Báo cáo khoa học: Probing the determinants of substrate specificity of a feruloyl esterase, AnFaeA, from Aspergillus niger doc

Probing the determinants of substrate specificity of a feruloyl esterase, AnFaeA, from Aspergillus niger Craig B. Faulds 1 , Rafael Molina 2 , Ramo ´ n Gonzalez 3 , Fiona Husband 1 , Nathalie Juge 1,4 , Julia Sanz-Aparicio 2 and Juan A. Hermoso 2 1 Institute of Food Research, Colney, Norwich, UK 2 Grupo de Cristalografia Macromolecular y Biologia Estructural, Instituto de Quı ´ mica Fı ´ sica ‘Rocasolano’, CSIC, Madrid, Spain 3 Departamento de Microbiologia, Instituto de Fermentaciones Industriales, CSIC, Madrid, Spain 4 Institut Me ´ diterrane ´ en de Recherche en Nutrition, Universite ´ Paul Ce ´ zanne, Marseille, France The plant cell wall is a complex mixture of polysaccha- rides, proteins, phenolics and lipids. The polysaccha- rides form the skeleton of the plant cell wall, and are composed of cellulose microfibrils embedded within a matrix of hemicellulose or pectin, depending on the plant tissue. Hemicelluloses are the most abundant renewable polymers after to cellulose and they are the key components in the degradation of plant biomass. However, this degradative process is often inefficient because most polymers of cellulose and hemicellulose are either insoluble or simply too closely associated with the insoluble matrix. In cereals, the main hemi- cellulosic polymer is arabinoxylan, which is composed of a b-(1,4) glycosidic-linked d-xylopyranosyl units, substituted at positions O-2orO-3 with arabinose. To deconstruct or modify arabinoxylans, plants or micro- organisms require a battery of glycoside hydrolases (xylanases, a-arabinofuranosidases, b-xylosidases, glu- curonidases) and esterases (feruloyl, acetyl). Feruloyl esterases (EC 3.1.1.73) release ferulic acid (FA) Keywords active site specificity; Aspergillus niger; ferulic acid; feruloyl esterase; plant cell wall Correspondence C. B. Faulds, Institute of Food Research, Norwich Research Park, Colney, Norwich NR4 7UA, UK Fax: +44 160 350 7723 Tel: +44 160 325 5152 E-mail: craig.faulds@bbsrc.ac.uk (Received 10 March 2005, revised 27 May 2005, accepted 7 July 2005) doi:10.1111/j.1742-4658.2005.04849.x Feruloyl esterases hydrolyse phenolic groups involved in the cross-linking of arabinoxylan to other polymeric structures. This is important for open- ing the cell wall structure making material more accessible to glycoside hydrolases. Here we describe the crystal structure of inactive S133A mutant of type-A feruloyl esterase from Aspergillus niger (AnFaeA) in complex with a feruloylated trisaccharide substrate. Only the ferulic acid moiety of the substrate is visible in the electron density map, showing interactions through its OH and OCH 3 groups with the hydroxyl groups of Tyr80. The importance of aromatic and polar residues in the activity of AnFaeA was also evaluated using site-directed mutagenesis. Four mutant proteins were heterologously expressed in Pichia pastoris, and their kinetic properties determined against methyl esters of ferulic, sinapic, caffeic and p-coumaric acid. The k cat of Y80S, Y80V, W260S and W260V was drastically reduced compared to that of the wild-type enzyme. However, the replacement of Tyr80 and Trp260 with smaller residues broadened the substrate specificity of the enzyme, allowing the hydrolysis of methyl caffeate. The role of Tyr80 and Trp260 in AnFaeA are discussed in light of the three-dimen- sional structure. Abbreviations AnFaeA, an A-type feruloyl esterase from Aspergillus niger; AXE, acetylxylan esterase; diFA, diferulic acid; FA, ferulic acid; FAE_XynY, Clostridium thermocellum celulosomal xylanase Y domain that displays feruloyl esterase activity; FAE_XynZ, Clostridium thermocellum celulosomal xylanase Z domain that displays feruloyl esterase activity; FAXX, O-[5-O-[(E)-feruloyl]-a- L-arabinofuranosyl}-(1fi3)-O-b-D- xylopyranosyl-(1fi4)- D-xylopyranose; MCA, methyl caffeate (methyl 3,4-dihydroxycinnamate); MFA, methyl ferulate (methyl 4-hydroxy- 3-methyoxycinnamate); MpCA, methyl p-coumarate (methyl 4-hydroxycinnamate); MSA, methyl sinapate (methyl 3,5-dimethoxy-4- hydroxycinnamate). 4362 FEBS Journal 272 (2005) 4362–4371 ª 2005 FEBS (Fig. 1) from arabinose-substituted xylans and rhamnogalacturonans [1]. While most of the feruloyl esterases to date have been grouped into the carbo- hydrate esterase family 1 [2] (for more information, see http://www.afmb.cnrs-mrs.fr/CAZY/), a complement- ary classification based on amino acid sequence simi- larities and substrate specificity has putatively grouped feruloyl esterases into four types, A–D [3]. AnFaeA is a type-A feruloyl esterase isolated from Aspergillus niger [4]. From protein sequence homology, feruloyl esterases belong to the same family as the serine proteases, est- erases and lipases, with a serine residue acting as the nucleophile in a catalytic triad comprising the hydroxyl group of the active serine, the imidazole side chain of histidine and a buried carboxylic acid chain [5]. Although the mechanism of deferuloylation has not been reported, it is probable, based on the general hydrolytic mechanism of esterases [6], that the basic His248 (AnFaeA numbering) removes a proton from the hydroxyl group of Ser133 and that the nucleophilic oxygen