Báo cáo khoa học: Hypoxia-driven proliferation of embryonic neural stem ⁄ progenitor cells – role of hypoxia-inducible transcription factor-1a ppt

Hypoxia-driven proliferation of embryonic neural stem ⁄ progenitor cells – role of hypoxia-inducible transcription factor-1a Tong Zhao1,*, Cui-ping Zhang1,*, Zhao-hui Liu1, Li-ying Wu1, Xin Huang1, Hai-tong Wu1, Lei Xiong1, Xuan Wang2, Xiao-min Wang2, Ling-ling Zhu1 and Ming Fan1,2 Department of Brain Protection and Plasticity, Institute of Basic Medical Sciences, Beijing, China Key Laboratory for Neurodegenerative Disorders of the Ministry of Education and Department of Physiology, Capital Medical University, Beijing, China Keywords embryonic neural stem or progenitor cells; HIF-1a; hypoxia; proliferation Correspondence L.-l Zhu, Department of Brain Protection and Plasticity, Institute of Basic Medical Sciences, Beijing, China No 27 Taiping Rd, Beijing 100850, China Fax: +86 10 6821 3039 Tel: +86 6821 0077 ext 931315 E-mail: linglingzhu@hotmail.com M Fan, Department of Brain Protection and Plasticity, Institute of Basic Medical Sciences, Beijing, China No.27 Taiping Rd, Beijing 100850, China Fax: +86 10 6821 3039 Tel: +86 10 6821 4026 E-mail: fanming@nic.bmi.ac.cn *These authors contributed equally to this work (Received 20 November 2007, revised February 2008, accepted 15 February 2008) We recently reported that intermittent hypoxia facilitated the proliferation of neural stem ⁄ progenitor cells (NPCs) in the subventricule zone and hippocampus in vivo Here, we demonstrate that hypoxia promoted the proliferation of NPCs in vitro and that hypoxia-inducible factor (HIF)-1a, which is one of the key molecules in the response to hypoxia, was critical in this process NPCs were isolated from the rat embryonic mesencephalon (E13.5), and exposed to different oxygen concentrations (20% O2, 10% O2, and 3% O2) for days The results showed that hypoxia, especially 10% O2, promoted the proliferation of NPCs as assayed by bromodeoxyuridine incorporation, neurosphere formation, and proliferation index The level of HIF-1a mRNA and protein expression detected by RT-PCR and western blot significantly increased in NPCs subjected to 10% O2 To further elucidate the potential role of HIF-1a in the proliferation of NPCs induced by hypoxia, an adenovirus construct was used to overexpress HIF1a, and the pSilencer 1.0-U6 plasmid as RNA interference vector targeting HIF-1a mRNA was used to knock down HIF-1a We found that overexpression of HIF-1a caused the same proliferative effect on NPCs under 20% O2 as under 10% O2 In contrast, knockdown of HIF-1a inhibited NPC proliferation induced by 10% O2 These results demonstrated that moderate hypoxia was more beneficial to NPC proliferation and that HIF-1a was critical in this process doi:10.1111/j.1742-4658.2008.06340.x Neural stem ⁄ progenitor cells (NPCs), which exist in the developing and adult mammalian brain, are selfrenewing and can differentiate into neurons, astrocytes or oligodendrocytes in vitro [1–3] Stem cells derived from the embryonic midbrain have been successfully engrafted into the central nervous system (CNS) to cure diseases such as stroke, ischemia and Parkinson’s disease [4–8] A recent encouraging report has raised hopes of using human NPCs for patients with brain trauma [9] Although some growth factors, such as epidermal growth factor, glial cell line-derived neurotrophic factor, leukemia inhibitory factor, and vascular Abbreviations BrdU, bromodeoxyuridine; CKO, conditioned knockout; CNS, central nervous system; eGFP, enhanced green fluorescent protein; HIF, hypoxia-inducible factor; mNPC, mouse neural precursor cell; m.o.i., multiplicity of infection; MSC, mesenchymal stem cell; NPC, neural stem ⁄ neural progenitor cell; PI, proliferation index; RNAi, RNA interference; shRNA, short hairpin RNA; siRNA, small interfering RNA; VEGF, vascular endothelial growth factor 1824 FEBS Journal 275 (2008) 1824–1834 ª 2008 The Authors Journal compilation ª 2008 FEBS T Zhao et al endothelial growth factor (VEGF), can regulate the proliferation of NPCs in vitro [10–12], the expansion of NPCs in vitro is too slow to meet the huge demand for NPCs, which can be used in clinical transplantation without side-effects The development of more effective methods for expansion of NPCs has become urgent and important both in vitro and