Analysisofdopaminetransportergene expression
pattern )generationofDAT-iCretransgenic mice
Marc Turiault
1,
*, Se
´
bastien Parnaudeau
1,
*, Aude Milet
1
, Rosanna Parlato
2
, Jean-Denis Rouzeau
1
,
Monique Lazar
1
and Franc¸ois Tronche
1
1 CNRS UMR7148, Molecular Genetics, Neurophysiology and Behavior, Colle
`
ge de France, Institut de Biologie, Paris, France
2 Molecular Biology of the Cell I, German Cancer Research Center, Heidelberg, Germany
Dopamine-synthesizing neurons modulate many biolo-
gical functions in a dynamic manner. In the mamma-
lian brain, dopamine neurons are distributed as groups
of cells in the ventral midbrain area (A8, A9, A10),
diencephalon (A11–A15), olfactory bulb (A16) and
retina (A17). Dopaminergic systems are involved in the
regulation of motor and motivational control, cardio-
vascular and respiratory activities via ascending and
descending projections that are widely distributed in
the mammalian brain and spinal cord [1,2]. In the
ventral midbrain, the A9 nucleus (substantia nigra) has
several functions, including the modulation of motor
control, and the A10 nucleus (ventral tegmental area)
is involved in reward mechanisms. Hypothalamic
Keywords
Cre ⁄ loxP system; dopaminergic cells;
dopamine transporter; gene expression;
transgenic mice
Correspondence
F. Tronche, UMR7148 CNRS, 11 place
Marcelin Berthelot, 75005 Paris, France
Fax: +33 1 44 27 13 22
Tel: +33 1 44 27 13 08
E-mail: francois.tronche@gmail.com
*These authors contributed equally to this
work
(Received 16 February 2007, revised
10 May 2007, accepted 16 May 2007)
doi:10.1111/j.1742-4658.2007.05886.x
The dopaminetransporter is an essential component of the dopaminergic
synapse. It is located in the presynaptic neurons and regulates extracellular
dopamine levels. We generated a transgenic mouse line expressing the Cre
recombinase under the control of the regulatory elements of the dopamine
transporter gene, for investigations ofgene function in dopaminergic neu-
rons. The codon-improved Cre recombinase (iCre) gene was inserted into
the dopaminetransportergene on a bacterial artificial chromosome. The
pattern ofexpressionof the bacterial artificial chromosome–dopamine
transporter–iCre transgene was similar to that of the endogenous dopamine
transporter gene, as shown by immunohistochemistry. Recombinase activ-
ity was further studied in mice carrying both the bacterial artificial chromo-
some–dopamine transporter–iCre transgene and a construct expressing
the b-galactosidase gene after Cre-mediated recombination. In situ studies
showed that b-galactosidase (5-bromo-4-chloroindol-3-yl b-d-galactoside
staining) and the dopaminetransporter (immunofluorescence) had identical
distributions in the ventral midbrain. We used this animal model to study
the distribution ofdopaminetransportergeneexpression in hypothalamic
nuclei in detail. The expression profile of tyrosine hydroxylase (an enzyme
required for dopamine synthesis) was broader than that of b-galactosidase
in A12 to A15. Thus, only a fraction of neurons synthesizing dopamine
expressed the dopaminetransporter gene. The bacterial artificial chromo-
some–dopamine transporter–iCre transgenic line is a unique tool for target-
ing Cre ⁄ loxP-mediated DNA recombination to dopamine neurons for
studies ofgene function or for labeling living cells, following the crossing
of these mice with transgenic Cre reporter lines producing fluorescent
proteins.
Abbreviations
BAC, bacterial artificial chromosome; DAT, dopamine transporter; GFP, green fluorescent protein; iCre, codon-improved Cre recombinase;
IRES, internal ribosome entry site; TH, tyrosine hydroxylase; X-Gal, 5-bromo-4-chloroindol-3-yl b-
D-galactoside staining.
3568 FEBS Journal 274 (2007) 3568–3577 ª 2007 The Authors Journal compilation ª 2007 FEBS
dopamine cells form five groups (A11–A15). A11 neu-
rons from the posterior hypothalamus project into the
spinal cord. A13 neurons from the zona incerta project
locally into the hypothalamus and are engaged in
gonadotropin-releasing hormone neuron control. In
the arcuate nucleus (A12 group) and the preoptic
area ⁄ anterior hypothalamus (A14 group), most of the
dopamine neurons are endocrine neurons, secreting
dopamine into the portal blood system ) which bathes
the anterior lobe of the pituitary gland ) or directly
into the median pituitary lobe. These neurons control
prolactin secretion and growth hormone secretion from
the anterior pituitary gland and melanocyte-stimula-
ting hormone secretion from the intermediate lobe.
Dopaminergic neurons are able to synthesize dop-
amine because they contain the rate-limiting enzyme
tyrosine hydroxylase (TH) and the widely expressed
3,4-dihydroxyphenylalanine decarboxylase. Some sub-
sets ofdopamine neurons express other specific genes,
such as that encoding the dopamine 2 receptor, which
functions as an autoreceptor, or that encoding the
dopamine transporter (DAT), an essential regulator of
extracellular dopamine levels in the synaptic cleft.