attacks the carbonyl carbon of the feruloyl group to form a tetrahedral intermediate. Amino acids with aromatic side chains play a pro- minent role in binding carbohydrates [7]. The hydro- phobic patch of a sugar moiety, resulting from the disposition of the equatorial and axial hydroxyls to one side of the pyranose ring of a sugar monomer, aligns itself upon binding with the aromatic ring face of the amino acid to contribute to selectivity of fit of the substrate to the binding site of the enzyme [8]. Tryptophan has been shown to be essential for sub- strate binding in most of the glycoside hydrolases stud- ied to date, such as cellulases [9], xylanases [8,10,11] and a-amylases [12]. The protein sequence of AnFaeA, showed the presence of four tryptophan residues in the molecule [13] and chemical modification of the mature protein with N-bromosuccinimide (NBS) demonstrated that one tryptophan essential for activity was exposed on the surface of the enzyme [14]. The structure of AnFaeA has recently been solved (PDB accession numbers 1USW, 1UZA, 1UWC) [15,16]. The enzyme displays an a ⁄ b hydrolase fold [17] similar to that found in fungal lipases, such as those from Thermomyces lanuginosa [18] and Rhizo- mucor miehei [19]. This structure is different from that reported for the feruloyl esterases from Clostridium thermocellum [20,21], although the catalytic triads can be superimposed allowing direct extrapolation of the position of the oxyanion pocket. Crystallography and point replacement of the nucleophilic serine of An- FaeA, Ser133, allowed the identification of the active site, confined by a lid (residues 68–90) and a loop (resi- dues 226–244) which confers plasticity to the substrate binding site [15]. While structurally resembling lipases, AnFaeA does not exhibit lipase activity [22]. From these studies we postulated that Tyr80 could play an essential role in substrate binding and specificity. In addition, Trp260, located at the C terminus and near the surface is the closest tryptophan to the active centre. In this study, we used site-directed mutagenesis and X-ray crystallography to give insights into the specifi- city and affinity of AnFaeA for methyl hydroxycin- namic acid substrates. Results and Discussion Crystal structure of the S133A AnFaeA–FAXX complex and design of AnFaeA mutants To determine which residues are important for the interaction of ferulate and ester-linked carbohydrates with AnFaeA, the crystal structure of the inactive S133A nucleophilic mutant of AnFaeA complexed to the feruloylated trisaccharide O-[5-O-[(E)-feruloyl]- a-l-arabinofuranosyl}-(1(q)3)-O-b- d-xylopyranosyl- (1fi4)-d-xylopyranose (FAXX) was solved at 2.5-A ˚ resolution. AnFaeA requires both the hydroxycinna- mate as well as a carbohydrate grouping as part of the substrate for optimal activity, and a feruloylated trisac- charide consisting of the linkage of sugars found in FAXX has been shown to be the optimal size of sub- strate [23]. Three molecules of S133A AnFaeA mutant are present in the asymmetric unit and show no signifi- cant differences between the native and mutant struc- tures, as revealed by the low r.m.s.d. deviation of their backbones (0.47 A ˚ ) after superimposition of both structures. The electron density maps revealed the presence of a FA moiety bounded at the active site in the three molecules of the asymmetric unit (not shown). However, the remaining groups of the sub- strate (i.e. the arabinose and the two xylose units) were not visible in the 2Fo–Fc map, neither difference map indicated the presence of carbohydrate groups. As the HO OH OCH 3 O H 3 CO HO OH O DC HO O OH OH B HO OH OCH 3 O A Fig. 1. Hydroxycinnamic acids. (A) Ferulic acid. (B) Caffeic acid. (C) Sinapic acid. (D) p-Coumaric acid. C. B. Faulds et al. Substrate specificity of AnFaeA of A. niger FEBS Journal 272 (2005) 4362–4371 ª 2005 FEBS 4363 S133A mutant is inactive [15], the substrate should be complete and therefore the carbohydrate moiety is probably disordered. The substrate is placed in a long and narrow cavity (Fig. 2A). The active site cavity is mainly confined by the flap (residues 68–80) and the 226–244 loop (Fig. 2B). As shown in Fig. 3, the arrangement of the FA in the active site is essentially the same to that observed in the high-resolution struc- ture of the AnFaeA–FA complex determined by McAuley et al. (PDB code 1UWC) [16]. The FA inter- acts (Fig. 2B,C) through the OH group at C4 with the hydroxyl group of Tyr80 in the enzyme substrate com- plex. Despite the apparently long distance found in the present structure (3.8 A ˚ ) the hydroxyl group of Tyr80 probably interacts with the OCH3 group at C-3 as it also occurs in the high resolution structure of 1UWC [16]. Tyr80 is one of the residues that takes part in the formation of the substrate cavity and its arrangement delimitates the long substrate cavity where the aroma- tic ring of the FA is placed (Fig. 4A). Moreover, the global arrangement of residues in the substrate cavity provides a molecular surface in which OCH3 group fits perfectly (Fig. 4A). The carboxylate moiety is located at the oxyanion hole defined by the Leu134-N main- chain and both the backbone N atom and the OH group from Thr68. Leu199, Val243 and Ile196 provide the hydrophobic environment to stabilize the