Báo cáo khoa học: Characterization of the 16S rRNA- and membrane-binding domains of Streptococcus pneumoniae Era GTPase Structural and functional implications docx

Characterization of the 16S rRNA- and membrane-binding domains of Streptococcus pneumoniae Era GTPase Structural and functional implications Julie Q. Hang 1 and Genshi Zhao 2 1 Roche Palo Alto, LLC, Palo Alto, CA, USA; 2 Cancer Research, Lilly Research Laboratories, Eli Lilly and Company, Indianapolis, IN, USA Era is a highly conserved GTPase essential for bacterial growth. The N-terminal part of Era contains a conserved GTPase domain, whereas the C-terminal part of the protein contains an RNA- and membrane-binding domain, the KH domain. To investigate whether the binding of Era to 16S rRNA and membrane requires its GTPase activity and whether the GTPase domain is essential for these acti- vities, the N- and C-terminal parts of the Streptococ- cus pneumoniae Era – Era-N (amino acids 1–185) and Era-C (amino acids 141–299), respectively – were expressed and purified. Era-C, which had completely lost GTPase activity, bound to the cytoplasmic membrane and 16S rRNA. In contrast, Era-N, which retained GTPase activity, failed to bind to RNA or membrane. These results therefore indicate that the binding of Era to RNA and membrane does not require the GTPase activity of the protein and that the RNA-binding domain is an independent, functional domain. The physiological effects of the overexpression of Era-C were assessed. The Escherichia coli cells overexpress- ing Era and Era-N exhibited the same growth rate as wild- type E. coli cells. In contrast, the E. coli cells overexpressing Era-C exhibited a reduced growth rate, indicating that the overexpression of Era-C inhibits cell growth. Furthermore, overexpression of era-N and era-C resulted in morphological changes. Finally, purified Era and Era-C were able to bind to poly(U) RNA, and the binding of Era to poly(U) RNA was significantly inhibited by liposome, as the amount of Era bound to the RNA decreased proportionally with the increase of liposome in the assay. Therefore, this study provides the first biochemical evidence that both binding sites are overlapping. Together, these results indicate that the RNA- and membrane-binding domain of Era is a separate, functional entity and does not require the GTPase activity or the GTPase domain of the protein for activity. Keywords: GTPase activity; 16S rRNA-binding activity; membrane association; KH domain; Streptococcus pneu- moniae. The Era GTPase is an RNA-binding protein essential for bacterial growth. The sequences of Era homologues are highly conserved in all bacteria sequenced to date [1–6]. Era is also functionally conserved, as the homologues of Era from different bacterial species are able to functionally complement an Escherichia coli era mutant [6,7]. Owing to its essentiality and widespread existence, Era represents an attractive antibacterial target. Era has been implicated in a wide array of cellular functions, including DNA replication, protein translation, and cell cycle regulation. Mutations in era have been shown to cause pleiotropic phenotypes in E. coli, including a profoundly altered carbon metabolism [8,9] and a lack of cell cycle progression [10,11]. Depletion of the cellular concentration of Era at low temperatures inhibited the growth of, and caused the elongation of, E. coli cells that contained two or four segregated nucleoids [11]. The exact function of Era, however, still remains to be determined. Era homologues were also identified in human and mouse [10,12]. The mammalian homologues of Era appear to play a role in the regulation of apoptosis [13]. The crystal structure analysis of E. coli Era indicates a two-domain structure [14]. The N-terminal part of Era contains a conserved GTP-binding domain (Era) (Fig. 1) [6,14–16], whereas the C-terminal part appears to contain a motif similar to the KH domain, a conserved RNA-binding domain present in the eukaryotic pre-mRNA-binding proteins (Fig. 1) [6,14–16]. Purified Era proteins of Strepto- coccus pneumoniae and E. coli were bound primarily with 16S rRNA [17,18]. In addition, purified E. coli Era was also found to bind poly(U) RNA in vitro [19]. Truncation analysis of the C-terminus of Era indicated that the KH domain was required for 16S rRNA-binding activity [20]. Thus, Era is an RNA-binding protein that may play a critical role in protein synthesis. The essentiality of the RNA-binding activity of Era has also been established [20]. The GTPase activity of Era proteins has also been shown to be essential for bacterial growth [10,20–24]. Interestingly, some mutations in the GTPase domain of E. coli Era Correspondence to G. Zhao, Lilly Research Laboratories, Cancer Research, Drop code 0424, Lilly Corporate Center, Eli Lilly and Company, Indianapolis, IN 46285-0424, USA. Fax: +1 317 276 6510, Tel.: + 1 317 276 2040, E-mail: Zhao_Genshi@Lilly.com Abbreviations: GST, glutathione S-transferase; IPTG, isopropyl- b- D -thiogalactopyranoside; PtdEtn, phosphatidylethanolamine; PtdGro, phosphatidylglycerol. (Received 13 June 2003, revised 20 August 2003, accepted 1 September 2003) Eur. J. Biochem. 270, 4164–4172 (2003) Ó FEBS 2003 doi:10.1046/j.1432-1033.2003.03813.x impeded the RNA-binding activity, as judged by its ability to bind to polynucleotides in vitro [19], but some mutations in this domain did not appear to affect the RNA-binding activity [19]. Thus, it was not clear whether the binding of Era to 16S rRNA requires the GTPase activity of the protein and whether the RNA-binding domain can bind RNA in the absence of the GTPase domain. Structurally, it remained to be established whether the RNA-binding domain is functional in the absence of the GTPase domain. Era has been found to be associated with the inner membrane of E. coli [25]. However, the exact component of the membrane to which Era binds has yet to be identified. Interestingly, the amount of SGP, an Era homologue in Streptococcus mutans that was associated with the mem- brane, was increased significantly under stress conditions [26]. Therefore, the membrane-binding activity of Era may play a role in cell signaling. We have also shown that part of the KH domain responsible for RNA binding is also