Dopamine system dysfunction is associated with sev-
eral diseases of the motor and limbic systems. A loss
of dopamine neurons is one of the characteristics of
Parkinson’s disease, whereas changes in the activity or
function of dopaminergic nuclei are associated with
depression, schizophrenia and addiction to drugs of
abuse [3–7].
The use of the Cre DNA recombinase allows target-
ing of DNA recombination events to desired cell popu-
lations. Efforts have recently been made to generate
transgenic mice expressing the recombinase in restricted
neuronal populations [8]. We generated a transgenic
mouse line [bacterial artificial chromosome (BAC)–
DATiCrefto, hereafter referred to as BAC-DATiCre]
(iCre is codon-improved Cre recombinase) in which
Cre is specifically expressed in DAT-containing
neurons, as a molecular genetic tool for the investiga-
tion ofdopamine cell function. When crossed with
reporter mice expressing b-galactosidase after recombi-
nation (R26R mice [9]), the BAC-DATiCre line dis-
played irreversible labeling of all cells that were
expressing or had expressed the DAT gene. We found
that some subsets of neurons from the A12 to A15
regions never coexpressed the TH and DAT genes,
whereas all TH-positive neurons from the A8 to A10
regions were recombined.
Used in combination with other conditional alleles
containing loxP sites, the BAC-DATiCre transgenic
line will be an invaluable tool with which to analyze
dopamine neuron biology and dopamine presynaptic
alterations in physiopathologic disorders involving
dopaminergic systems.
Results
Generation of the DATiCre transgenic line
We used a large (177 kb) DNA genomic segment from
the C57BL ⁄ 6 mouse strain in a BAC clone encompas-
sing the entire mouse DAT (slc6) gene to ensure that
the iCre transgene [10] was correctly expressed
(Fig. 1A). We generated the transgene by recombina-
tion in bacteria, using the tools developed by Lee et al.
[11].
The final construct encompassed 97 kb of DNA
upstream from the DAT gene start codon and 38 kb
of DNA downstream from the polyadenylation signal
sequence of the gene. The homology arms of the BAC
targeting vector used for recombination in bacteria
were chosen such that the ATG of the iCre was in the
same position as the ATG of the DAT gene (Fig. 1A).
Following recombination and elimination of the selec-
tion cassette, bacterial colonies were screened and the
modified BAC was analyzed for the desired recombina-
tion event by restriction enzyme analysis. A 177 kb
DNA fragment was excised by digestion with PmeI
and AscI restriction enzymes, purified and injected into
mouse FVB ⁄ N zygotes.
We obtained two transgenic lines. In both lines, the
Cre recombinase protein was produced in the ventral
tegmental area and the substantia nigra, as shown
by immunohistochemistry with an antibody directed
against Cre [12]. Immunostaining for Cre was com-
pared with that for TH, on successive serial sections of
the mesencephalon, and a perfect match was found.
Cre expression in the ventral midbrain was restricted to
dopamine neurons of the A9 and A10 nuclei (Fig. 1B).
Cre-mediated recombination pattern
We investigated the distribution of Cre expression and
the DNA recombination pattern in the transgenic
mouse line, by analyzing one transgenic line in detail
(BAC-DATiCre line), and crossing this line with the
R26R reporter line [9]. In transgenic animals carrying
both the R26R and BAC-DATiCre transgenes, the
Cre recombinase catalyzed the removal of a DNA
sequence, leading to b-galactosidase production. A
detailed analysisof serial sections stained with
5-bromo-4-chloroindol-3-yl b-d-galactoside (X-Gal)
and for TH clearly showed that recombination was
restricted, in the mesencephalon, to dopaminergic
structures (Fig. 1C).
M. Turiault et al. Cre-mediated recombination in dopaminergic cells
FEBS Journal 274 (2007) 3568–3577 ª 2007 The Authors Journal compilation ª 2007 FEBS 3569
We investigated the patternof Cre expression fur-
ther, by carrying out double staining on sections of the
ventral tegmental area and the substantia nigra. Using
a combination of fluorescent secondary antibodies and
primary antibodies directed against TH and Cre, we
found that Cre (red) was restricted to the nuclei of
TH-expressing neurons (Fig. 2A).
We used TH immunostaining to identify cells con-
taining dopamine, because DAT labeling of the cell
body is very weak. Nevertheless, the labeling of mid-
brain sections for both DAT and Cre showed that all
neurons producing the Cre recombinase (red) also pro-
duced DAT protein (green, Fig. 2B). Similarly, when
analyzed at the cellular level, we showed that DNA
recombination was restricted to DAT-expressing neu-
rons. In mice carrying both the iCre and the R26R
transgenes, b-galactosidase expression (green) was con-
fined to the domain containing DAT neurons (red)
A
BC
Fig. 1. Expressionof Cre recombinase in the midbrain dopaminergic nuclei of BAC-DATiCre mice. (A) Schematic representation of the BAC-
DATiCre construct and its structure. The position of the DAT gene within the RP23–408F13 BAC is indicated, together with those of the
putative genes contained within this BAC. The exon ⁄ intron structure of the DAT gene is shown. The DAT gene has 14 exons (rectangles).