aromatic and the hydrocarbon chain of the FA. The importance of the interaction between an aromatic tyrosine and the phenolic ring of the substrate is consistent with the biochemical specificity of this enzyme [4,24]. The role of Tyr100 was previously probed by site-directed muta- genesis; mutating the Phe100 (AnFaeA numbering) of the lipase from Thermomyces lanuginose to Tyr was essential to confer ferulate ester-hydrolysing activity [25]. Of the four tryptophan residues in the sequence of AnFaeA, only one is located near the surface, as demonstrated by chemical modification, and is essen- tial for activity [14]. Trp260 is the terminal residue, located on a flexible loop [15] and although far from the active site, this residue is the closest Trp in the vicinity of the active site, and is thus a probable candi- date for substrate specificity (Fig. 4B). This residue is buried in a hydrophobic cavity surrounded by Met253, Thr19 and Ala23 side chains. In the present work, site- directed mutagenesis is used to probe the role of polar- ity and ⁄ or hydrophobicity in the environment of Tyr80 and Trp260. The active site of AnFaeA is placed in a long and narrow cavity that connects two crevices at the molecular surface [15], displaying hydrophobic residues that stabilizes the aromatic moiety of the substrate. As with the structure of the C. thermocellum feruloyl Fig. 2. Crystal structure of the S133A AnFaeA mutant in complex with FAXX. (A) Molecular surface of S133A AnFaeA mutant. The catalytic triad and the Y80 and W260 residues are labelled. Ferulic acid molecule is coloured in cyan. (B) Environment of FA (green) in the active site of S133A. The flap region of AnFaeA is highlighted in dark blue. (C) Proposed interactions of FA with residues at the substrate cavity of AnFaeA. Substrate specificity of AnFaeA of A. niger C. B. Faulds et al. 4364 FEBS Journal 272 (2005) 4362–4371 ª 2005 FEBS esterase in complex with FAXX, FAE_XynZ-FAXX (1JT2) [21], the FA moiety is clearly visible in the act- ive site but the carbohydrate parts of the substrate are not visible, suggesting that tight binding of the carbo- hydrate is not required for catalysis. Production and characterization of AnFaeA variants All four mutants (Y80S, Y80V, W260S, W260V) were efficiently produced in Pichia pastoris as confirmed by SDS ⁄ PAGE and western blot analysis with anti-FaeA polyclonal antibodies. Purified recombinant variants were obtained in yields ranging from 163 mgÆL )1 (Y80V) to 628 mgÆL )1 (W260V) using a single chroma- tographic step (hydrophobic interaction: HIC). While wild-type AnFaeA was purified using the phenyl seph- arose HIC column [26], the mutants were retained on the column, even by reducing the hydrophobicity of the buffer. Due to this, these four variants of AnFaeA were then purified using a butyl sepharose column. To evaluate the consequence of altering the hydro- phobicity or the bulking effect in the active site of AnFaeA around the Tyr80 mutation, and the effect of altering the only surface exposed tryptophan residue, Trp260, on activity, the four variants were tested on the methyl esters of hydroxycinnamic acids: methyl ferulate (MFA) and compared to wild-type AnFaeA. All of the variants displayed feruloyl esterase activity albeit at a reduced value compared to the wild-type enzyme. The effects of these mutations on the secon- dary structure of the Y80V, Y80S, W260V, W260S were tested by CD. All mutants show an increase in a-helix content, reflecting possible small local structural rearrangements (Table 1). However, as the kinetic values for Y80S and Y80V and for W260S and W260V were similar, such changes in structure did not duly affect the catalytic arrangement of the enzyme. Kinetic analyses and substrate specificity of AnFaeA variants The kinetic parameters (k cat and K m ) of the Y80V, Y80S, W260V, W260S mutants were determined Fig. 3. Superimposition of the complex S133A AnFaeA–FA (orange), native structure (red) and AnFaeA–FA complex deter- mined by McAuley [16] (blue). In the case of AnFaeA–FA complex determined by McAuley [16], apart from the active histidine confor- mation (blue) the inactive histidine conformation form (grey) is also found. Fig. 4. Local environment of Tyr80 and Trp260. (A) Arrangement of the Tyr80 residue. Ferulic acid is shown in blue, Tyr80 is shown in red and the residues that participate in the substrate cavity are shown in green. (B) Arrangement of Trp260 residue (red). The resi- dues that bury Tpr260 are shown in blue. C. B. Faulds et al. Substrate specificity of AnFaeA of A. niger FEBS Journal 272 (2005) 4362–4371 ª 2005 FEBS 4365 against MFA, methyl sinapate (MSA), methyl caffeate (MCA) and methyl p-coumarate (MpCA) (Fig. 1). All variants showed a significant decrease in the hydrolytic rate compared to the wild-type enzyme in addition to a slight increase in K m for all the substrates, except for MCA (Table 2). The decrease in the hydrolytic rate was between 1.5- and 4-fold, with the largest changes occurring with MFA and MSA as substrates. Both Tyr80 and Trp260 variants were able to hydrolyse MCA. The type of substitution on the phenolic ring of the substrate is important for defining the type of feru- loyl esterase [3,24]. Previous inhibition studies showed that AnFaeA binds MCA but does not