required for membrane binding [20]. However, it was not clear whether the membrane-binding domain of Era also required the GTP-binding and GTPase activities of the protein for function and whether, biochemically, the RNA- and membrane-binding domains overlap. To investigate whether the RNA- and membrane-binding activities require the GTPase activity of Era, and whether the RNA- and membrane-binding domain is a self-sufficient functional entity, we constructed N- and C-terminally truncated Era proteins of S. pneumoniae that contained the GTPase domain, and the RNA- and membrane-binding domain, respectively. We purified and analyzed these proteins for their GTP hydrolysis, and RNA- and membrane-binding activities. The results of this study indicate that the RNA- and membrane-binding domain is a self-sufficient, functional entity that does not require the GTPase domain for activity. This study also provides the first biochemical evidence that the RNA- and membrane- binding domains are overlapping. Materials and methods Materials GTP, GDP, ampicillin, tetracycline, sucrose, maltose, isopropyl-b- D -thiogalactopyranoside (IPTG), BSA, alka- line-phosphatase-conjugated goat anti-rabbit monoclonal IgG, 5-bromo-4-chloroindol-2-yl phosphate and Nitro Blue tetrazolium were purchased from Sigma Chemical Com- pany. Prestained molecular mass standards for SDS/PAGE (myosine, 209 kDa; b-galactosidase, 124 kDa; BSA, 80 kDa; ovalbumin, 49.1 kDa; carbonic anhydrase, 34.8 kDa; soybean trypsin inhibitor, 28.9 kDa; lysozyme, 20.6 kDa; aprotinin, 7.1 kDa) were purchased from Bio- Rad. Glutathione and glutathione–Sepharose were obtained from Amersham Pharmacia Biotech and New England Biolabs, respectively. T4 DNA ligase, calf intestinal alkaline phosphatase, Taq DNA polymerase, 1 kb DNA molecular mass standard, and all restriction enzymes were obtained from Gibco BRL and used according to the supplier’s recommendations. Vent DNA polymerase was obtained from New England Biolabs. The liposome preparation used in this study, which contained phospha- tidylethanolamine (PtdEtn) and phosphatidylglycerol (Ptd- Gro) in a ratio of 70 : 30 (wt/wt) LUV, was obtained from Northern Lipids Inc. (Vancouver, Canada). This prepar- ation was of uniform size. Poly(U) and poly(A) homopoly- meric RNA were purchased from Sigma. PtdEtn and PtdGro were purchased from Aventi Polar Lipids, Inc. (Alabaster, AL, USA). Bacterial strains, plasmids, and culture conditions The following E. coli strains were used in this study: BL21(DE3) pLysS (Stratagene), XL1-Blue-mRF¢ (Strata- gene), HT120 (W3110 rnc-40::Tn10,Tet r ) [24], LY12 (E. coli K12wild-type),LY41[E. coli XL1-Blue-mRF¢/pLY41 S. pneumoniae glutathione S-transferase (GST)–era + Amp r )] [27], and LY42 [E. coli BL21(DE3) plysS/pLY42 (S. pneumoniae era + Amp r ) [24]. The following plasmids were used in this study: pACYC184 (New England Biolabs), pGEX-2T and pGEX-4T (Amersham Biotech), and pET-11a (Novagene). Luria–Bertani (LB) medium was purchased from Difco Laboratories. Ampicillin (100 lgÆmL )1 ), tetracycline (15 lgÆmL )1 ), and IPTG were addedtomediaasindicatedineachexperiment. E. coli strains that express the S. pneumoniae Era, Era-N, and Era-C were first grown overnight at 33 °Cwith vigorous shaking in LB medium supplemented with 100 lgÆmL )1 ampicillin. The overnight cultures (40 mL each) were inoculated into 1.25 L (each) of fresh LB medium containing ampicillin and then induced with 0.4 m M IPTG at an A 600 of 0.5–0.7 for 3 h at 31 °C. Cells were harvested by centrifugation at 4000 g for 10 min and washed with NaCl/P i , pH 7.4 (Gibco BRL). Fig. 1. Functional domains of Streptococcus pneumoniae Era. (A) The structural motifs of S. pneumoniae Era are shown based on a computer modeling analysis [14,20]. The GTP-binding domain is composed of four functional modules: G1 or P-loop, responsible for the binding of GDP/GTP; G2, a putative regulatory domain; G3, responsible for binding of catalytic Mg 2+ through an intervening water molecule; and G4, a second putative regulatory domain. The putative KH domain in the C-terminal part of Era corresponds to IIGKGGAMLK, a con- served sequence located between residues 246 and 255. The region critical for the binding of Era to the cytoplasmic membrane corres- ponds to an amino acid sequence of KGIIIGKGGAMLKKI (residues 240–254) [15]. (B) Era-N (corresponding to amino acids 1–185), which contains the GTPase domain, and Era-C (corresponding to amino acids 141–299), which contains the RNA-binding domain (KH domain) and the region essential for the binding of Era to the cyto- plasmic membrane [20,24]. Ó FEBS 2003 16S rRNA- and membrane-binding domains of Era (Eur. J. Biochem. 270) 4165 DNA manipulation Plasmids were purified using a plasmid purification spin kit (Qiagen Inc.). To isolate DNA fragments after restriction digestion, reaction mixtures were subjected to agarose gel electrophoresis. The bands containing the DNA fragments of interest were cut out from the gel and the DNA fragments were purified using an Ultrafree DA column, according to the manufacturer’s instructions (Amicon Bioseparations). Competent cells of E. coli XL1-Blue-mRF¢ and BL21(DE3) LysS were purchased from Stratagene and Novagen, res- pectively. The transformation of plasmids and the prepar- ation of competent cells of E. coli HT120, LY12 (E. coli K12 wild-type) were performed as described previously [24]. Construction of recombinant plasmids for expressing C-terminally truncated Era proteins in GST fusion form To express Era, Era-C, and Era-N of S. pneumoniae in GST-fusion form, the pGEX vectors (Amersham Biotech) were used. The era genes of S. pneumoniae that encode the full-length protein (299 codons), the N-terminal domain (1–185 codons), and the C-terminal domain (141–299 codons) are designated era, era-N, and era-C, respectively, and their corresponding gene products are designated Era, Era-N, and Era-C, respectively. To generate deletions of era, a PCR method was used [24]. The full-length era gene of S. pneumoniae, carried on plasmid pLY41, was used as template for the amplification of era-N and era-C using the primers designed as described below. The era-N gene was cloned into pGEX-2T at the BamHI site. A 5¢-PCR primer was designed, which contained a BamHI