The recombination targeted the second DAT exon, inserting the Cre transgene at the level of the ATG of the DAT gene. The iCre ORF is rep-
resented as a white rectangle, whereas intron sequences and the polyadenylation signal of the bovine GH gene are shown as a dark gray
rectangle. The ampicillin resistance gene (light gray rectangle), flanked by FLP recombinase target sites (black half-circles), was removed
from the final construct by flp-mediated recombination from the final construct (lowest representation). (B) The Cre recombinase is
expressed in TH-positive neurons from the mesencephalon. Serial sections labeled by immunohistochemistry, using antibodies directed
against TH (left panel) and Cre (right panel) proteins. (C) DNA recombination occurs in TH-positive neurons from the mesencephalon. Serial
sections showing the distribution of TH-positive neurons (left) and X-Gal staining indicating Cre-mediated recombination of a LacZ-expressing
reporter gene (right). Magnification: scale bars ¼ 400 lm.
Cre-mediated recombination in dopaminergic cells M. Turiault et al.
3570 FEBS Journal 274 (2007) 3568–3577 ª 2007 The Authors Journal compilation ª 2007 FEBS
in the A10 region of the mesencephalon (Fig. 2C).
b-galactosidase expression was clearly restricted to
DAT-positive neurons (Fig. 2D).
We used the same approach for systematic analyses
of the DNA recombination pattern in groups of dop-
aminergic cells, from the mesencephalon to olfactory
bulbs and retina in serial sections labeled immunohis-
tochemically for TH and stained for b-galactosidase
activity with X-Gal substrate. In the retrorubral field
(A8), substantia nigra (A9), ventral tegmental area
(A10) and glomerular layer of the olfactory bulb
(A16), the number of recombination events was similar
to the number of TH-expressing cells in serial fields
(Fig. 3). In contrast, in hypothalamic groups of cells,
the overlap was only partial between recombination
and TH expression. Whereas in the periventricular
organ (A11) and the cell group of the dorsomedial and
lateral arcuate nucleus (A12) the number of recom-
bined cells was similar to the number of TH positive
cells, we did not detect b-galactosidase activity in the
ventromedial region of the arcuate nucleus. In the
zona incerta (A13) and periaqueductal gray area,
recombination events appeared to be restricted to a
minority of TH-positive neurons. No X-Gal staining
was detected in A14 and A15 nuclei. X-Gal staining of
retina slices showed some recombination events (data
not shown).
Behavioral analysisof BAC-DATiCre mice
The BAC-DATiCre line was, in part, used to study
behavioral consequences of mutations targeted to dop-
aminergic neurons. It was therefore essential to verify
that the presence of the BAC-DATiCre transgene
does not alter behavior. During the generationof the
BAC-DATiCre line, we minimized the risks of any
A
B
C
D
Fig. 2. In the midbrain of BAC-DATiCre mice, both Cre expression and recombination are restricted to dopamine neurons. Confocal images from
multiple staining of double-transgenic mouse brain coronal sections (30 lm). (A) Immunofluorescence of TH (green) and Cre (red) in midbrain
dopamine neurons. DNA was stained with TO-PRO
Ò
3 iodide (TOPRO). The left panel is an overlay of the three previous panels. (B) As for (A),
except that the green staining corresponds to the DAT protein. (C). Cre-mediated recombination visualized by immunofluorescence staining,
using antibodies against b-galactosidase (green). (D) Low-power magnification showing that Cre-mediated recombination corresponds to DAT-
expressing neurons (red), using a higher magnification. All nuclei of this region are stained with TOPRO. Magnification: scale bars ¼ 50 lm.
M. Turiault et al. Cre-mediated recombination in dopaminergic cells
FEBS Journal 274 (2007) 3568–3577 ª 2007 The Authors Journal compilation ª 2007 FEBS 3571
perturbations that could arise from undesired expres-
sion ofgene products encoded by the BAC transgene,
by designing a transgene from which DAT proteins
should not be produced. To rule out the existence of
any problem, we performed comparative behavioral
tests in BAC-DATiCre males (n ¼ 11) and their con-
trol littermates (n ¼ 11) maintained on an FVB ⁄ N
genetic background. The general appearance of trans-
genic and control littermates was undistinguishable.
The weights of animals from both groups were similar
(BAC-DATiCre, 33.9 g ± 0.8; controls, 33.4 g ± 0.7),
as were the levels of muscular strength (for two
limbs – BAC-DATiCre, 1.2 N ± 0.1; control,
1.3 N ± 0.1; and for four limbs ) BAC-DATiCre,
2.4 N ± 0.1; and controls, 2.5 N ± 0.1) and locomo-
tion (Fig. 4A). Anxiety-like behavior was not different
between the two genotypes as assessed by two tests
based on the natural avoidance behavior of mice: the
dark–light transition test (latency to exit the dark com-
partment for the first time, 15 s ± 2.9 versus
17.9 s ± 2.5, P ¼ 0.46, and time spent in the lit com-
partment, 174.9 s ± 7.8 versus 186.8 s ± 5.9, P ¼
0.24, for transgenic and control mice, respectively) and
the elevated plus maze test (time spent in open arms:
Fig. 3. Patternof b-galactosidase activity in dopamine cell groups A8–A16 in DATiCre mice. For each group ofdopamine cells, TH expression
was detected by immunohistochemistry, in mice carrying both the BAC-DATiCre and R26R transgenes (left panels). Recombination events
were detected on serial sections stained with X-Gal for the detection of b-galactosidase activity (right panels). In A8, A9, A10, A11, A12 and
A16, iCre-induced recombination matches the patternof TH expression, but some discrepancies are observed in the periaqueductal gray
area, the ventromedial part of the arcuate nucleus (arrow) and A13. In the A14 and A15 group of cells, recombination events are less fre-
quently observed than TH expression. The highlighted structures on these anatomic drawings from representative coronal sections of the
adult mouse brain modified from Paxinos [38] contain dopaminergic cells. Magnification: scale bars ¼ 50 lm.
