzyme interacts strongly with protamineagarose (Fig 4D) The strong interaction between Pph22p catalytic subunit and protamine-agarose is reflected by the resistance to elution with M NaCl Denaturing conditions (boiling of the gel in SDS sample buffer) are required to dissociate Pph22p from the protamine-agarose column This interaction is mediated by the acidic N-terminal extension, since the DN-Pph22p protein cannot interact strongly with protamine-agarose and like PP2Ac is eluted with 0.5 M NaCl from the gel (Fig 4D) In order to determine the effect of other polycations on phosphorylase phosphatase activity of yeast and mammalian PP2Ac poly-L-lysine was added to the purified enzymes As presented in Fig a peak of poly-L-lysinestimulated phosphorylase phosphatase activity was observed at 20 lg poly-L-lysine per mL for both enzymes, but the extend of activation of Pph22p was much more pronounced (4.5-fold activation of Pph22p activity vs 2.5-fold activation of PP2Ac) PR65/A subunit (3 nM) increased activation of PP2Ac by poly-L-lysine by approximately 70% and it also increased stimulation of Pph22p by poly-L-lysine another 50% From Fig it is clear that the activation (4.5-fold) of Pph22p by 20 lgỈmL)1 poly-L-lysine is very similar to activation Ó FEBS 2002 Characterization of protein phosphatase Pph22p (Eur J Biochem 269) 3379 (4.5-fold) of the human PP2Ac-PR65/A dimer by 20 lgỈmL)1 poly-L-lysine and much stronger than that of the free human catalytic subunit PP2Ac Interestingly the deletion mutant DN-Pph22p behaved more like PP2Ac DN-Pph22p is only around 70% activated by poly L-lysine and even the DN-Pph22p/PR65a dimer is less stimulated than Pph22p alone (Fig 5) Again these data point to a domain present in the yeast Pph22p N-terminus responsible for mimicking the polycation-stimulation effects exerted by the PR65/A subunit in mammalian PP2A Taken together we can conclude that activation of Pph22p by polycations is mediated by its N-terminal region The role of this region in vivo is unknown, but it might stabilize the structure of Pph22p, influence substrate specificity or exert a regulatory function Fig Effect of polylysine on the phosphatase activity of Pph22p, DN-Pph22p, PP2Ac and the corresponding dimers Phosphatase activity of 0.5 nM Pph22p (squares), 0.5 nM DN-Pph22p (triangles) and 0.5 nM PP2Ac (circles) was assayed using 32P-labelled phosphorylase a as a substrate in the presence of the indicated concentrations of polyL-lysine and in the absence (open symbols) or presence (closed symbols) of nM purified PR65a/A subunit Effects of phospholipids on activity of Pph22p Some studies showed that phospholipids can stimulate or inhibit of PP2A and PP1 phosphatases [26] (reviewed in [23,24]) In this study we also checked the influence of several phospholipids (assembled in liposomes) on activity of Pph22p and DN-Pph22p Lipids were tested at a Fig Influence phospholipids on Pph22p and DN-Pph22p activity Phosphatase assays were carried out as described in Materials and Methods (A) Influence of egg yolk phosphatidic acid (PA) and synthetic dioleoylphosphatidic acid (DOPA) on Pph22p and DN-Pph22p phosphatase activity (B) Influence of phosphatidylserine (PS) and (C) phosphatidylethanolamine (PE) on Pph22p and DN-Pph22p phosphatase activity (D) Effects of dioleoylphosphatidylcholine (DOL) and phosphatidylcholine (L) on Pph22p and DN-Pph22p phosphatase activity Phosphatases at a concentration of 2.3 nM were used to measure the effects of phospholipids on its activity Lipids were solubilized in