site followed by an NdeI site. These two restriction sites contained an ATG start codon. The 3¢-PCRprimerwasdesignedtocontainaTCA stop codon followed by a BamHI site at the end of the gene. The 5¢-and3¢-PCR primers used for the amplification of era-N are 5¢-GTTCCGCGT GGATCCCATATGAC-3¢ and 5¢-CATTTCTGAAACTAA GGATCCTCATGGAT GATCTGTGATTTGATCAGACG-3¢, respectively [dou- ble underlined sequences are the NdeIsiteandthestop codon (TCA)]. The orientation of the DNA insert was determined by restriction digestion using StyIandEcoRI. The era-C gene was cloned into pGEX-4T at BamHI and NotIsites.The5¢-PCR primer was designed to contain a BamHI site followed by a NdeI site with an ATG start codon. The 3¢-PCR primer was designed to contain a TAA stop codon followed by a NotI site at the end of the gene. The 5¢-and3¢-PCR primers used for the amplification of era-N are as follows: 5¢-GACATC GGATCCCATATGCAAATGGACTTTAA GGAAATTGTTCCA-3¢ and 5¢-GATGTCGGATCC GC GGCCGCTAAGTATTCTCTTTCATTATAGCCA-3¢, respectively. To amplify era, reaction mixtures (100 lL each) con- tained 20 ng of pLY41 (era + ) DNA, 1 · PCR buffer (Gibco BRL), 2 m M MgCl 2 ,0.2m M dNTPs, 10 pmol of each primer, 1.25 U Taq DNA polymerase, and 0.25 U Vent DNA polymerase. The PCR amplification conditions used were as follows: denaturation at 94 °Cfor30s; annealing at 55 °C for 30 s; and polymerization at 72 °Cfor 60 s. PCR products were digested with BamHI, purified using a Qiaquick PCR purification kit (Qiagen), and cloned into pGEX-2T at the BamHI site. The resulting plasmid was designated pLY248 (era-N) and transformed into E. coli XL1 Blue mRF¢ cells. The DNA sequences of the era-N and era-C genes were confirmed by sequencing at the Sequen- cing Facility of Eli Lilly and Company. Construction of recombinant plasmids for complementation studies To test whether 3¢-terminally truncated era genes could complement an E. coli mutant strain deficient in Era production, the following genes were cloned into pACYC184 at the BamHI site, as described above: era, era-N, and era-C. The resulting plasmids were designated as pLY344 (era), pLY353 (era-N), and pLY470 (era-C). The DNA sequences and orientations of the genes cloned in the expression vectors were confirmed by sequencing, as described above. Purification of Era, GST–Era, GST–Era-C, and GST–Era-N proteins For the purification of GST–Era, GST–Era-C, and GST– Era-N proteins, E. coli cells were suspended in 20 m M Tris/ HCl, pH 8.0, containing 50 m M NaCl, and 5 m M MgCl 2 (buffer A). The resulting cell suspensions were disrupted by passage through a French Press cell (Aminco Laboratories, Inc., Rochester, NY, USA) and the resulting cell lysates were centrifuged at 180 000 g for 45 min (Beckman Instru- ments, Inc.). After centrifugation, the supernatant fraction of each lysate was collected, passed through a filter (0.2 lm; Gelman Laboratory, Ann Arbor, MI, USA), and loaded onto a glutathione–Sepharose column (10 mL) that had been equilibrated with buffer A. The column was washed with 100 mL of buffer A and protein was eluted with 30 mL of buffer A containing 10 m M glutathione. All fractions were subjected to SDS/PAGE [24] and those containing GST-fusion protein were collected and stored in small aliquots in 15% glycerol at )80 °C. For in vitro RNA-binding assays, these proteins were purified, as described above, except that buffer A contained 300 m M NaCl because, at high concentrations, salt could disrupt the association of Era with 16S rRNA during purification [19]. The native Era protein of S. pneumoniae was purified from LY42 [E. coli BL21(DE3) plysS/pLY42 (S. pneumo- niae era + Amp r )] cells, as described previously [17,24]. Briefly, a three-step chromatographic method (Source Q, hydroxyapitate, and heparin column chromatography) was used. The purified proteins were dialyzed against 20 m M Tris/HCl, pH 8.0, 5 m M MgCl 2 , and stored at )80 °C. Analysis of the association of RNA with the full-length and truncated Era proteins of S. pneumoniae To determine the association of bacterial rRNA with Era, the proteins were purified by one-step glutathione–Seph- arose column chromatography and the RNA associated with the proteins was extracted as described below. The purified proteins (0.2 mg each) were mixed with an equal volume of phenol/chlorofrom/isoamyl alcohol (25 : 24 : 1, 4166 J. Q. Hang and G. Zhao (Eur. J. Biochem. 270) Ó FEBS 2003 v/v/v) [28]. The extracted materials were precipitated with ethanol [28]. The resulting pellet from each protein prepar- ation was collected, air dried, and resuspended in 30 lL of RNase-free water (Ambion, Austin, TX, USA). The resulting preparations (15 lL each) were analyzed by agarose gel electrophoresis (1.5%) and stained with 0.5% ethidium bromide in Tris/borate/EDTA buffer [28]. Total RNAs of E. coli were isolated from E. coli LY12, as described above [28]. The intensity of each RNA band was quantified using IMAGEQUANT software (version 5.1; Molecular Dynamics) after scanning agarose gels using a FluorImager 757 (Molecular Dynamics). The in vitro RNA-binding assay, using the poly(U) RNA immobilized onto Sepharose, was employed [19] and modified as described below. Poly(U)–Sepharose resin (Pharmacia) was washed four times with water and resuspended as a 50% slurry. Purified proteins (150 pmol) wereaddedto175lL of binding buffer (25 m M Tris/HCl, pH 7.5, 150 m M NaCl, 2.5 m M MgCl 2 , 0.1% Triton-X100) and 25 lL of slurry at 23 °C. The mixtures were incubated for 40 min, washed five times with 1 mL of binding buffer, and resuspended in 15 lLof2· SDS/PAGE loading buffer (Invitrogen). The resulting preparations were boiled for 4 min and subjected to SDS/PAGE (12% polyacryl- amide) followed by Western blotting analysis, as described previously [24]. Briefly, transfer (25 V, constant) was carried out in 12 m M Tris/HCl, 96 m M glycine, and 20% methanol at room temperature for 2 h by using a Blot Module (Invitrogen). The poly(vinylidene difluoride) membrane was blocked in NaCl/P i , pH 7.4 (Gibco BRL), containing 5% dry milk (Bio-Rad) at 4 °C overnight, incubated with primary antibodies (diluted 1 : 500) and secondary anti- bodies (diluted 1 : 2000) for 2–3 h at room temperature, and then washed three times with NaCl/P i . The poly(viny- lidene