Cre-mediated recombination in dopaminergic cells M. Turiault et al.
3572 FEBS Journal 274 (2007) 3568–3577 ª 2007 The Authors Journal compilation ª 2007 FEBS
150 s ± 16 versus 146 s ± 18 for transgenic and con-
trol mice, respectively). Similarly, no differences were
observed when despair-like behavior was studied using
the forced swim test (Fig. 4B).
Discussion
Transgenesis with small DNA regions regulating tran-
scription is inherently prone to problems of ectopic
expression, mosaic expression or the absence of expres-
sion, due to the influence of genomic sequences
surrounding the integration site or the absence of
essential DNA elements. The expressionof a transgene
under the control of an endogenous regulatory ele-
ment, using knock-in approaches, can prevent these
problems but disrupts one copy of the gene, generating
results that may be difficult to interpret. The use of a
large (100–250 kb) DNA segment that contains a gene
with an interesting expression profile, including all
DNA regions required for correct gene expression,
alleviates this problem [13,14]. We targeted Cre recom-
binase expression to dopamine neurons, by generating
a mouse transgenic line expressing the iCre recombin-
ase under the control of the DAT gene encompassed
within a 177 kb BAC. We used the iCre ORF, an
improved version of the Cre recombinase gene that is
more efficiently expressed in mammalian cells [10].
In the ventral tegmental area and the substantia ni-
gra, the patternof iCre expression was similar to the
pattern ofexpressionof the endogenous DAT gene
reported in previous in situ mRNA hybridization stud-
ies [15–17]. When recombination events were analyzed
in situ following the Cre-dependent recombination of a
LacZ reporter construct in double-transgenic animals,
b-galactosidase expression was found to be confined to
areas of endogenous DAT gene expression. Recombi-
nation was restricted exclusively to TH- and DAT-
positive neurons. Discrepancies have been reported
between TH and DAT expression in the ventral
midbrain in rats [17], but we detected no TH-positive
neurons that did not display recombination in the
ventral midbrain group of cells. This suggests that the
TH-positive, DAT-negative cells detected in previous
studies may have been in a transient state or may have
expressed DAT during development.
The perfect concordance between Cre and DAT
expression in the midbrain of BAC-DATiCre mice led
us to use this strategy to improve the definition
of DAT geneexpression in other dopaminergic cell
groups in which the precise distribution of DAT was
unclear. In double-transgenic mice carrying the Cre
and R26R (reporter) transgenes, transient or low-level
DAT expression should be paralleled by Cre expres-
sion, leading to permanent, irreversible LacZ expres-
sion, increasing the sensitivity of DAT detection. We
focused on the various cell groups of the hypothalamic
region (from A11 to A15).
No DAT-iCre-mediated recombination was observed
in the ventromedial neurons of the arcuate nucleus in
mice. Interestingly, in other mammals, this region has
been shown to contain monoenzymatic neurons expres-
sing TH or aromatic l-amino acid decarboxylase, but
not the entire enzymatic machinery required for dop-
amine synthesis. Dopamine produced in this region
may result from an exchange of precursor molecules
between complementary cells [18,19]. Previous studies
have suggested that no DAT mRNA is produced in
this region [17,20,21]. The authors detected very low
levels of DAT expression in the dorsomedial part of
the arcuate nucleus, and our results are consistent with
the presence of very few recombined cells per section.
DAT mRNA levels, which were considerably lower in
A
B
Fig. 4. The presence of the BAC-DATiCre transgene did not affect
locomotion and despair behavior. (A) The presence of the transgene
had no effect on locomotor activity measured within a circular
maze. The numbers of 1 ⁄ 4th turns per 5 min are indicated for trans-
genic and control animals. (B) Transgenic and control littermates did
not show differences in immobility time in a forced swim test.
Immobility was measured for 6 min, in 2-min periods, over two con-
secutive days. Results obtained with transgenic (n ¼ 11) and con-
trol (n ¼ 11) mice are shown in black and gray, respectively.
M. Turiault et al. Cre-mediated recombination in dopaminergic cells
FEBS Journal 274 (2007) 3568–3577 ª 2007 The Authors Journal compilation ª 2007 FEBS 3573
the A13 region than in the ventral midbrain [17,21,22],
may account for the smaller number of b-galactosi-
dase-expressing neurons than of TH-positive neurons.
Expression of DAT in the A14 nucleus of rats remains
controversial, as some studies have reported the detec-
tion of very low levels of DAT mRNA in scattered
cells [21], whereas others detected neither DAT mRNA
nor protein [22,23]. DAT-iCre-expressing mice allow
us to answer this question, as the lack of recombina-
tion in the A14 nucleus indicates an absence of DAT
in these dopaminergic neurons in mice.