hydrolyse it, suggesting that the enzyme possesses a fairly nonspe- cific binding site [24]. In the present study, replacement of Tyr80 or Trp260 by a nonaromatic amino acid resulted in the reduction in the activity and broadened the specificity of AnFaeA for phenolic acids, in partic- ular for MCA. From the close up view of the phenolic binding pocket (Fig. 2) it is clear that two tyrosine residues, Tyr80 and Tyr100, are closely located near the substit- uent groups around the phenolic ring, in agreement with the results from the mutagenesis study. It is pos- sible that the removal of the bulky tyrosine from the pocket in the mutant variants must result in a local realignment allowing the accommodation of a hydro- xyl group at O-3 of FA instead of the methoxyl group. In comparison, the structures of the two feruloyl esterases from C. thermocellum, FAE_XynY (PDB accession code 1GKK) [20] and FAE_XynZ (1JJF) [21] show that ferulate binds in a small blunt-ended surface depression, with the hydroxyl group interacting with an Asp residue and the methoxyl group with a Trp, instead of Tyr as in AnFaeA. The tryptophan did not form a direct stacking interaction with the phenolic ring of FA, instead contributing to the hydro- phobic environment by forming a small cavity with a leucine residue on one side of the binding depression [20]. The structural implication of Trp260 in binding of the substrate is less clear. Although relatively far from the active site ( 14 A ˚ ) (Fig. 2a), biochemical evidence demonstrated that Trp260 interacted with the active site pocket, as modification of AnFaeA with 4500-fold excess of N-bromosuccinimide (a chemical oxidizer of Trp residues) resulted in an 80% loss of activity against MSA [14]. This is not due to this residue hav- ing a role in enzyme stability, as joining a bacterial dockerin domain to the C-terminal end of AnFaeA through Trp260 did not significantly affect the activity of the feruloyl esterase [27]. One hypothesis is that Trp260 may be in a position to interact with the car- bohydrate moiety of a feruloylated polysaccharide. In FAE_XynZ, the C-terminal tryptophan, Trp265, is located in a hydrophobic pocket of primarily aromatic residues adjacent to the binding pocket [21] whereas it is absent in FAE_XynY [28]. However, the interactions between Trp260 and the sugar moieties of the substrate could not be directly demonstrated due to both the lack of resolved sugar interactions in the AnFaeA– FAXX complex, and the nature of the methyl Table 1. Secondary structure of wild type and mutant AnFaeA, from circular dichroism and SELCON analysis. a-Helix b-Sheet b-Turn Aperiodic Native 30.6 17.4 22.4 29.7 Y80S 53.5 8.9 15.9 23.7 Y80V 38.7 15.5 20.6 27.8 W260S 33.9 18 20.7 26.2 W260V 37.8 17.2 19.6 26.2 Table 2. Kinetic parameters of the wild-type and mutated AnFaeA determined against the methyl esters (1 mM) of ferulate (MFA), sinapate (MSA), caffeate (MCA) and p-coumarate (MpCA). nd, Activity not detected. Substrate Wild type Y80S Y80V W260S W260V MFA k cat (molÆs )1 Æmol )1 ) 70.74 (± 1.44) 1.56 (± 0.04) 2.56 (± 0.08) 20.06 (± 0.67) 18.33 (± 0.44) K m (mM) 0.78 (± 0.05) 1.22 (± 0.07) 1.17 (± 0.08) 0.88 (± 0.07) 1.01 (± 0.06) Catalytic efficiency 90.7 1.3 2.2 22.8 18.1 MSA k cat (molÆs )1 Æmol )1 ) 84.95 (± 2.26 3.48 ± 0.11) 7.85 (± 0.28) 27.76 (± 0.62) 28.28 (± 0.49) K m (mM) 0.24 (± 0.02) 0.84 (± 0.07) 1.23 (± 0.09) 0.35 (± 0.02) 0.76 (± 0.03) Catalytic efficiency 354.0 4.1 6.4 79.5 37.0 MCA k cat (molÆs )1 Æmol )1 ) nd 0.01 (± 0.002) 0.02 (± 0.002) 0.32 (± 0.02) 0.26 (± 0.02) K m (mM) nd 3.84 (± 0.82) 3.02 (± 0.52) 4.10 (± 0.34) 4.72 (± 0.45) Catalytic efficiency nd 0.003 0.006 0.079 0.055 MpCA k cat (molÆs )1 Æmol )1 ) 0.73 (± 0.05) 0.10 (± 0.003) 0.26 (± 0.01) 0.49 (± 0.02) 0.29 (± 0.02) K m (mM) 4.26 (± 0.45) 2.07 (± 0.11) 2.88 (± 0.14) 3.26 (± 0.31) 3.99 (± 0.33) Catalytic efficiency 0.17 0.05 0.09 0.15 0.07 Substrate specificity of AnFaeA of A. niger C. B. Faulds et al. 4366 FEBS Journal 272 (2005) 4362–4371 ª 2005 FEBS hydroxycinnamates used as substrates. Alternatively, from the 3D structure and the measured effects on the kinetic parameters, it is possible to hypothesize that this tryptophan affects the mobility of the catalytic his- tidine [29]. Such a shift was reported in the side chain position of His260 and His247 in the FAE_XynZ– FAXX [21] and the AnFaeA–FA complexes [16], respectively. While in the free enzyme His247 is present in a single conformation corresponding to the active orientation for a catalytic histidine residue, in the case of the enzyme–product complex His247 can move pro- viding an inactive form. As it was described in the high resolution AnFaeA–FA complex [16], in the complex structure His247 can present two histidine conforma- tions which easily interconvert from an active to an inactive form. However in our case, the S133A AnFaeA–FA electron density maps did not reveal any difference between the arrangement of His247 in the complexed and free enzyme structures, as His247 is always in the active conformation (Fig. 3). In FAE_XynZ, Trp265 is only 4 A ˚ from the catalytic his- tidine (His247) [21], allowing direct interaction, which is not the case in AnFaeA. In other carbohydrate- active esterases, the exposed catalytic His187 residue of the acetylxylan