difluoride) membranes were incubated in a solution containing 5-bromo-4-chloroindol-2-yl phosphate and Nitro Blue tetrazolium (Sigma) until the desired color developed. Protein concentrations were determined using the Bradford assay kit (Bio-Rad) with BSA as a standard. To evaluate the potential inhibition of RNA binding by liposome and phospholipids, the RNA-binding assay was performed in the presence of liposome or phospholipids for 10 min before addition of the Era protein. The intensity of each band was quantified by using an Imaging Densitometer (Model GS-700; Bio-Rad) after scanning the membrane. GTPase activity assay and enzyme kinetics GTP hydrolysis activities of S. pneumoniae Era, Era-N, and Era-C proteins were assayed by using an HPLC method [17,18]. Reaction mixtures (100 lL each) containing 50 m M Tris/HCl, pH 7.5, 5 m M MgCl 2 , and 3.45 l M of Era, Era-N, and Era-C proteins, were incubated at room temperature (23 °C). To initiate the reactions, GTP was added at concentrations of 62.5–1000 l M . The reactions were stopped by adding 5 lLof1 M HCl at time zero or after 30 min of incubation. Then, the reaction mixtures (50 lL each) were injected into a Nov-Pak C-18 column (3.9 mm · 150 mm, 4 lm; Waters) and separated under isocratic conditions (79 m M potassium phosphate, pH 6.0, 4m M tetrabutyl ammonium hydrogen sulfate, and 21% methanol). The GDP produced was quantified by compar- ing its peak areas with those of GDP standards. As GDP was bound to the protein when purified, the total amount of GDP produced after 30 min of incubation was calculated by subtracting the GDP present at the start of the reaction. Complementation of an E. coli mutant strain, HT120, defective in Era production, by truncated era genes of S. pneumoniae pET-11a and pGEX plasmids carrying the S. pneumoniae era, era-N, and era-C genes, were transformed into E. coli HT120, as described above. The resulting transformants were selected on LB plates containing appropriate anti- biotics as indicated in each experiment. The LB plates were incubated at 31 °C for 24 h and examined for growth. Analysis of the association of the truncated Era proteins of S. pneumoniae with the cytoplasmic membrane To examine the association of Era, Era-N, and Era-C of S. pneumoniae with the cytoplasmic membrane, E. coli BL21 (DE3) pLysS cells were first grown in LB medium containing 100 lgÆmL )1 ampicillin overnight at 35 °C. The overnight cultures (9 mL each) were inoculated into 300 mL of LB medium supplemented with ampicillin. The cultures were grown for 1 h at 33 °C and then induced with 1m M IPTG for 2 h. The cells were collected, washed, resuspended in 3 mL of buffer C (20 m M Tris/HCl, pH 7.0, 5m M MgCl 2 ), and disrupted as described above. The resulting crude extracts were diluted to 6 mL with buffer C and centrifuged at 12 000 g for 12 min to remove unbroken cells and potential inclusion bodies. The supernatant fractions (2 mL each) were mixed with 0.5 mL of buffer C and loaded onto a sucrose gradient (2 mL of 25% sucrose solution) in a polyallomer tube (13 · 51 mm; Beckman) and centrifuged at 120 000 g for 50 min (SW50.1 rotor; Beckman). The supernatant fractions, designated as cyto- plasmic preparations, were collected. The resulting pellets, designated as membrane preparations, were washed with 5 mL of buffer C and then resuspended in 3 mL of buffer C. The membrane preparations were collected by centrifuga- tion at 140 000 g for 40 min (SW 50.1 rotor; Beckman) and resuspended in buffer C containing 0.5% SDS. The protein concentrations of the cytoplasmic and membrane prepara- tions were determined using a Dc protein assay kit (Bio- Rad). Both the cytoplasmic and membrane preparations (40 lg of each) were subjected to SDS/PAGE followed by Western blotting analysis, as described above. Growth characteristics The cells of LY12 (E. coli K12 wild-type strain) carrying the genes on pGEX, which encoded GST–Era, GST–Era-N, GST–Era-C, and GST, were cultured overnight. The overnight cultures were washed once, using LB, and transferred into 5 mL of LB containing 100 lgÆmL )1 ampicillin. The density of all cultures was adjusted to an A 600 of 0.04 before use. When the cultures reached an A 600 of 0.2, 1 m M IPTG was added to the growth medium. The cultures were allowed to grow at 37 °C with vigorous Ó FEBS 2003 16S rRNA- and membrane-binding domains of Era (Eur. J. Biochem. 270) 4167 shaking (225 r.p.m.) and the cell growth was monitored hourly by measuring the cell density at A 600 (Spectronic 20 Genesys Spectrophotometer; Spectronic Instruments). Cell viability was examined using a Nikon Eclipse E800 microscope. The nucleoids of the cells were stained with 4¢,6¢-diamidino-2-phenylindole (DAPI), as described by Johnstone et al. [19]. Results Effects of the deletion of the RNA- and membrane- binding domains of S. pneumoniae Era on the GTPase activity of the protein To assess the potential effects of removal of the RNA- and membrane-binding domains on the GTPase activity of Era, we measured the GTPase activity of the purified Era proteins. GST–Era-N, purified using one-step glutathione- affinity column chromatography, exhibited a K m value similar to that of GST-Era, but a lower V max value (Table 1). These results indicate that removal of the KH domain does not significantly affect the binding of GTP to Era, but does reduce the GTP hydrolysis activity (by approximately threefold). As expected, Era-C, whose GTPase domain was removed, completely lost GTPase activity. These results, consistent with those of previous studies [20], demonstrate that the GTPase domain is a separate functional entity. Effects of deletion of the GTPase domain on the 16S rRNA-binding activity of Era Sequence comparison of the S. pneumoniae and E. coli Era proteins showed that both proteins are similar (43% identity and 63% similarity, respectively). On the basis of the sequence similarities between the two Era proteins and the X-ray crystal structure of the E. coli Era protein [14], a computer-based modeling analysis of S. pneumoniae Era indicated that this protein also contains a KH domain with a similar baab folding structure (Fig. 1A,B). Removal of this KH domain of S. pneumoniae Eraresultedinthelossof 16S rRNA-binding activity [20]. Thus, the KH domain