The discrepancies observed between TH and X-Gal
labeling in A15 are consistent with the absence of
DAT expression in A15, as shown by in situ mRNA
hybridization or immunohistofluorescence [17,21–23].
All previous published data on DAT expression pat-
terns were obtained with rats. Our study is thus the
first to confirm that the patternof DAT expression in
the brain is very similar in mice and rats.
A recombination pattern restricted to dopamine cells
has been previously achieved [24,25]. The approaches
used involved insertion of the Cre gene, at different
positions, into the DAT gene by homologous recombi-
nation in embryonic stem cells. In two cases, this led to
inactivation of the endogenous targeted DAT allele and,
in the last case, to an alteration of its expression, prob-
ably due to the presence of the Cre construct in the
3¢-UTR of DAT mRNA [26]. An important advantage
of using BAC transgenesis is that it leaves both endog-
enous DAT alleles intact. This is essential, as changes in
DAT geneexpression levels lead to atypical behaviors
[26–31]. We confirmed that the presence of the BAC-
DATiCre transgene had no effect on muscular strength,
locomotion, or anxiety-related or despair behaviors.
The BAC-DATiCre transgenic line is likely to prove
a valuable tool for targeting DNA recombination
events, resulting in reporter geneexpression or gene
inactivation, in studies ofdopamine neuron biology
and presynaptic alterations in physiopathologic disor-
ders involving dopaminergic systems. Combined with
mice expressing cre-dependent fluorescent protein, it
will facilitate the localization and the study of dopam-
ine cells in living tissues. Combined with conditional
alleles of relevant genes, it will allow us to distinguish
their function in dopamine cells from their function in
other cell types. This will be particularly useful in the
context of Parkinson’s disease, in which several genes
potentially involved in the pathogenesis have a wide-
spread expression pattern. In this respect, we have
already used the BAC-DATiCre vector to inactivate
the cAMP-response-element-binding (CREB) gene
[32]. In combination with the D1Cre line, which
allows targeting of recombination in dopaminoceptive
neurons expressing dopamine 1a receptor [33,34], the
BAC-DATiCre line will allow us to distinguish between
presynaptic and postsynaptic gene functions. The BAC-
DATiCrefto transgenic line has been deposited in the
European Mouse Mutant Archives (http://www.
emma.rm.cnr.it).
Experimental procedures
DNA construction and transgenesis
Using the Ensembl genome database, we chose a 210 kb
BAC (RP24 408F13) encompassing the DAT (slc6) gene
from a CHORI BAC library [35]. This BAC was modified by
homologous recombination [11], to insert a 2950 bp DNA
cassette containing the ORF of the improved Cre recombin-
ase, iCre [10], followed by a DNA sequence containing
intron and polyA sequences from the bovine GH gene, and
an ampicillin resistance gene flanked by two FLP recombi-
nase target sites in the same orientation, which was subse-
quently removed (Fig. 1). The BAC was modified as follows:
a 319 bp 5¢ DNA fragment of the DAT gene was ampli-
fied by PCR (using the primers 5¢-CTAGGTACCA
CAAGCCGGCGTTAATGTGAA and 5¢-CTAATCGAT
GGAGCCCGAGGAAGTCTGTTT), digested with ClaI
and KpnI, and inserted upstream from the iCre DNA cassette
in pMT1. The pMT1 plasmid was derived from the vector
iCre-internal ribosome entry site (IRES)-green fluorescent
protein (GFP)-polyA [36], by removing an NsiI–BsrGI DNA
fragment containing the IRES and eGFP sequences, and
then the 3¢ protruding NsiI end, and filling in the 5¢ BsrGI
end before ligation (sequence available on request). The 3¢
homology region was a 200 bp DNA fragment of DAT ge-
nomic DNA amplified by PCR (using the primers 3¢-CAT
GCTAGCTAAAAGCAAATGCTCCGTGGG and 3¢-CTA
GTATACGAAACCTCCAGACATTGGCCA), digested
with BstZ17I and NheI, and inserted downstream from the
DNA cassette. Recombination was induced as previously
described [11]. Briefly, EL250 bacteria (a gift from N. G.
Copeland, National Cancer Institute, Frederick, MO, USA)
containing the RP24 408F13 BAC were electroporated with
the targeting vector. The bacteria were incubated for 15 min
at 42 °C to induce recombination. Correctly targeted BACs
were identified by DNA restriction analysisof ampicillin-
resistant colonies. The ampicillin resistance cassette used for
selection was excised by inducing Flpe recombinase expres-
sion by adding 0.1% l-arabinose to the culture medium for
1 h. Correctly recombined BACs were identified by DNA
restriction analysis and pulsed-field gel electrophoresis. A
177 kb DNA fragment was excised from the BAC DNA by
digestion with PmeI–AscI and purified by chromatography
on Sepharose CL4b columns (Pharmacia, New York, NY,
USA) [37]. This fragment was then used for pronuclear injec-
tions into fertilized FVB ⁄ N oocytes.
Cre-mediated recombination in dopaminergic cells M. Turiault et al.