esterase, AXE-II, of P. purporogenum forms a hydrogen bond with a sulphate ion forcing the histidine to adopt an altered conformation [30]. This has also been observed with a cutinase from Fusarium solani [31]. With AXE-II, transition of histidine from a resting state to an active state necessitated the rear- rangement of other residues of the active site, most notably the movement of Tyr177 which moved 2 A ˚ away to accommodate the catalytic histidine in the act- ive state. While no change in the position of His247 was determined when the free and complexed struc- tures were compared, Trp260 still can influence both catalytic rate and specificity. The role of Trp260 in the catalytic mechanism of AnFaeA requires further exam- ination. The above differences in reported structures and activities of feruloyl esterases are reflected in the cladogram for carbohydrate-active esterases with known 3D structures (Fig. 5). While AnFaeA closely resembles the lipases of Rhizomucor meihei and Thermomyces lanuginosa, of the feruloyl esterases, FAE_XynZ from C. thermocellum shows the closest homology. AnFaeA releases 5,5¢ diFA from cereal- derived material [32] and the 3D structure shows how the dimer can be accommodated within the active site [15]. The structure of FAE_XynZ suggested that the open and solvent-exposed FA binding site can interact with diFA [15], while FAE_XynY could not accommo- date such a substrate. This is in agreement with the closeness demonstrated in the phylogenic analysis (Fig. 3). FAE_XynY, on the other hand, is further removed from AnFaeA and may resemble more the acetylxylan esterases of Penicillium purpogenum (1BS9) [30] and Trichoderma reesei (1QOZ) [33]. Further bio- chemical characterization of these enzymes is required to test these hypotheses. Experimental procedures Site-directed mutagenesis In vitro site-directed mutagenesis of the faeA gene on plas- mid pFAE-W was performed by using the QuickChange TM Site-Directed Mutagenesis Kit from Stratagene (La Jolla, CA, USA) following the manufacturer’s instructions with two exceptions: DH5a Escherichia coli cells where used instead of Epicurian Coli XL1-Blue, and the elongation step in each thermal cycle was extended from the recom- mended 18 s (2 s per kb) to 25 s. Alanine, serine and valine replacement codons were chosen taking into account codon usage in yeast. Two complementary oligonucleotides were used for replacement of S133A, W260V or W260S, how- ever, following the observations of Makarova et al . [34], a single primer was successfully used for Y80V or Y80S replacements. The plasmids carrying the resulting mutant faeA alleles were called pFAE-S133A, pFAE-W260V, pFAE-W260S, pFAE-Y80V and pFAE-Y80S, respectively. Table 3 shows the sequence of all the oligonucleotides used in this work. In all cases, the plasmid region containing the faeA gene, as well as the AOX1 promoter and terminator, was sequenced completely to rule out the presence of any additional mutation. Spheroplasts from Pichia pastoris strain GS115 were transformed with these plasmids, by using the Pichia expression kit from Invitrogen (Carlsbad, CA, USA) and His + Mut S strains were selected for the expression of the mutated versions of AnFaeA. CtXYNZ AnFAEA RmLipase TiLipase CtXYNY PpAXEll TrAXE PpAXEl Fig. 5. Cladogram of feruloyl esterases and related enzymes of known 3D structure. Enzyme names are shown on the right hand side of the tree: CtXYNZ, Clostridium thermocellum FAE_XynZ (M22624); AnFAEA, Aspergillus niger FaeA (AF361950); RmLipase, Rhizomucor miehei lipase (P19515); TiLipase, Thermomyces lanugi- nosus lipase (O59952); CtXYNY, Clostridium thermocellum FAE_XynY (X83269); PpAXEII, Penicillium purporogenum acetylxy- lan esterase-II (AF015285); TrAXE, Trichoderma reesei acetylxylan esterase I (S71334); PpAXEI, Penicillium purporogenum acetylxylan esterase-I (AAM93261). C. B. Faulds et al. Substrate specificity of AnFaeA of A. niger FEBS Journal 272 (2005) 4362–4371 ª 2005 FEBS 4367 Purification of the AnFaeA mutants AnFaeA mutants were purified from the P. pastoris cultures by HIC based on previously described protocols [26]. Apart from the wild-type and S133A mutant, the other mutants were retained on a phenyl-sepharose column (Amersham Biotech, Little Chalfont, Bucks, UK), even after a water elution. A butyl-sepharose column (Amersham Biotech) was used to purify these mutants. Crystallization, data collection and processing Co-crystallization of S133A AnFaeA–FAXX complex was performed by the hanging-drop, vapour-diffusion method at 291 K, testing the conditions obtained for the native pro- tein (1.8 m ammonium sulphate, 0.1 m Hepes, pH 7.5). FAXX was purified from Driselase-hydrolysed de-starched wheat bran, as described previously [35]. After preliminary trials, crystals suitable for X-ray studies were obtained by mixing 4 lL of a well solution (1.7 m ammonium sulphate), 1 lL of FAXX substrate (10 mm) and 2 lL of the mutant enzyme solution at 12 mgÆmL )1 . The crystals were tested on an in-house MAR Research IP area detector with CuKa X-rays (k ¼ 1.5418 A ˚ ) generated by an Enraf-Nonius rotating anode generator, but diffraction data were of low resolution. Consequently, synchrotron radiation was used. Data sets were collected at ESRF (ID14-4 beamline), with k ¼ 0.9184 A ˚ . All data were processed and scaled using mosflm [36] and scala from CCP4 package software [37]. Data processing statistics are given in Table 4. The crystals belong to space group P2 1 , with unit cell dimensions a ¼ 46.74 A ˚ , b ¼ 130.75 A ˚ , c ¼ 76.51 A ˚ and b ¼ 98.14°A ˚ . Spe- cific volume calculations yielded three molecules of S133A AnFaeA in the asymmetric unit, with a solvent content of 55.3% (v ⁄ v) (V M ¼ 2.75 A ˚ 3 ÆDa )1 ). Structure determination The structure of the S133A AnFaeA–FAXX complex was determined by the molecular replacement method using the program amore [38,39]. The atomic coordinates of the AnFaeA (PDB code 1USW) were used as the search model for a rotational and translational search in the 49–3.5 A ˚ resolution range. We obtained a good solution for three molecules in the asymmetric unit and the values of the final correlation coefficient and R factor were 0.70 and 21.6%, respectively. The structure was refined with cns [40] up to 2.5 A ˚ resolution using strict ncs refinement, and restrained ncs refinement in the last stages. Refinement statistics are given in Table 4. Table 3. Sequences of the oligonucleotides used for site directed mutagenesis. Primer Sequence 5¢fi3¢ Mutant S133A-S CTTACCGTGACAGGCCATGCTCTGGGAGCGTCGATG S133A S133A-A CATCGACGCTCCCAGAGCATGGCCTGTCACGGTAAG S133A Y80V-S GCTCGATACTAACGTCACGCTCACGCCATTCG Y80V Y80S-S GCTCGATACTAACTCCACGCTCACGCCATTCG Y80S W260V-S GATGACGAGCGGAGCTTGTACTGTGTAGTAGAAGC W260V W260V-V GCTTCTACTACACAGTACAAGCTCCGCTCGTCATC W260V W260S-S GATGACGAGCGGAGCTTGTACTTCCTAGTAGAAGC W260S W260S-V GCTTCTACTAGGAAGTACAAGCTCCGCTCGTCATC- W260S Table 4. Data collection and refinement statistics for the S133A AnFAEA mutant in complex with FAXX. Values in parentheses cor- respond to the highest resolution shell. R factor ¼ P h ||F obs |–|F calc || ⁄ P |F obs |, eE h ||F obs |–|F calc || ⁄ O ´ |F obs |, where F obs and F calc are observed and calculated structure factor amplitudes, respectively. R free calculated for 7% of data excluded from the refinement. X-ray source Synchrotron Temperature (K) 100 Space group P2 1 Unit cell parameters a (A ˚ ) 46.74 b (A ˚ ) 130.75 c (A ˚ ) 76.51 b (°) 98.14 Wavelength (A ˚ ) 0.9184 Resolution limit (A ˚ )2.4 Total no. of reflections 108677 Unique reflections (n) 35 001 Redundancy 3.1 (3.1) Completeness (%) 98.6 (99.4) I ⁄ r 5.9 (2.3) R merge 0.16 (0.49) Refinement statistics Resolution range (A ˚ ) 49–2.5 R factor 0.21 R free 0.27 Residues (n) 780 Water molecules (n) 375 Ferulic acid molecules (n) 3 N-acetyl glucosamine molecules (n) 6 r.m.s.d. from ideal Bond lengths (A ˚ ) 0.007 Bond angles (°)1.3 Substrate specificity of AnFaeA of A. niger C. B. Faulds et al. 4368 FEBS Journal 272 (2005) 4362–4371 ª 2005 FEBS Model quality and accuracy The final model consists of three molecules of S133A AnFaeA (A, B, C), three FA molecules (one per S133A AnFaeA molecule) and 375 water molecules. As the native structure, the S133A AnFaeA is glycosylated at Asp79 and two molecules of N-acetyl glucosamine residue were built at each glycosylation site. In the complex, the electron density maps in this region reveal a carbohydrate structure larger than only two units of N-acetyl glucosamine but this could not be modelled because of the poor electron density defini- tion. The stereochemical quality of the model was checked with the program procheck [41]. The figures were gener- ated with molscript [42], raster 3d [43] and grasp [44]. The atomic coordinates and structure factors for S133A AnFaeA–FA complex have been deposited in the Protein Data Bank, with accession number 2BJH. Gel electrophoresis and immunoblotting SDS ⁄ PAGE was carried out on a 10% Bis ⁄ Tris precast NuPAGE gel (Invitrogen) with wild-type AnFaeA as a marker. Proteins were transferred to nitrocellulose mem- branes by semidry blotting (Bio-Rad, Hercules, CA, USA). The blotted membranes were probed with a 1000-fold dilu- tion of polyclonal antiserum raised in rabbits against AnFaeA [45]. Immunoreactive proteins were visualized using alkaline phosphatase-conjugated anti-rabbit secon- dary antibody (Sigma, St Louis, MO, USA; 1 : 2000). Circular dichroism Circular dichroism spectra were collected using a JASCO 710 spectropolarimeter (Great Dunmow, Cambs, UK). Far UV CD spectra were recorded at 0.5 mgÆ mL )1 with a 0.2-mm path length cell. The spectra shown are an average of four accumulations, with a scan speed of 100 nmÆmin )1 , band width 1 nm, response 1 s, data pitch 0.2 nm and range 260–190 nm. Analysis of the spectra was estimated using selcon [46]. Enzyme assays Feruloyl esterase activity, assayed with hydroxycinnamate methyl esters, was determined by HPLC for all the AnFaeA mutants as described previously [26]. All measurements were carried out in 100 mm Mops pH 6.0 at 37 °C. In all measurements, the free acid present in samples pretreated with glacial acetic acid was subtracted from that in the test assays. One unit of esterase activity was defined as the amount of enzyme required to release 1 lmol hydroxy- cinnamic acidÆmin )1 Æmg protein )1 at 37 °C, pH 6.0. The kinetic results obtained from the hydrolysis of a range of 0.2–2 mm methyl hydroxycinnamates was interpreted using the Michaelis–Menten kinetic model, using grafit [47]. For each variant and each substrate, at least 10 substrate concentrations were measured in duplicate. Phylogenetic analyses Multiples alignment of sequences encoding feruloyl ester- ases and related enzymes such as lipases, and construction of neighbor-joining cladogram [48], were performed with clustal w (http://www.ebi.ac.uk/clustalw/) [49]. Acknowledgements This work was funded by the Biotechnology and Bio- logical Research Council (BBSRC), UK through an ISIS travel grant to CBF and by the BBSRC and the Department of Trade and Industry (DTI), UK, through the award of an Applied Biocatalysts Link award (grant number ABC11741). References 1 Faulds CB (2003) Feruloyl esterases: Molecular tools to unravel cell structure. Recent Res Dev Appl Microbiol Biotechnol 1, 245–275. 