is required for 16S rRNA-binding activity. However, it is not clear whether the binding of Era to 16S rRNA requires the GTPase activity of the protein. Furthermore, it is not known whether the KH domain of Era is a separate, functional entity that structurally does not require the GTPase domain for activity. To examine these aspects further, we determined whether the KH domain of Era could bind 16S rRNA in the absence of the GTPase domain. First, we constructed expression systems that produced GST–Era-N and GST–Era-C proteins. Then, we purified these truncated proteins and compared their 16S rRNA-binding activity with that of the full-length Era. Surprisingly, Era-C, the C-terminal part of Era, which corresponds to the KH domain, was able to bind to 16S Fig. 2. Analysis of RNA association with Era, Era-C, and Era-N of Streptococcus pneumoniae. Era proteins were expressed, purified, and analyzed for their association with RNA, as described in the Materials and methods. (A) Association of Era proteins with 16S rRNA. Lane 1, total rRNA isolated from Escherichia coli; lanes 2–5, phenol/chloroform extracted materials from purified glutathione S-transferase (GST)–Era, GST–Era-N, GST–Era-C, and GST alone, respectively; lane 6, DNA standards (1 kb increments). (B) Binding of Era to poly(U) homopolymeric RNA. In all cases, 150 pmol of protein was used in the binding assays except for lane 6 in which 200 ng of GST–Era was directly loaded onto the gel without being subjected to the poly(U) RNA-binding assay. Lane 1, molecular weight markers (Bio-Rad broad range); lanes 2–5, GST–Era, GST–Era-N, GST–Era-C, or GST alone; and lane 6, GST–Era (200 ng) that was not subjected to the poly(U) RNA-binding assay. Table 1. Kinetic properties of glutathione S-transferase (GST)–Era, GST–Era-C, and GST–Era-N of Streptococcus pneumoniae. NA, not applicable; ND, not detected. Protein K m (l M ) V max (mmolÆmin )1 Æmol )1 ) GST–Era (full length) 271 ± 130.6 170.0 ± 31.2 GST–Era-N (amino acids 1–181) 276 ± 75.2 61.6 ± 1.0 GST–Era-C (amino acids 141–299) NA ND 4168 J. Q. Hang and G. Zhao (Eur. J. Biochem. 270) Ó FEBS 2003 rRNA (Fig. 2A, lane 4). The amount of 16S rRNA bound to Era-C was similar to that of the full-length Era, as demonstrated by fluorescent scanning analysis (Fig. 2A, lanes 2 and 4, data not shown). In contrast, Era-N, which did not contain the KH domain, failed to bind 16S rRNA (Fig. 2A, lane 3). Together, these results show that the KH domain of Era is a separate functional entity whose RNA- binding activity does not require the presence of the GTPase activity biochemically or the GTPase domain structurally. To further confirm these results, we also constructed expression systems producing similar truncated Era pro- teins of E. coli and Mycoplasma pneumoniae and com- pared their 16S rRNA-binding activity with that of the full-length Era proteins. The C-terminal parts of both Era proteins were able to bind to 16S rRNA in the absence of the N-terminal GTPase domain and the amount of the RNA bound to the proteins was similar to that of the full-length proteins (data not shown). Furthermore, the N-terminal parts of both Era proteins failed to bind 16S rRNA. Thus, the C-terminal KH domain of Era, which alone can bind to 16S rRNA, appears to be a highly conserved structural entity among Gram-negative and Gram-positive bacteria, and Mycoplasma. It has been reported that some of the mutations in the GTPase domain of E. coli Era decreased the ability of the protein to bind to homopolymeric poly(U) RNA in an in vitro assay [19]. To further examine whether the GTPase activity might biochemically, or the GTPase domain structurally, influence the binding of Era to RNA, we analyzed, using an in vitro binding assay, the ability of Era, Era-N, and Era-C to bind to homopolymeric RNA immobilized onto Sepharose. The Era protein preparations used in this assay were purified, in the presence of 300 m M NaCl, to remove 16S rRNA associated with the protein during purification. As shown in Fig. 2B (lanes 2 and 4), both the full-length Era and Era-C were able to bind poly(U), albeit with slightly different affinities. The molar amount of Era-C bound with poly(U) was 60% of that for the full-length Era. On the other hand, the amount of Era-N associated with poly(U) was virtually undetectable and similar results were obtained with the control GST protein (Fig. 2B, lanes 3 and 5). Thus, removal of the GTPase domain of Era did not significantly affect the binding of the protein to RNA in vitro or in vivo. Effects of the deletion of the GTPase domain on the cytoplasmic membrane-binding activity of Era To examine the effect of domain removal on the membrane- binding activity of Era, we expressed Era, Era-C, and Era-N in E. coli, isolated the cytoplasmic and membrane fractions of E. coli that overexpressed the proteins, and measured their membrane-binding activities, as described above in the Materials and methods. The cytoplasmic and membrane fractions prepared were subjected to Western blotting analysis. Era and Era-C were found to be associated with the membrane (Fig. 3, lanes 2 and 8). In addition, the amounts of protein distributed between the cytoplasmic and membrane fractions were the same for Era and Era-C (Fig. 3, lanes 1–2, 7–8). In contrast, Era-N, although highly expressed in the cells, was not significantly associated with the membrane (Fig. 3, lanes 4–5). Previous studies have shown that Era is distributed approximately equally between the cytoplasm and the cytoplasmic membrane [24–26,29]. However, the amount of Era-N remaining in the membrane fraction was only 10–16% of that in the cytoplasmic fraction. Together, these results indicated that the C-terminus of Era retains the structural integrity for the RNA- and membrane-binding activities. The results also indicated that the GTPase activity of Era is not necessary for the membrane-binding activity of Era. Inhibition of Era binding to poly(U) RNA by liposome As shown previously, the KH domain of Era is required for the binding of the protein to 16S rRNA, and part of the domain is also required for the binding of the protein to membrane. Thus, the regions critical for the membrane- and 16S rRNA-binding activities of Era appear to overlap. As shown above, Era