3574 FEBS Journal 274 (2007) 3568–3577 ª 2007 The Authors Journal compilation ª 2007 FEBS
Mouse genotyping and breeding
Transgenic BAC-DATiCrefto animals were maintained in
an FVB ⁄ N background as well as being backcrossed for
five generations onto the C57BL ⁄ 6 background. These
animals were genotyped using DNA obtained by tail
biopsy, by dot blot DNA hybridization, with a
32
P-radio-
labeled DNA fragment from the iCre ORF. Rosa 26 repor-
ter animals [9] were maintained on a mixed background
and genotyped by PCR amplification, using LacZ-Forward
(5¢-GTCGTTTTACAACGTCGTGACT-3¢) and LacZ-
Reverse (5¢-GATGGGCGATCGTAACCGTGC-3¢) prim-
ers. Animals were housed under specific pathogen-free
conditions at 22 °C, with a 12 h light ⁄ 12 h dark cycle and
free access to water and a rodent diet. All experiments were
performed in accordance with French (Ministe
´
re de l’Agri-
culture 87-848) and European Union (EEC86-6091) guide-
lines for care of laboratory animals.
Histology
Vibratome sections (30 lm) prepared from the brains of
perfused mice (4% paraformaldehyde in 0.1 m NaCl ⁄ P
i
)
were incubated overnight with a rabbit polyclonal anti-Cre
serum (1 : 3000 dilution [12]), 1 : 400 dilution) or a mono-
clonal b-galactosidase antibody (Monosan, Am Uden, the
Netherlands; 1 : 2000 dilution). Immunohistochemistry was
carried out with the avidin–biotin system from Vector
Laboratories (Vectastain, Burlingame, CA, USA). For
double-immunofluorescence labeling, we used Alexa-488-
coupled anti-mouse serum (Molecular Probes, Eugene, OR,
USA) and Cy3-coupled anti-rabbit serum (Jackson Immu-
noresearch, West Grove, PA, USA) at a 1 : 400 dilution as
the secondary antibodies. Immunostaining controls were
performed in the same way, but without primary antibod-
ies. Nuclei were stained with 0.5 lm TO-PRO-3 iodide
(Molecular Probes). b-galactosidase enzymatic activity was
detected on brain cryosections (30 lm). The histologic
immunofluorescence of sections was assessed with a Leica
TCS SP 2 confocal laser scanning microscope (Leica Micro-
systems, Heidelberg, Germany). For cryostat sectioning,
brains were transferred to 15% sucrose in NaCl ⁄ P
i
at room
temperature, and then embedded in 7% gelatin and 15%
sucrose in NaCl ⁄ P
i
, before being frozen by immersion in
isopentane at ) 140 °C. Cryosections were cut and incuba-
ted at 37 °C overnight in X-Gal staining solution [4 mm
potassium hexacyanoferrate(III), 4 mm potassium hexa-
cyanoferrate(II), 2 mm MgCl
2
, 0.02% NP-40, 0.01% sodium
deoxycholate, 5 mm EGTA, and 4 mgÆmL
)1
X-Gal].
Behavioral studies
Mutant (n ¼ 11) and control (n ¼ 11) littermate males
matched for age (4–6 months) were housed together. One
hour before each behavioral test, mice were isolated in
individual cages. Muscular strength was quantified using
the Grip strength test (Bioseb, Chaville, France). To meas-
ure spontaneous locomotor activity, mice were placed, for
130 min, in a circular corridor (4.5 cm width, 17 cm exter-
nal diameter) crossed by four infrared beams (1.5 cm above
the base), equally spaced (Imetronic, Pessac, France). The
locomotor activity was counted when animals interrupted
two successive beams and thus had traveled at least a quar-
ter of the circular corridor. Anxiety was assessed using
the dark–light transition test and the elevated plus maze.
The dark–light box was 45 · 20 · 25 cm, and separated
into two compartments connected by a central aperture
(5 · 5 cm) (Ligna, Paris, France). The dark compartment
(black PVC, 15 cm) was covered, and in the lit compart-
ment the intensity of light (white PVC, 30 cm) was 700 lux.
Animals were tracked for 5 min using the Ethovision video
tracking system from Noldus (Wageningen, The Nether-
lands); both time of exit from the dark compartment and
the time spent in the lit compartment were measured. The
elevated plus maze consists of two elevated (1 m high) and
open arms (24 · 8 cm) positioned opposite to one another
and separated by a central platform and two arms of the
same dimension, but enclosed by walls (20 cm high), form-
ing a cross. The maze was lit by a light placed above the
central platform (30 lux in each arm). The mouse was
placed on the platform, and allowed to explore for 10 min,
and the time spent and the number of presentations (two
paws) and entries (four paws) in the open arms were recor-
ded and quantified using Ethovision. To assess despair be-
havior, we performed a forced swim test. We placed mice
(for 6 min during two consecutive days) in a glass cylinder
(height 25 cm, diameter 11 cm) containing water 8 cm deep
(23 °C). Immobility time was measured during three peri-
ods of 2 min. Data were expressed as means ± SEM and
analyzed by Student’s t-test or ANOVA followed by the
post hoc Scheffe test.