chloroform and after evaporation of chloroform were resuspended in 50 mM Tris, pH 7.4, 0.1 mM EDTA, 0.1 mM 2-mercaptoethanol buffer and sonicated Liposomes were added to phosphatase and reactions were incubated on ice for 30 and phosphatase activity in samples were determined (see Materials and methods) Ó FEBS 2002 3380 P Zabrocki et al (Eur J Biochem 269) calculated concentration of 4–400 lM and after 10 incubation on ice, a time where effects were maximal Phosphatidic acid from egg yolk (PA) stimulated Pph22p activity, but it inhibited DN-Pph22p Inhibition reached 70% for DN-Pph22p at 320 lM concentration with IC50 around 80 lM of lipid (Fig 6A) The same lipid stimulated Pph22p around twofold at lM or higher concentrations (Fig 6A) Dioleoylphosphatidic acid (C18:1, [cis]-9) inhibited both Pph22p and DN-Pph22p in a similar manner (IC50)40 lM concentration of phospholipid for DN-Pph22p and 30 lM of phospholipid for Pph22p) (Fig 6A) Phosphatidylserine and phosphatidylethanolamine both stimulated Pph22p phosphatase around 2.5-fold to threefold, but only slightly affected DN-Pph22p (Figs 6B,C) Dioleoylphosphatidylcholine (C18:1, [cis]-9) and phosphatidylcholine were not selective, and stimulated both Pph22p and DN-Pph22p in a similar way (Fig 6D) These results indicate a specific influence of the N-terminal extension of Pph22p on its Fig Determination of influence of redox agents on phosphatase activity (A) Effects of GSSG and GSH on activity of yeast and human recombinant phosphatases Phosphatases (PP2Ac, Pph22p and DN-Pph22p) at a concentration of 2.5 nM were added to the indicated concentrations of GSSG and GSH Reactions were incubated at 30 °C for 10 and phosphatase activity was determined (B) Reactivation test of PP2Ac, DN-Pph22p and Pph22p phosphatases inactivated by incubation with 20 mM GSSG After inactivation phosphatases were dialysed extensively and assayed for activity after 10 incubation with dithiothreitol or 2-mercaptoethanol in the indicated concentrations A 2.5-nM concentration of PP2Ac, Pph22p and DN-Pph22p was used On the graph, the solid squares precisely overlap the open squares activity and on interactions with specific phospholipids and possibly membranes Redox state of Pph22p Some authors reported an influence of reducing and oxidizing agents on PP2A and PP1 activity [27,28] Oxidizing reagents like o-iodosobenzoate, dipiridyl disulfates or glutathione disulfide can inactivate of PP2A and PP1 isolated from rabbit skeletal muscle [27] Inactivation is different between PP2A and PP1 and depends on the oxidizing agent used [27] We tested the influence of the oxidizing agent GSSG on activity of Pph22p, DN-Pph22p and recombinant human PP2Ac catalytic subunit as control Figure 7A illustrates the influence of various concentrations of GSSG on PP2Ac, Pph22p and DN-Pph22p phosphatases All these enzymes are inactivated in a similar way by GSSG, but interestingly only Pph22p activity is also inhibited by GSH GSH at mM concentration has no effect on recombinant human PP2Ac and in low concentrations even slightly stimulates PP2Ac activity (Fig 7A) (data not shown) We then checked the influence of reducing agents on the activity of phosphatases Dithiothreitol and 2-mercaptoethanol can reactivate PP1 and PP2A phosphatases from rabbit skeletal muscle inactivated by GSSG [27] We tested whether both Pph22p and DN-Pph22p were reactivated by dithiothreitol and 2-mercaptoethanol As a control recombinant PP2Ac was used Pph22p and DN-Pph22p were not reactivated, even at 50 mM concentration