from S. pneumoniae wasabletobindto poly(U) (Fig. 4A, lane 2). To further examine this bio- chemically, we performed the in vitro RNA-binding experi- ments (see the Materials and methods) using poly(U) in the presence or absence of liposome. In the absence of liposome, Era was able to bind to poly(U), as shown above. In the presence of liposome, the amount of Era bound to poly(U) decreased significantly (Fig. 4A, lanes 3–5). Scanning ana- lysis indicated that the amount of Era bound to poly(U) decreased proportionally with an increase in the concentra- tion of liposome (Fig. 4B). Further analysis indicated that 50% inhibition was achieved at a liposome concentration of 0.86 ngÆlL )1 . Therefore, this study provides direct biochemical evidence that the membrane- and RNA- binding sites of Era overlap. To further understand the inhibition of liposome on the binding of Era to poly(U), we analyzed the effects of different component lipids of the liposome on the ability of the protein to bind to poly(U). As shown in Fig. 4C, the binding of Era to poly(U) was significantly inhibited in the presence of a 10-fold excess of unbound cognate poly(U) (lanes 1 and 3). Interestingly, the amount of Era bound to Fig. 3. Analysis of the association with the C-terminal part (Era-C) of Streptococcus pneumoniae ErawiththeEscherichia coli cytoplasmic membrane. The cytoplasmic and membrane preparations of E. coli cells expressing Era-C, Era and Era-N were prepared, subjected to SDS/PAGE, and analysed by Western blotting. Arrows indicate the position of each Era protein. Lanes 1, 4, and 7, the cytoplasmic preparations ÔCÕ of E. coli cells expressing glutathione S-transferase (GST)–Era, GST–Era-N, and GST–Era-C, respectively; lanes 2, 5, and 8, the membrane preparations ÔMÕ of E. coli cells expressing GST–Era, GST–Era-N, and GST–Era-C, respectively; lanes 3, 6, and 9, the crude lysates ÔRÕ collected before ultracentrifugation (at 120 000 g)ofE. coli cells expressing GST–Era, GST–Era-N, and GST–Era-C, respectively. Ó FEBS 2003 16S rRNA- and membrane-binding domains of Era (Eur. J. Biochem. 270) 4169 poly(U)–Sepharose in the presence of PtdGro was 41% of that in the absence of PtdGro (Fig. 4C, lanes 1 and 4). The inhibitory effect of PtdGro is comparable to that of poly(U) (Fig. 4C, lanes 3 and 4). The amount of Era associated with poly(U) in the presence of PtdEtn was 114% of that in the absence of PtdEtn (Fig. 4C, lanes 1 and 5). Therefore, PtdEtn did not appear to inhibit the binding of Era to poly(U) RNA. The results indicate that the inhibition of the binding of Era to RNA by liposome is specific and that PtdGro, a major component of liposome, appears to be mainly responsible for the inhibition. The physiological implications of these findings are discussed below. Effects of overexpression of Era-C and Era-N on cell growth and morphology To further understand the physiological role of Era, we overexpressed the full-length and truncated proteins in E. coli and compared their effects on bacterial growth. If both the membrane- and 16S rRNA-binding activities of Era are required for normal function, overexpression of the C-terminal part of Era may interfere with cell growth by directly competing with the wild-type Era to bind to 16S rRNA or the cytoplasmic membrane. The pGEX plasmids, carrying the full-length and truncated era genes, were transformed into LY12 (a wild-type E. coli K-12 strain), and the growth rates of these strains were analysed in the presence of IPTG. As shown in Fig. 5, when Era and Era-N were overexpressed in E. coli, these cells exhibited the same growth rate (88 min) as the wild-type E. coli cells carrying the pGEX plasmid. However, the overexpression of Era-C in the cell resulted in a moderate reduction in growth rate (112 min). The results suggest that the overexpression of Era-C inhibited bacterial growth. The results also support the notion [10] that the RNA- and membrane-binding domain of Era may be involved in the regulation of cell cycle. Fig. 4. Inhibition of the binding of Streptococcus pneumoniae Era to poly(U) RNA by liposome. In each case, Era (5 lg or 150 pmol) was used. (A) Inhibitory effect of liposome on the binding of Era to Poly(U) RNA. Lane 1, protein molecular mass standards (Bio-Rad broad-range); lanes 2–5, the binding of Era to poly(U) RNA in the presence of 0, 0.1, 0.6, or 1.2 lgÆlL )1 of liposome; lane 6, purified Era (200 ng). (B) The amount of Era bound to poly(U) RNA in the presence of different amounts of liposome. (C) The binding of Era to poly(U)–Sepharose in the presence of liposome, free poly(U), phos- phatidylethanolamine (PtdEtn), or phosphatidylglycerol (PtdGro). The amount of Era to bound poly(U) in the absence of liposome (lane 1), or in the presence of 1.2 lgÆlL )1 liposome (lane 2), 10-fold excess of poly(U) (lanes 3), 1.2 lgÆlL )1 PG (lane 4), 1.2 lgÆlL )1 PtdEtn (lane 5) or 200 ng of purified Era (lane 6). Fig. 5. Effects of the overexpression of Streptococcus p neu monia e Era-CaswellasEraandEra-NonEscherichia coli K-12 cells. The E. coli cells containing era, era-N, or era-C carried on pGEX were grown in Luria–Bertani (LB) medium containing 100 lgÆlL )1 ampi- cillin. The growth of bacterial cells was monitored by measurement at A 600 . For the induction of protein expression, 1 m M isopropyl- b- D -thiogalactopyranoside (IPTG) was added to the culture when it reached an A 600 of 0.2. 4170 J. Q. Hang and G. Zhao (Eur. J. Biochem. 