2 Coutinho PM & Henrissat B (1999) Carbohydrate- active enzymes: an integrated database approach. In Recent Advances in Carbohydrate Bioengineering (Gilbert HJ, Davies GJ, Henrissat B & Svensson B, eds), pp. 3–12. Royal Society of Chemistry, Cambridge. 3 Crepin VF, Faulds CB & Connerton IF (2004) Func- tional recognition of new classes of feruloyl esterases. Appl Microbiol Biotechnol 63, 647–652. 4 Faulds CB & Williamson G (1994) Purification and characterization of a ferulic acid esterase (FAE-III) from Aspergillus niger: specificity for the phenolic moiety and binding to microcrystalline cellulose. Micro- biology 140, 779–787. 5 Walsh C (1976) Enzymatic Reaction Mechanism. W.H. Freeman & Co, San Francisco. 6 Blow DM (1976) Structure and mechanism of chymo- trypsin. Biochemistry 9, 145–152. 7 Vyas NK (1991) Atomic features of protein–carbohy- drate interactions. Curr Opin Struct Biol 1, 732–740. 8 Quiocho FA (1986) Carbohydrate-binding proteins: ter- tiary structures and protein–sugar interactions. Ann Rev Biochem 55, 278–315. 9 Clarke AJ (1987) Essential tryptophan residues in the function of cellulase from Schizophyllum commune. Biochim Biophys Acta 912, 424–431. 10 Keskar SS, Srinivasan MC & Deshpande VV (1989) Chemical modification of a xylanase from a thermotoler- ant Streptomyces. Evidence for essential tryptophan C. B. Faulds et al. Substrate specificity of AnFaeA of A. niger FEBS Journal 272 (2005) 4362–4371 ª 2005 FEBS 4369 and cysteine residues at the active site. Biochem J 261, 49–55. 11 Deshpande V, Hinge J & Rao M (1990) Chemical modi- fication of xylanases: evidence for essential tryptophan and cysteine residues at the active site. Biochim Biophys Acta 1041, 172–177. 12 Gibson RM & Svensson B (1986) Chemical modifica- tion of barley malt a-amylase 2: involvement of trypto- phan and tyrosine residues in enzyme activity. Carlsberg Res Comm 51, 295–308. 13 de Vries RP, Michelsen B, Poulsen CH, Kroon PA, van den Heuvel RHH, Faulds CB, Williamson G, van den Hombergh JPTW & Visser J (1997) The faeA genes from Aspergillus niger and Aspergillus tubingensis encode ferulic acid esterases involved in degradation of complex cell wall polysaccharides. Appl Environ Microbiol 63, 4638–4644. 14 Aliwan FO (1998) Mechanism, structure and specificity of a feruloyl esterase from Aspergillus niger. PhD Thesis, University of East Anglia, Norwich, UK. 15 Hermoso JA, Sanz-Aparicio J, Molina R, Juge N, Gonzalez R & Faulds CB (2004) The crystal structure of feruloyl esterase A from Aspergillus niger suggests evolutive functional convergence in feruloyl esterase family. J Mol Biol 338, 495–506. 16 McAuley KE, Svendsen A, Patkar SA & Wilson KS (2004) Structure of a feruloyl esterase from Aspergillus niger. Acta Crystallogr D60, 878–887. 17 Ollis DL, Cheah E, Cygler M, Dijkstra F, Frolow F, Franken SM, Harel M, Remington SJ, Silman I, Scrag J, Sussman JL, Verschueren KHG & Glodman A (1992) The a ⁄ b hydrolase fold. Prot Eng 5, 197–211. 18 Lawson DM, Brzozowski AM, Dodson GG, Hubbard RE, Huge-Jensen B, Boel E & Derewenda ZS (1994) The three-dimensional structures of two lipases from filamentous fungi. In Lipases: Their Biochemistry, Structure and Application (Woolley P & Petersen S, eds), pp. 77–94. Cambridge University Press, Cambridge, UK. 19 Derewenda ZS, Derewenda U & Dodson G (1992) The crystal and molecular structure of the Rhizomucor mie- hei triacylglyceride lipase at 1.9A ˚ resolution. J Mol Biol 227, 818–839. 20 Prates JAM, Tarbouriech N, Charnock SJ, Fontes CMGA, Ferreira LMA & Davies GJ (2001) The struc- ture of the feruloyl esterase module of xylanase 10B from Clostridium thermocellum provides insights into substrate recognition. Structure 9, 1183–1190. 21 Schubot FD, Kataeva IA, Blum DL, Shah AC, Ljungdahl LG, Rose JP & Wang BC (2001) Structural basis for the substrate specificity of the feruloyl esterase domain of the cellulosomal xylanase Z from Clostridium thermocellum. Biochemistry 40, 12524–12532. 22 Aliwan FO, Kroon PA, Faulds CB, Pickersgill R & Williamson G (1999) Ferulic acid esterase-III from Aspergillus niger does not exhibit lipase activity. J Sci Food Agric 79, 457–459. 23 Faulds CB, Kroon PA, Saulnier L, Thibault J-F & Williamson G (1995) Release of ferulic acid from maize bran and derived oligosaccharides by Aspergillus niger esterases. Carbohydr Polymers 27, 187–190. 24 Kroon PA, Faulds CB, Bre ´ zillon C & Williamson G (1997) Methyl phenylalkanoates as substrates to probe the active sites of esterases. Eur J Biochem 248, 245–251. 