dithiothreitol or 2-mercaptoethanol, while PP2Ac was reactivated by both reducing agents to around 15% of its original activity (Fig 7B) This is in agreement with data reported previously [27], where authors have shown slight reactivation of PP2A from rabbit skeletal muscle and very high levels of reactivation of rabbit PP1 Pph22p cannot be reactivated under our conditions by reducing agents, moreover 2-mercaptoethanol and in lesser extend dithiothreitol, even decrease the activity of Pph22p, in contrast to PP2Ac, which can be activated about twofold (data not shown) Serine-threonine phosphatases, e.g rabbit and human PP1c and PP2Ac, probably have disulfide bonds connecting their cysteine residues PP2Ac and Pph22p have 10 and cysteine residues, respectively The different properties of both enzymes can probably be explained by two residues, Cys50 and Cys251, which are unique for PP2Ac, and Cys143, which is unique for Pph22p Because cysteine residues can influence secondary structure, the structure of both phosphatases might be slightly different More likely, in contrast to Pph22p, PP2Ac might be regulated by reversible oxidation of cysteine residues; it is noteworthy that PP2A from rabbit tissue was isolated in complex with nucleoredoxin, an enzyme with high homology to thioredoxins (S Zolnierowicz, N Andjelkovic, C Van Hoof, J Goris & B A Hemmings, unpublished data) (reviewed in [24]) However, homologs of nucleoredoxin are not found in the yeast genome CONCLUSION Although Pph22p has been studied thoroughly using genetic methods, no data are available regarding its enzymatic properties To fill this gap we overexpressed Ó FEBS 2002 Characterization of protein phosphatase Pph22p (Eur J Biochem 269) 3381 Pph22p in P pastoris, purified this phosphatase to apparent homogeneity, determined its enzymatic properties and compared them to those of mammalian PP2Ac This analysis shows that although both enzymes share a number of characteristics (specific activity, sensitivity to inhibitors, inhibition by high concentrations of metal ions), they show a remarkably different response to protamine, polylysine and reducing agents Using purified Pph22p lacking the N-terminus, we can attribute most of these differences to the unique N-terminal extension present in Pph22p In contrast to PP2Ac and DN-Pph22p, Pph22p strongly interacts with protamine resulting in stimulation of enzymatic activity The stimulation of catalytic activity of Pph22p by protamine and polylysine reflects the stimulation of the mammalian PP2Ac-PR65/A dimeric form of the phosphatase The N-terminus of Pph22p also influences interactions of Pph22p with specific phospholipids or membranes Our data therefore indicate a possible regulatory function for the acidic N-terminus of Pph22p and demonstrate that yeast Pph22p has unique enzymatic characteristics compared to other PP2A phosphatases studied so far 12 13 14 15 16 17 ACKNOWLEDGEMENTS This work was supported by grants from NATO (LST.CLG 974983) and the Ministry of the Flemish Community (BIL99/26), by a postdoctoral fellowship from the Research Fund of the Katholieke Universiteit Leuven to S W., and by a grant BW# B000-5-0217-1 to S Z The authors thank Prof Michal Wozniak for helping with the preparation of liposomes 18 19 REFERENCES Hunter, T (2000) Signaling 2000 and beyond Cell 100, 113–127 Barford, D (1996) Molecular mechanisms of the protein serine/ threonine phosphatases Trends Biochem Sci 21, 407–412 Cohen, P.T.W (1997) Novel protein serine/threonine phosphatases: variety is the spice of