270) Ó FEBS 2003 Interestingly, the overexpression of Era-C and Era-N in the cell resulted in morphological changes, i.e. elongation and the formation of short rod-shaped cells (data not shown). Staining analysis of the cells with DAPI showed that these elongated cells contained between two and four nucleoids (data not shown). The results suggest that the loss of 16S rRNA- and membrane-binding activities, as well as GTPase activity, significantly affected the physiology of E. coli cells. It is not clear why the overexpression of Era-C and Era-N in the cell resulted in similar abnormal morphological changes. Finally, we further confirmed that the GTPase activity, and the RNA- and membrane-binding activities of Era are essential for bacterial growth. When the era-N and era-C genes carried on pACYC184 were transformed into an E. coli strain defective in Era production, they failed to restore cell growth. However, when the era gene carried on the same plasmid was transformed into these cells, it restored cell growth. Therefore, these results further confirm the essentiality of the RNA- and membrane-binding activities of the Era for growth. Discussion In this study, we examined the biochemical and structural requirements of the RNA- and membrane-binding activities of Era. We showed that the C-terminal part of Era, which lacks the GTPase domain, retains 16S rRNA- and mem- brane-binding activities. We also demonstrated that the RNA-binding activity was inhibited by liposome, and identified PtdGro as a major active component of liposome that inhibits this RNA-binding activity. Finally, we showed that the overexpression of Era-C inhibited bacterial growth and resulted in morphological changes. The KH domain has been found to exist in several RNA- binding proteins, including hnRNPK [30], Sam68 [31,32], yeast MER1 [33], and FMR1 [27,34]. It was not known whether the prokaryotic KH domain, like the eukaryotic KH domains, is a biochemically and structurally separate entity that is self-sufficient in the binding of RNA. In this study, we demonstrated, for the first time, that the prokaryotic KH domain, when separated from the GTPase domain, binds to 16S RNA as effectively as the wild-type Era. These results indicate that the C-terminal part of Era, which contains the RNA-binding domain, is a structural entity independent of the GTPase domain and does not require the GTPase domain for its activity (see below). The results are also consistent with the observation that guanine nucleotides do not have any apparent effect on the in vitro RNA-binding activity of Era [19]. We could not, however, exclude the possibility that interactions exist between the RNA-binding domain and the GTPase domain which may play a role in the regulation of the RNA-binding activity and thereby the physiological function in the cell. Previous studies have suggested that some mutations in the GTPase domain of E. coli Era influence the binding of the protein to RNA, but some do not [19]. The results of this study demonstrated that the binding of Era to 16S rRNA does not require the GTPase domain of Era. In addition, the results of the in vitro RNA-binding experiments also demonstrated that the KH domain of Era was able to bind poly(U) RNA. Therefore, the mutational effects on the RNA-binding activity are probably a result of their effects on the structure of the Era KH domain, which explains why some of the mutations affected the activity, and others did not. Membrane-associated GTPases are important signaling regulators in eukaryotic cells where the GTP-bound form of GTPase is required for pathway activation. For example, ras and ras-like proteins represent a distinct class of the membrane-associated GTPases that are ubiquitous in eukaryotic cells and are essential for normal cell growth and development [15,16]. It was thought that Era might be involved in a GTPase receptor-coupled membrane-signaling pathway [10,25]. In an in vitro experiment designed to test the binding of purified Era to the cytoplasmic membrane, Lin et al. [25] found that purified Era was able to bind to the membrane and that this binding activity was stimulated by the presence of guanine nucleotides in the assay mixture [25]. These results are in contrast to our finding, in this study, that the binding of Era to the membrane does not require GTPase activity of the protein. At present, we do not understand the discrepancy between the findings of these two studies. We previously reported that the regions required for the RNA- and membrane-binding activities of Era appeared to overlap [20]. These results suggest that the binding of Era to RNA may compete with the binding of Era to the cytoplasmic membrane. Consistent with this contention, the binding of Era to poly(U) RNA was inhibited by liposome composed mainly of the two major components of lipids, PtdEtn and PtdGro. Of the two, PtdGro exhibited an inhibitory effect on the binding of Era to RNA. The results appear to support our previous hypotheses that the RNA- free form of Era may be sequestered by the membrane and that the RNA- and membrane-binding activities of Era may play a role in regulating the physiological function of the protein. In addition, overexpression of Era-C inhibited the growth of the organism. This is again consistent with our hypothesis. It is possible that the large amount of Era-C produced in the cell can bind to the membrane or 16S rRNA, which, in turn, prevents the wild-type Era from binding to the membrane or RNA. As a result, the function of the wild-type Era is inhibited. Acknowledgements We thank Timothy I. Meier and Kelly A. McAllister for help, advice and stimulating discussions during the course of this work. This work was supported by a Lilly Postdoctoral Research Grant. References 1. Ahnn,J.,March,P.E.,Takiff,H.E.&Inouye,M.(1986)AGTP- binding protein of Escherichia coli has homology to yeast RAS proteins. Proc. Natl Acad. Sci. USA 83, 8849–8853. 2. Fleischmann, R.D., Adams, M.D., White, O., Clayton, R.A., Kirkness, E.F., Kerlavage, A.R., Bult, C.J., Tomb, J.F., Dougherty, B.A., Merrick, J.M., et al. (1995) Whole-genome random sequencing and assembly of Haemophilus influenzae Rd. Science 269, 496–512. 3. Fraser, M., Gocayne, J.D., White, O., Adams, M.D., Clayton, R.A., Fleischmann, R.D., Bult, C.J., Kerlavage, A.R., Sutton, G., Kelley, J.M., et al. (1996) The minimal gene comple- ment of Mycoplasma genitalium. Science 270, 397–403. Ó FEBS 2003 16S rRNA- and membrane-binding domains of Era (Eur. J. Biochem. 270) 4171 4.Kawabata,S.,Terao,Y.,Andoh,T.&Hamada,S.(1997) Nucleotide sequence and molecular characterization of a gene encoding GTP-binding protein from Streptococcus gordonii. FEMS Microbiol. Lett. 156, 211–216. 5. Zuber, M., Hoover, T.A., Dertzbaugh, M.T. & Court, D.L. (1997) A Francisella tularensis DNA clone complements Escherichia coli defective for the production of Era, an essential Ras-like GTP- binding protein. Gene 189, 31–34. 6. Zuber, M., Hoover, T.A., Powell, B.S. & Court, D.L. (1990) Analysis of the rnc locus of Coxiella burnetii. Mol. Microbiol. 14, 291–300. 