Acknowledgements
We are grateful to E. Casanova for the gift of piCre-
IRES-GFP-polyA plasmid, and to N. G. Copeland for
the gift of EL250 bacteria. We thank M. Cohen-
Salmon, S. Vyas, J. P. Tassin, S. Mhaouty-Kodja,
G. Schu
¨
tz and P.V. Piazza for discussions, critical
reading or support. We thank H. Cambier for excellent
technical assistance. This work was supported by the
‘Centre National de la Recherche’ and the Colle
`
ge de
France, by grants from the ‘Ministe
`
re de l’Education
National de la Recherche et de la Technologie’
(‘Action Concerte
´
e Incitative neurosciences’), the
‘Agence Nationale de la Recherche’ (neurosciences),
the ‘Mission Interministe
´
rielle de Lutte contre la
De
´
pendance et la Toxicomanie’ (MILDT), the ‘Fonda-
tion pour la Recherche Me
´
dicale’ (FRM) and the
M. Turiault et al. Cre-mediated recombination in dopaminergic cells
FEBS Journal 274 (2007) 3568–3577 ª 2007 The Authors Journal compilation ª 2007 FEBS 3575
‘Fondation NRJ’. M. Turiault held PhD fellowships
from MILDT and FRM.
References
1 Smeets WJ & Gonzalez A (2000) Catecholamine systems
in the brain of vertebrates: new perspectives through a
comparative approach. Brain Res Brain Res Rev 33,
308–379.
2 Montague PR, Hyman SE & Cohen JD (2004) Compu-
tational roles for dopamine in behavioural control.
Nature 431, 760–767.
3 Vila M & Przedborski S (2004) Genetic clues to the
pathogenesis of Parkinson’s disease. Nat Med 10 (Sup-
pl.), S58–S62.
4 Nestler EJ & Carlezon WA Jr (2006) The mesolimbic
dopamine reward circuit in depression. Biol Psychiatry
59, 1151–1159.
5 Sawa A & Snyder SH (2002) Schizophrenia: diverse
approaches to a complex disease. Science 296, 692–695.
6 Gerdeman GL, Partridge JG, Lupica CR & Lovinger
DM (2003) It could be habit forming: drugs of abuse
and striatal synaptic plasticity. Trends Neurosci 26, 184–
192.
7 Nieoullon A & Coquerel A (2003) Dopamine: a key
regulator to adapt action, emotion, motivation and cog-
nition. Curr Opin Neurol 16 (Suppl. 2), S3–S9.
8 Morozov A, Kellendonk C, Simpson E & Tronche F
(2003) Using conditional mutagenesis to study the brain.
Biol Psychiatry 54, 1125–1133.
9 Soriano P (1999) Generalized lacZ expression with the
ROSA26 Cre reporter strain. Nat Genet 21, 70–71.
10 Shimshek DR, Kim J, Hubner MR, Spergel DJ, Buch-
holz F, Casanova E, Stewart AF, Seeburg PH & Spren-
gel R (2002) Codon-improved Cre recombinase (iCre)
expression in the mouse. Genesis 32, 19–26.
11 Lee EC, Yu D, Martinez de Velasco J, Tessarollo L,
Swing DA, Court DL, Jenkins NA & Copeland NG
(2001) A highly efficient Escherichia coli-based chromo-
some engineering system adapted for recombinogenic
targeting and subcloning of BAC DNA. Genomics 73,
56–65.
12 Kellendonk C, Tronche F, Casanova E, Anlag K,
Opherk C & Schutz G (1999) Inducible site-specific
recombination in the brain. J Mol Biol 285, 175–182.
13 Yang XW, Model P & Heintz N (1997) Homologous
recombination based modification in Escherichia coli
and germline transmission in transgenicmiceof a bac-
terial artificial chromosome. Nat Biotechnol 15, 859–865.
14 Schedl A, Montoliu L, Kelsey G & Schutz G (1993) A
yeast artificial chromosome covering the tyrosinase gene
confers copy number-dependent expression in transgenic
mice. Nature 362, 258–261.
15 Giros B, el Mestikawy S, Bertrand L & Caron MG
(1991) Cloning and functional characterization of a
cocaine-sensitive dopamine transporter. FEBS Lett 295,
149–154.
16 Ciliax BJ, Heilman C, Demchyshyn LL, Pristupa ZB,
Ince E, Hersch SM, Niznik HB & Levey AI (1995) The
dopamine transporter: immunochemical characterization
and localization in brain. J Neurosci 15, 1714–1723.
17 Hoffman BJ, Hansson SR, Mezey E & Palkovits M
(1998) Localization and dynamic regulation of biogenic
amine transporters in the mammalian central nervous
system. Front Neuroendocrinol 19, 187–231.
18 Ershov PV, Ugrumov MV, Calas A, Krieger M & Thi-
bault J (2005) Degeneration of dopaminergic neurons
triggers an expressionof individual enzymes of dopam-
ine synthesis in non-dopaminergic neurons of the arcu-
ate nucleus in adult rats. J Chem Neuroanat 30, 27–33.
19 Ugrumov MV, Melnikova VI, Lavrentyeva AV, Kudrin
VS & Rayevsky KS (2004) Dopamine synthesis by non-
dopaminergic neurons expressing individual comple-
mentary enzymes of the dopamine synthetic pathway
in the arcuate nucleus of fetal rats. Neuroscience
124,
629–635.
20 Cerruti C, Walther DM, Kuhar MJ & Uhl GR (1993)
Dopamine transporter mRNA expression is intense in
rat midbrain neurons and modest outside midbrain.
Brain Res Mol Brain Res 18, 181–186.