life Trends Biochem Sci 22, 245–251 Denu, J.M., Stuckey, J.A., Saper, M.A & Dixon, J.E (1996) Form and function in protein dephosphorylation Cell 87, 361–364 Wera, S & Hemmings, B.A (1995) Serine/threonine protein phosphatases Biochem J 311, 17–29 Zolnierowicz, S (2000) Type 2A protein phosphatase, the complex regulator of numerous signaling pathways Biochem Pharmacol 60, 1225–1235 Millward, T.A., Zolnierowicz, S & Hemmings, B.A (1999) Regulation of protein kinase cascades by protein phosphatase 2A Trends Biochem Sci 24, 186–191 Stark, M.J (1996) Yeast protein serine/threonine phosphatases: multiple roles and diverse regulation Yeast 12, 1647–1675 Costanzo, M.C., Hogan, J.D., Cusick, M.E., Davis, B.P., Fancher, A.M., Hodges, P.E., Kondu, P., Lengieza, C., Lew-Smith, J.E., Lingner, C., Roberg-Perez, K.J., Tillberg, M., Brooks, J.E & Garrels, J.I (2000) The yeast proteome database (YPD) and Caenorhabditis elegans proteome database (WormPD): comprehensive resources for the organization and comparison of model organism protein information Nucleic Acids Res 28, 73–76 10 Sneddon, A.A., Cohen, P.T.W & Stark, M.J.R (1990) Saccharomyces cerevisiae protein phosphatase 2A performs an essential cellular function and is encoded by two genes EMBO J 9, 4339–4346 11 Evans, D.R.H & Stark, M.J.R (1997) Mutations in the Saccharomyces cerevisiae type 2A protein phosphatase catalytic 20 21 22 23 24 25 26 27 28 subunit reveal roles in cell wall integrity, actin cytoskeleton organization and mitosis Genetics 145, 227–241 Di Como, C.J & Arndt, K.T (1996) Nutrients, via the Tor proteins, stimulate the association of Tap42 with type 2A phosphatase Genes Dev 10, 1904–1916 Lin, F.C & Arndt, K.T (1995) The role of Saccharomyces cerevisiae type 2A phosphatase in the actin cytoskeleton and in entry into mitosis EMBO J 14, 2745–2759 Ronne, H., Carlsberg, M., Hu, G.-Z & Nehlin, J.O (1991) Protein phosphatase 2A in Saccharomyces cerevisiae: effects on cell growth and bud morphogenesis Mol Cell Biol 11, 4876– 4884 Healy, A.M., Zolnierowicz, S., Stapleton, A.E., Goebl, M., DePaoli-Roach, A.A & Pringle, J.R (1991) CDC55, a Saccharomyces cerevisiae gene involved in cellular morphogenesis: identification, characterization, and homology to the B subunit of mammalian type 2A protein phosphatase Mol Cell Biol 11, 5767–5780 van Zyl, W., Huang, W., Sneddon, A.A., Stark, M., Camier, S., Werner, M., Marck, C., Sentenac, A & Broach, J.R (1992) Inactivation of the protein phosphatase 2A regulatory subunit A results in morphological and transcriptional defects in Saccharomyces cerevisiae Mol Cell Biol 12, 4946–4959 Zhao, Y., Boguslawski, G., Zitomer, R.S & DePaoli-Roach, A.A (1997) Saccharomyces cerevisiae homologs of mammalian B and B¢ subunits of protein phosphatase 2A direct the enzyme to distinct cellular functions J Biol Chem 272, 8256–8262 Ramotar, D., Belanger, E., Brodeur, I., Masson, J.Y & Drobetsky, E.A (1998) A yeast homologue of the human phosphotyrosyl phosphatase activator PTPA is implicated in protection against oxidative DNA damage induced by the model carcinogen 4-nitroquinoline 1-oxide J Biol Chem 273, 21489–21496 Van Hoof, C., Janssens, V., De Baere, I., de Winde, J.H., Winderickx, J., Dumortier, F., Thevelein, J.M., Merlevede, W & Goris, J (2000) The Saccharomyces cerevisiae homologue of protein phosphatase 2A controls progression through the G1 phase of the yeast cell cycle J Mol Biol 302, 103–120 Favre, B., Zolnierowicz, S., Turowski, P & Hemmings, B.A (1994) The catalytic subunit of protein phosphatase 2A is