7. Pillutla, C.R., Sharer, J.D., Gulati, P.S., Wu, E., Yamashita, Y., Lerner, C.G., Inouye, M. & March, P.E. (1995) Cross-species complementation of the indispensable Escherichia coli era gene highlights amino acid regions essential for activity. J. Bacteriol. 177, 2194–2196. 8. Pillutla, C.R., Ahnn, J. & Inouye, M. (1996) Deletion of the putative effector region of Era, an essential GTP-binding protein in Escherichia coli, causes a dominant-negative phenotype. FEMS Microbiol. Lett. 143, 47–55. 9. Lerner, C.G. & March, P.E. (1991) Pleiotropic changes resulting from depletion of Era, an essential GTP-binding protein in Escherichia coli. Mol. Microbiol. 5, 951–957. 10. Britton, R.A., Powell, B.S., Dasgupta, S., Sun, Q., Margolin, W., Lupski, J.R. & Court, D.L. (1998) Cell cycle arrest in Era GTPase mutants: a potential growth rate-regulated checkpoint in Escher- ichia coli. Mol. Microbiol. 27, 739–750. 11. Gollop, N. & March, P.E. (1991) A GTP-binding protein (Era) has an essential role in growth rate and cell cycle control in Escherichia coli. J. Bacteriol. 173, 2265–2270. 12. Britton, R.A., Chen, S.M., Wallis, D., Koeuth, T., Powell, B.S., Shaffer, L.G., Largaespada, D., Jenkins, N.A., Copeland, N.G., Court, D.L. & Lupski, J.R. (2000) Isolation and preliminary characterization of the human and mouse homologues of the bacterial cell cycle gene, Era. Genomics 67, 78–82. 13. Akiyama,T.,Gohda,J.,Shibata,S.,Nomura,Y.,Azuma,S., Ohmori,Y.,Sugano,S.,Arai,H.,Yamamoto,T.&Inoue,J. (2001) Mammalian homologue of E. coli Ras-likeGTPase(ERA) is a possible apoptosis regulator with RNA binding activity. Genes Cells 6, 987–1001. 14. Chen, X., Court, D.L. & Ji, X. (1999) Crystal structure of ERA: a GTPase-dependent cell cycle regulator containing an RNA-bind- ing motif. Proc. Natl Acad. Sci. USA 96, 8396–8401. 15. Bourne, H.R., Sanders, D.A. & McCormick, F. (1990) The GTPase superfamily: a conserved switch for diverse cell functions. Nature 348, 125–132. 16. Bourne, H.R., Sanders, D.A. & McCormick, F. (1991) The GTPase superfamily: conserved structure and molecular mechanism. Nature 349, 117–127. 17. Meier, T.I., Peery, R.B., Jaskunas, S.R. & Zhao, G. (1999) 16S rRNA is bound to Era of Streptococcus pneumoniae. J. Bacteriol. 181, 5242–5249. 18. Meier, T.I., Peery, R.B., McAllister, K.A. & Zhao, G. (2000) Era GTPase of Escherichia coli: binding to 16S rRNA and modulation of GTPase activity by RNA and carbohydrates. Microbiology 146, 1071–1083. 19. Johnstone, B.H., Handler, A.A., Chao, D.K., Nguyen, V., Smith, M., Ryu, S.Y., Simons, E.L., Anderson, P.E. & Simons, R.W. (1999) The widely conserved Era G-protein contains an RNA- binding domain required for Era function in vivo. Mol. Microbiol. 33, 1118–1131. 20. Hang, J.Q., Meier, T.I. & Zhao, G. (2001) Analysis of the inter- action of 16S rRNA and cytoplasmic membrane with the C-terminal part of the Streptococcus pneumoniae Era GTPase. Eur. J. Biochem. 268, 5570–5577. 21. Britton, R.A., Powell, B.S., Court, D.L. & Lupski, J.R. (1997) Characterization of mutations affecting the Escherichia coli essential GTPase Era that suppress two temperature-sensitive dnaG alleles. J. Bacteriol. 179, 4575–4582. 22. Inada, T., Kawakami, K., Chen, S., Takiff, H.E., Court, D.L. & Nakamura, Y. (1989) Temperature-sensitive lethal mutant of Era, a G protein in Escherichia coli. J. Bacteriol. 171, 5017–5024. 23. Nashimoto, H. (1993) Non-ribosomal proteins affecting the assembly of ribosomes in Escherichia coli.InThe Translational Apparatus. (Nierhaus, H.K., Franceschi, F., Subramanian, A.R., Erdmann, V.A. & Wittmann-Liebold, B., eds), pp. 185–195. Plenum Press, New York. 24. Zhao, G., Meier, T.I., Peery, R.B. & Skatrud, P.L. (1999) Bio- chemical and molecular analyses of the C-terminal domain of Era GTPase from Streptococcus pneumoniae. Microbiology 145, 791–800. 25. Lin, Y.P., Sharer, J.D. & March, P.E. (1994) GTPase-dependent signaling in bacteria: characterization of a membrane-binding site for Era in Escherichia coli. J. Bacteriol. 176, 44–49. 26. Baev, D., England, R. & Kuramitsu, H.K. (1999) Stress-induced membrane association of the Streptococcus mutans GTP-binding protein, an essential G protein, and investigation of its physiolo- gical role by utilizing an antisense RNA strategy. Infect. Immun. 67, 4510–4516. 27. Siomi, H., Siomi, M.K., Nussbaum, R.L. & Dreyfuss, G. (1993) The protein product of the fragile X gene, FMR1, has char- acteristics of an RNA-binding protein. Cell 74, 291–298. 28. Sambrook, J., Fritsch, E.F. & Maniatis, T. (1989) Molecular Cloning: a Laboratory Manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY. 29. Gollop, N. & March, P.E. (1991) Localization of the membrane- binding sites of Era in Escherichia coli. Res. Microbiol. 142, 301–307. 30. Siomi, H., Matunis, M.J., Michael, W.M. & Dreyfuss, G. (1993) The pre-mRNA-binding K-protein contains a novel evolutionarily conserved motif. Nucleic Acids Res. 21, 1193–1198. 31. Fumagalli, S., Totty, N.F., Hsuan, J.J. & Courtneidge, S.A. (1994) A target for Src in mitosis. Nature 368, 871–874. 32. Lock, P., Fumagalli, S., Polakis, P., McCormick, F. & Court- neidge, S.A. (1996) The human p62 cDNA encodes Sam68 and not the RasGAP-associated p62 protein. Cell 84, 23–24. 33. Nandabalan, K. & Roeder, G.S. (1995) Binding of a cell-type- specific RNA splicing factor to its target regulatory sequence. Mol. Cell. Biol. 15, 1953–1960. 34. Siomi, H., Chol, M., Siomi, M.C., Nussbaum, R.L. & Dreyfuss, G. (1994) Essential role for KH domains in RNA-binding: impaired RNA-binding by a mutation in the KH domain of FMR1 that causes fragile X syndrome. Cell 77, 33–39. 4172 J. Q. Hang and G. Zhao (Eur. J. Biochem. 270) Ó FEBS 2003 . [19]. Results Effects of the deletion of the RNA- and membrane- binding domains of S. pneumoniae Era on the GTPase activity of the protein To assess the potential effects of removal of the RNA- and membrane-binding. Characterization of the 16S rRNA- and membrane-binding domains of Streptococcus pneumoniae Era GTPase Structural and functional implications Julie Q. Hang 1 and Genshi Zhao 2 1 Roche. not clear whether the binding of Era to 16S rRNA requires the GTPase activity of the protein and whether the RNA-binding domain can bind RNA in the absence of the GTPase domain. Structurally,