Báo cáo khoa học: Probing the determinants of substrate specificity of a feruloyl esterase, AnFaeA, from Aspergillus niger doc

... Y80V Y80S-S GCTCGATACTAACTCCACGCTCACGCCATTCG Y80S W260V-S GATGACGAGCGGAGCTTGTACTGTGTAGTAGAAGC W260V W260V-V GCTTCTACTACACAGTACAAGCTCCGCTCGTCATC W260V W260S-S GATGACGAGCGGAGCTTGTACTTCCTAGTAGAAGC W260S W260S-V ... specificity of a feruloyl esterase, AnFaeA, from Aspergillus niger Craig B. Faulds 1 , Rafael Molina 2 , Ramo ´ n Gonzalez 3 , Fiona Husband 1 , Nathalie Juge 1,4 , J...

Ngày tải lên: 30/03/2014, 20:20

... nicotinamide-nucleotide-dependent oxidative deamination of l-glutamate to 2-oxoglutarate and ammonia and, in different organisms and meta- bolic circumstances, the reaction may function either to release or to assimilate ammonia ... nicotinamide cofactors in the unmutated enzyme. Table 1 shows the separate values of k cat and K m and the derived value for the catalytic efficiency...

Ngày tải lên: 30/03/2014, 03:20

... shift assay and by the self-cleavage assay. (A) A gel image is shown illustrating a direct comparison of the EcoRV–DNA binding by the gel mobility shift assay (left) and by the self-cleavage assay ... Biolabs. Additionally, the slowly associating component is fully capable of cleaving DNA. Only a single component is apparent in the dissociation also using the self-clea...

Ngày tải lên: 22/03/2014, 16:20

... of the family reveals that the three members associated with the fermentative citrate pathways of S. mutans, S. pyogenes and E. faecalis are on a separate branch of the tree that is well separated from ... The results suggest that the complex of Ca 2+ and citrate is the true substrate of EfCitH and that the low uptake in the absence of added Ca 2+ was due t...

Ngày tải lên: 23/03/2014, 10:20

... deleted Plasmids transformed into E. coli BL21(DE3) Activity against 2MA atdA1 pACYC A2 and pET A3 A 4A5 – atdA2 pACYC A1 and pET A3 A 4A5 + atdA3 pACYC A1 A2 and pET A4 A5 – Control (no deletion) pACYC A1 A2 ... of the enzyme. Although the V20 5A muta- tion caused the loss of activity against aniline and 24DMA, the primary goal of this work, which was to probe the mol...

Ngày tải lên: 19/02/2014, 02:20

... that is crucial to the generation and transduction of a mitochondrial signal that regulates copper efflux from the cell. Neither the players nor the molecular mechanisms of the signalling pathway ... COX is the terminal component of the respiratory chain, located in the inner mitochondrial membrane of eukaryotes and in the plasma membrane of many prokaryotes. T...

Ngày tải lên: 14/02/2014, 18:20

... previously, the assay was performed using PNPA or AcCoA as the acetyl donor and one of the fol- lowing primary arylamines as the acetyl acceptor: anisi- dine, PABA, pABglu or PNA [27]. The reaction rates were ... On the basis of the Ping Pong mechanism, the acetylation rate (k 2 )of NAT2 by the acetyl donor is independent of the trans- acetylation rate (k 4 ) of...

Ngày tải lên: 16/03/2014, 00:20

... TGT AAC CAG ATG ATG GC G AGC TCG AAC CTG ACC AAA GAT C3¢ SacI rev 5¢-G ATC TTT GGT CAG GTT C GA GCT CGC CAT CAT CTG GTT ACA G-3¢ L3 5A fw 5¢-G ATG ATG AAG AGC CG GAAT GCC ACC AAA GAT CGA TGC AAG ... revealed that all RNase A variants are active (Table 3). However, while the RNase A variants with mutations in the Ala20 loop region a s well as N 34D- RNase A and L3 5A- RNase A sh...

Ngày tải lên: 16/03/2014, 18:20

... the effects of mutations that retain and those that alter the charge. It may be significant that none of these amino acid side-chains make contact with the carbon substrate or the metal ion cofactor ... worse than 2-acetolactate. Only the expected intermediate HMKB has a k cat ⁄ K m value exceeding that of 2-acetolactate. Based on these data we chose HMKB and 3-hy- droxypyr...

Ngày tải lên: 16/03/2014, 18:20

... was from Stratagene (La Jolla, CA, USA). Bovine trypsin was from Sigma-Aldrich (Oakville, Canada). All restriction enzymes and T4 DNA ligase were from New England Biolabs (Pickering, Canada). All ... required a basic amino acid (Arg) at the P4 position of the substrates to establish k cat ⁄ K m values. The presence of other types of amino acids at this position (Ala, Glu,...

Ngày tải lên: 23/03/2014, 04:21