carboxyl-methylated in vivo J Biol Chem 269, 16311–16317 Bryant, J.C., Westphal, R.S & Wadzinski, B.E (1999) Methylated C-terminal leucine residue of PP2A catalytic subunit is important for binding of regulatory B subunit Biochem J 339, 241–246 Wei, H., Ashby, D.G., Moreno, C.S., Ogris, E., Yeong, F.M., Corbett, A.H & Pallas, D.C (2001) Carboxylmethylation of the PP2A catalytic subunit in Saccharomyces cerevisiae is required for efficient interaction with the B-type subunits Cdc55p and Rts1p J Biol Chem 276, 1570–1577 Zabrocki, P., Van Hoof, C., Goris, J., Thevelein, J.M., Windericx, J & Wera, S (2002) Protein phosphatase 2A on track for nutrientinduced signalling in yeast Mol Microbiol 43, 835–842 Janssens, V & Goris, J (2001) Protein phosphatase 2A: a highly regulated family of serine/threonine phosphatases implicated in cell growth and signalling Biochem J 353, 417–439 Guo, H & Damuni, Z (1993) Autophosphorylation – activated protein kinase phosphorylates and inactivates protein phosphatase 2A Proc Natl Acad Sci USA 90, 2500–2504 Kishikawa, K., Chalfant, C.E., Perry, D.K., Bielawska, A & Hannun, Y.A (1999) Phosphatidic acid is a potent and selective inhibitor of protein phosphatase and an inhibitor of ceramidemediated responses J Biol Chem 274, 21335–21341 Nemani, R & Lee, E.Y.C (1993) Reactivity of sulfhydryl groups of the catalytic subunits of rabbit skeletal muscle protein phosphatase and 2A Arch Biochem Biophys 300, 24–29 Holmes, C.F.B & Boland, M (1993) Inhibitors of protein phosphatase-1 and -2A; two of the major serine/threonine protein 3382 P Zabrocki et al (Eur J Biochem 269) phosphatases involved in cellular regulation Curr Opin Struct Biol 3, 934–943 29 Swiatek, W., Sugajska, E., Lankiewicz, L., Hemmings, B.A & Zolnierowicz, S (2000) Biochemical characterization of recombinant subunits of type 2A protein phosphatase overexpressed in Pichia pastoris Eur J Biochem 267, 5209–5216 30 Hoffman, C.S & Winston, F (1987) A ten-minute DNA preparation from yeast efficiently releases autonomous plasmids for transformation of Escherichia coli Gene 57, 267–272 31 Zolnierowicz, S., Csortos, C., Bondor, J., Verin, A., Mumby, M.C & DePaoli-Roach, A.A (1994) Diversity in the regulatory B-subunits of protein phosphatase 2A: identification of a Ó FEBS 2002 novel isoform highly expressed in brain Biochemistry 33, 11858– 11867 32 Cohen, P (1989) The structure and regulation of protein phosphatases Annu Rev Biochem 58, 453–508 33 Favre, B., Turowski, P & Hemmings, B.A (1997) Differential inhibition and posttranslational modification of protein phosphatase and 2A in MCF7 cells treated with calyculin-A, okadaic acid, and tautomycin J Biol Chem 272, 13856–13863 34 Turowski, P., Favre, B., Campbell, K.S., Lamb, N.J & Hemmings, B.A (1997) Modulation of the enzymatic properties of protein phosphatase 2A catalytic subunit by the recombinant 65-kDa regulatory subunit PR65a Eur J Biochem 248, 200–208  ... ppa2_pombe PP2Ac_2_A.thaliana Pph3_S .cerevisiae Pph22_S .cerevisiae Pph21_S .cerevisiae ppa1_S.pombe PP2Ac/beta_rabbit PP2Ac/alfa_H.sapiens ppa2_pombe PP2Ac_2_A.thaliana Pph3_S .cerevisiae Pph22_S .cerevisiae. .. Pph22_S .cerevisiae Pph21_S .cerevisiae ppa1_S.pombe PP2Ac/beta_rabbit PP2Ac/alfa_H.sapiens ppa2_pombe PP2Ac_2_A.thaliana Pph3_S .cerevisiae Fig Alignment of PP2A from S cerevisiae and other organisms Sequence... like PP2Ac is eluted with 0.5 M NaCl from the gel (Fig 4D) In order to determine the effect of other polycations on phosphorylase phosphatase activity of yeast and mammalian PP2Ac poly-L-lysine