25 Andersen A, Svendsen J, Vind SF, Lassen C, Hjort K, Borch SA & Patkar SA (2002) Studies on ferulic acid esterase activity in fungal lipases and cutinases. Colloids Surf Sect B 26, 47–55. 26 Juge N, Williamson G, Puigserver A, Cummings NJ, Connerton IF & Faulds CB (2001) High-level produc- tion of recombinant Aspergillus niger cinnamoyl esterase (FAEA) in the methylotrophic yeast Pichia pastoris. FEMS Yeast Res 1, 127–132. 27 Levasseur A, Page ` s S, Fierobe H-P, Navarro D, Punt P, Belaı ¨ ch J-P, Asther M & Record E (2004) Design and production in Aspergillus niger of a chimeric protein associating a fungal feruloyl esterase and a clostridial dockerin domain. Appl Environ Microbiol 70, 6984–6991. 28 Blum DL, Kataeva IA, Li X-L & Ljungdahl LG (2000) Feruloyl esterase activity of the Clostridium thermocel- lum cellulosome can be attributed to previously unknown domains of XynY and XynZ. J Bacteriol 182, 1346–1351. 29 Bachovchin WW (1986) 15N NMR spectroscopy of hydrogen–bonding interactions in the active site of serine proteases: evidence for a moving histidine mech- anism. Biochemistry 25, 7751–7759. 30 Ghosh D, Sawick M, Lala P, Erman M, Pangborn W, Eyzaguirre J, Gutie ´ rrez R, Jo ¨ rnvall H & Thiel DJ (2001) Multiple conformations of catalytic serine and histidine in acetylxylan esterase at 0.90A ˚ . J Biol Chem 276, 11159–11166. 31 Longhi S, Czjzek M, Lamzin V, Nicolas A & Cambillau C (1997) Atomic resolution (1.0 A ˚ ) crystal structure of Fusarium solani cutinase: stereochemical analysis. J Mol Biol 268, 779–799. 32 Faulds CB, Zanicelli Z, Crepin VF, Connerton IF, Juge N, Bhat MK & Waldron KW (2003) Specificity of feru- loyl esterases for water-extractable and water-unextract- able feruloylated polysaccharides: influence of xylanase. J Cereal Sci 38, 281–288. 33 Hakulinen N, Tenkanen M & Rouvinen J (2000) Three- dimensional structure of the catalytic core of acetylxylan esterase from Trichoderma reesei: insights into the deacetylation mechanism. J Struct Biol 132, 189–190. 34 Makaroba O, Kamberov E & Margolis B (2000) Gen- eration of deletion and point mutations with one primer in a single cloning step. Biotechniques 29, 970–972. 35 Borneman WS, Hartley RD, Himmelsbach DS & Ljungdahl LG (1990) Assay for trans-p-coumaroyl Substrate specificity of AnFaeA of A. niger C. B. Faulds et al. 4370 FEBS Journal 272 (2005) 4362–4371 ª 2005 FEBS esterase using a specific substrate from plant cell walls. Anal Biochem 190, 129–133. 36 Leslie AGW (1987) Profile fitting. In Proceedings of the CCP4 Study Weekend. (Machin JR & Papiz MZ, eds), pp. 39–50. SERC Daresbury Laboratory, Warrington. 37 Bailey S (1994) The CCP4 Suite: programs for protein crystallography. Acta Crystallogr D50, 760–763. 38 Navaza J (1994) AmoRe: an automated package for molecular replacement. Acta Crystallogr A50, 157–163. 39 Navaza J (2001) Implementation of molecular replace- ment in Amore. Acta Crystallogr D57, 1367–1372. 40 Bru ¨ nger AT, Adams PD, Clore GM, DeLano WL, Gros P, Grosse-Kunstleve RW, Jiang J-S, Kuszewski J, Nilges M, Pannu NS, Read RJ, Rice LM, Simonson T & Warren GL (1998) Crystallography and NMR system: a new software suite for macromolecular struc- ture determination. Acta Crystallogr D54, 905–921. 41 Laskowski RA, MacArthur MW, Moss DS & Thornton JM (1993) PROCHEK: a program to check the stereo- chemical quality of protein structures. J Appl Crystal- logr 26, 283–291. 42 Kraulis P (1991) MOLSCRIPT: a program to produce both detailed and schematic plots of protein structures. J Appl Crystallogr 24, 946–950. 43 Merritt E & Bacon D (1997) Raster3D: a photorealistic molecular graphics. Methods Enzymol 277, 505–524. 44 Nicholls A, Sharp KA & Honig B (1991) Protein fold- ing and association: insights from the interfacial and thermodynamic properties of hydrocarbons. Proteins 11, 281–296. 45 Bre ´ zillon C, Kroon PA, Faulds CB, Brett GM & Williamson G (1996) Novel ferulic acid esterases are induced by growth of Aspergillus niger on sugar-beet pulp. Appl Microbiol Biotechnol 45, 371–376. 46 Sreerama N & Woody RW (1993) A self-consistent method for the analysis of protein secondary structure from circular dichroism. Anal Biochem 209, 32–44. 47 Leadbetter RJ (1998) Grafit, Version 4.0. Erithacus Soft- ware Ltd, Staines, UK. 48 Saitou N & Mei M (1987) The neighbour-joining method: a new method for reconstructing phylogenetic trees. Mol Biol Evol 4, 406–425. 49 Higgins D, Thompson J, Gibson T, Thompson JD, Higgins DG & Gibson TJ (1994) CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, posi- tion-specific gap penalties and weight matrix choice. Nucleic Acids Res 22, 4673–4680. C. B. Faulds et al. Substrate specificity of AnFaeA of A. niger FEBS Journal 272 (2005) 4362–4371 ª 2005 FEBS 4371 . Y80V Y80S-S GCTCGATACTAACTCCACGCTCACGCCATTCG Y80S W260V-S GATGACGAGCGGAGCTTGTACTGTGTAGTAGAAGC W260V W260V-V GCTTCTACTACACAGTACAAGCTCCGCTCGTCATC W260V W260S-S GATGACGAGCGGAGCTTGTACTTCCTAGTAGAAGC W260S W260S-V. Probing the determinants of substrate specificity of a feruloyl esterase, AnFaeA, from Aspergillus niger Craig B. Faulds 1 , Rafael Molina 2 , Ramo ´ n Gonzalez 3 , Fiona Husband 1 , Nathalie. directed mutagenesis. Primer Sequence 5¢fi3¢ Mutant S13 3A- S CTTACCGTGACAGGCCATGCTCTGGGAGCGTCGATG S13 3A S13 3A- A CATCGACGCTCCCAGAGCATGGCCTGTCACGGTAAG S13 3A Y80V-S GCTCGATACTAACGTCACGCTCACGCCATTCG Y80V Y80S-S