in vivo Recently, reports have shown that hypoxia can regulate the proliferation and differentiation of stem cells, and that, especially, mild hypoxia has salutary effects on stem ⁄ progenitor cells [12–14] Cytotrophoblasts proliferate at low O2 tensions and differentiate into a highly invasive phenotype at high O2 tensions [15,16] Mesenchymal stem cells (MSCs) from rat bone marrow display enhanced colony-forming capability and increased proliferation at 5% O2 as compared to those at 20% O2 [17] Studer and Morrison reported that O2 lowered to more physiological levels (3%) produced marked trophic and proliferative effects on neural precursors and significantly changed developmental kinetics and outcome as compared with traditional culture conditions (20%) [13,14] We also found that hypoxia (3% O2) increased the proliferation of human MSCs, myoblasts, and neural stem cells [12] These observations indicate that mild hypoxia may be a useful tool for expansion of some stem cells for clinical use in vitro at low cost However, the molecular mechanisms involved in proliferation of stem cells under hypoxic conditions are not well understood Hypoxia-inducible factor (HIF)-1 is one of the key transcription factors in the response to hypoxia; it mediates a variety of adaptive cellular and systemic responses to hypoxia by upregulating the expression of > 50 different genes to assist animals in their adaptation and survival [18] HIF is a heterodimeric DNA-binding complex consisting of a- and b-subunits, which are members of the bHLH-PAS (PER-ARNT-SIM) superfamily of proteins [19,20] The increase in HIF-1 activity is primarily due to the hypoxia-induced stabilization and activation of HIF1a, which is degraded by the ubiquitin–proteasome system under normoxic conditions [21] It has been reported that a hypoxic environment is essential for early development, and that HIF-1a induced by a low O2 tension plays an important role in maintaining the proliferative and undifferentiated phenotype in human trophoblasts [15,16] In addition, HIF-1a conditioned knockout (CKO) caused midbrain-specific impairment Survival of mouse neural precursor cells (mNPCs) and expression of VEGF mRNA was reduced in HIF-1a CKO However, treatment of HIF-1a CKO mNPCs with 50 ngỈmL)1 VEGF only HIF-1a in hypoxia-driven proliferation of NPCs partially restored proliferation [22] On other hand, it was reported that low O2 could increase the expression of fibroblast growth factor and erythropoietin during proliferation of NPCs Furthermore, research findings showed that NPCs exposed to 250 ngỈmL)1 fibroblast growth factor could partly recapitulate the proliferation–trophic effects of lowered O2 on CNS stem cells [13] Recently, we demonstrated that hypoxia promoted human bone barrow-derived MSC proliferation in vitro The gene profile assayed by using cDNA microarrays showed that only four genes among 282 differentially expressed genes were known to be HIF-1-targeted genes [23] From the above, we wondered whether HIF-1a induced by lowered O2 is a contributory factor in hypoxia-driven proliferation of NPCs in vitro In the present study, different O2 concentrations (20% O2, 10% O2, and 3% O2) were adopted for culturing NPCs to further assess the effect of hypoxia on NPC proliferation In an attempt to elucidate the role of HIF-1a in the hypoxia-induced proliferative effect, we investigated the expression of HIF-1a mRNA and protein during the proliferation of NPCs under hypoxia, and the effect of overexpression or knockdown of HIF-1a on NPC proliferation Results Hypoxia promotes the proliferation of NPCs Neurosphere formation It has been reported that lowered O2 (3 ± 2%) promotes the survival and growth of neural stem cells derived from the neural crest and midbrain [13,14] In order to further elucidate the effect of hypoxia on NPC proliferation, different O2 concentrations were employed, and the neural stem cells derived from the embryonic mesencephalon (E13.5) were used in the present study Generally, neural stem cells were grown to form as neurospheres in vitro The ability of stem cells to form neurospheres is one of the indicators for proliferation of neural stem cells in vitro The passaged neurospheres were dissociated into single cells and planted in four-well plates at a density of · 104 cells per well, and then cultured under different O2 