21 Meister B & Elde R (1993) Dopamine transporter
mRNA in neurons of the rat hypothalamus. Neuroendo-
crinology 58, 388–395.
22 Lorang D, Amara SG & Simerly RB (1994) Cell-type-
specific expressionof catecholamine transporters in the
rat brain. J Neurosci 14, 4903–4914.
23 Demaria JE, Nagy GM, Lerant AA, Fekete MI, Leven-
son CW & Freeman ME (2000) Dopamine transporters
participate in the physiological regulation of prolactin.
Endocrinology 141, 366–374.
24 Zhuang X, Masson J, Gingrich JA, Rayport S & Hen R
(2005) Targeted geneexpression in dopamine and sero-
tonin neurons of the mouse brain. J Neurosci Methods
143, 27–32.
25 Ekstrand MI, Terzioglu M, Galter D, Zhu S, Hofstetter
C, Lindqvist E, Thams S, Bergstrand A, Hansson FS,
Trifunovic A et al. (2007) Progressive parkinsonism in
mice with respiratory-chain-deficient dopamine neurons.
Proc Natl Acad Sci USA 104, 1325–1330.
26 Backman CM, Malik N, Zhang Y, Shan L, Grinberg A,
Hoffer BJ, Westphal H & Tomac AC (2006) Characteri-
zation of a mouse strain expressing Cre recombinase
from the 3¢ untranslated region of the dopamine trans-
porter locus. Genesis 44, 383–390.
27 Jones SR, Gainetdinov RR, Jaber M, Giros B, Wight-
man RM & Caron MG (1998) Profound neuronal plas-
ticity in response to inactivation of the dopamine
transporter. Proc Natl Acad Sci USA 95, 4029–4034.
28 Gainetdinov RR, Mohn AR, Bohn LM & Caron MG
(2001) Glutamatergic modulation of hyperactivity in
Cre-mediated recombination in dopaminergic cells M. Turiault et al.
3576 FEBS Journal 274 (2007) 3568–3577 ª 2007 The Authors Journal compilation ª 2007 FEBS
mice lacking the dopamine transporter. Proc Natl Acad
Sci USA 98, 11047–11054.
29 Spielewoy C, Biala G, Roubert C, Hamon M, Betancur
C & Giros B (2001) Hypolocomotor effects of acute
and daily d-amphetamine in mice lacking the dopamine
transporter. Psychopharmacology (Berl) 159, 2–9.
30 Savelieva KV, Caudle WM, Findlay GS, Caron MG &
Miller GW (2002) Decreased ethanol preference and
consumption in dopaminetransporter female knock-out
mice. Alcohol Clin Exp Res 26, 758–764.
31 Spielewoy C, Roubert C, Hamon M, Nosten-Bertrand
M, Betancur C & Giros B (2000) Behavioural distur-
bances associated with hyperdopaminergia in dopamine-
transporter knockout mice. Behav Pharmacol 11, 279–
290.
32 Parlato R, Rieker C, Turiault M, Tronche F & Schu
¨
tz
G (2006) Survival of DA neurons is independent of
CREM upregulation in absence of CREB. Genesis 44,
454–464.
33 Mantamadiotis T, Lemberger T, Bleckmann SC, Kern
H, Kretz O, Martin Villalba A, Tronche F, Kellendonk
C, Gau D, Kapfhammer J et al. (2002) Disruption of
CREB function in brain leads to neurodegeneration.
Nat Genet 31, 47–54.
34 Lemberger T, Parlato R, Dassesse D, Westphal M,
Casanova E, Turiault M, Tronche F, Schiffmann SN
& Schutz G (2007) Expressionof Cre recombinase in
dopaminoceptive neurons. BMC Neurosci 8,4.
35 Osoegawa K & de Jong PJ (2004) BAC library con-
struction. Methods Mol Biol 255, 1–46.
36 Casanova E, Fehsenfeld S, Mantamadiotis T, Lember-
ger T, Greiner E, Stewart AF & Schutz G (2001) A
CamKIIalpha iCre BAC allows brain-specific gene inac-
tivation. Genesis 31, 37–42.
37 Hammes A & Schedl A (2000) Generationof transgenic
mice from plasmids, BACs and YACs. In Mouse Genet-
ics and Transgenics: a Practical Approach (Hammes A
& Schedl A, eds), pp. 217–245. Oxford University Press,
New York, NY.
38 Paxinos G & Franklin KBJ (2001) The Mouse Brain in
Stereotaxic Coordinates, pp. xxv–lv. Academic Press,
San Diego, CA.
M. Turiault et al. Cre-mediated recombination in dopaminergic cells
FEBS Journal 274 (2007) 3568–3577 ª 2007 The Authors Journal compilation ª 2007 FEBS 3577
. Analysis of dopamine transporter gene expression pattern ) generation of DAT-iCre transgenic mice Marc Turiault 1, *, Se ´ bastien Parnaudeau 1, *,. (iCre) gene was inserted into the dopamine transporter gene on a bacterial artificial chromosome. The pattern of expression of the bacterial artificial chromosome dopamine transporter iCre transgene. levels. We generated a transgenic mouse line expressing the Cre recombinase under the control of the regulatory elements of the dopamine transporter gene, for investigations of gene function in dopaminergic