concentrations (20% O2, 10% O2, and 3% O2) for days The number of neurospheres formed in each well was counted blindly after days of culture We found that the numbers of neurospheres in 10% O2 and 3% O2 were increased 2.5-fold and 1.5-fold, respectively, as compared with that in 20% O2 (Fig 1A–C) These data showed that hypoxia, especially 10% O2, significantly increased the number of neurospheres FEBS Journal 275 (2008) 1824–1834 ª 2008 The Authors Journal compilation ª 2008 FEBS 1825 HIF-1a in hypoxia-driven proliferation of NPCs T Zhao et al C B 1200 Number of neural spheres A ** 1000 800 ** 600 400 200 20 % D E F 10% 1000 Proliferation index (%) DNA content 40 3% ** 35 * 30 25 20 15 10 0 Counts 130 260 390 520 650 Counts 150 300 450 600 750 control 10 % 1000 20 % DNA content 10 % 3% I H Number of BrdU positive cells G 1000 ** 900 ** 800 700 600 500 400 300 200 100 20% 10% 3% Fig Hypoxia promoted the proliferation of embryonic NPCs (A) Phase contrast images of neurospheres formed under normoxic (20% O2) conditions (B) Phase contrast images of neurospheres formed under hypoxic (10% O2) conditions (C) The number of neurospheres produced under hypoxic conditions, especially 10% O2, increased significantly as compared with control Hypoxia promoted the formation of neurospheres (D, E) Flow cytometric analysis showed that hypoxia, especially 10% O2, led to more NPCs in the S phase and G2 ⁄ M phase of the cell cycle (F) Cartogram of flow cytometric analysis Hypoxia increased the PI BrdU was added to the culture medium (10 lM), and NPCs were cultured in different O2 concentrations (20% O2, 10% O2, and 3% O2) for days (G) Representative photograph of BrdU-labeled cells in the control (20% O2) (H) Representative photograph of BrdU-labeled cells under hypoxia (10% O2) (I) Hypoxia significantly enhanced the number of BrdU-labeled cells The data are the means ± SD (n = 4) *P < 0.05, **P < 0.01, as compared with control (20% O2) Scale bar = 100 lm Proliferation index (PI) We then determined the PI of NPCs by performing a flow cytometric measurement of DNA distributions of cells Phase fractions calculated from such distri1826 butions are used to study the growth characteristics of NPCs The NPCs were stained with propidium iodide after being subjected to different O2 concentration for days Three cell subpopulations (G1, S and G2 + M) were estimated Under lower O2 FEBS Journal 275 (2008) 1824–1834 ª 2008 The Authors Journal compilation ª 2008 FEBS T Zhao et al A C H B 0.8 The above data demonstrate that hypoxia, especially 10% O2, promoted the proliferation of neural stem cells in vitro We further investigated the expression of HIF-1a during proliferation of NPCs, which is the key molecular event in the response to hypoxia The NPCs were exposed to 10% O2 for different periods of time (1, 3, 6, 12, 24, 48, and 72 h) Then, the cells were collected at different time points; the expression of HIF-1a mRNA was detected by RT-PCR, and HIF-1a protein was detected by western blot The data showed that HIF-1a mRNA in NPCs was expressed constantly under both normoxia and hypoxia, and increased from to 72 h (Fig 2A,B) However, expression of HIF-1a protein was undetectable under normoxic conditions, whereas a strong signal was observed in the hypoxic group The level of HIF-1a protein expression increased from h onwards, and lasted for days in the hypoxic group, as compared with the control at the same time point (Fig 2C,D) These results demonstrate that hypoxia induced the expression of HIF-1a during the proliferation of NPCs C H C Control 0.7 Hypoxia H C H ** ** 48 h 72 h * * * 6h 0.6 12 h 0.5 0.4 0.3 0.2 0.1 1h 3h 24 h C C H C H C H C H C H C H C H HIF-1α β-Actin D 1.8 * HIF-1α / actin 1.6 1.4 1.2 * * * * 24 h 48 h * 0.8 0.6 0.4 0.2 1h Expression of HIF-1a in NPCs under hypoxia (10%) H 18SRNA Bromodeoxyuridine incorporation assay Incorporation of Bromodeoxyuridine (BrdU) into growing (DNA-synthesizing) S phase cells is more accurate in determining phase fractions We further used BrdU incorporation to determine whether hypoxia affects the DNA synthesis phase of NPCs BrdU (10 lm) was added to the culture medium, and the NPCs were exposed to different O2 concentrations (20% O2, 10% O2, and 3% O2) The number of BrdU-positive cells among the newly divided cells was measured after days by BrdU immunohistochemistry The numbers of BrdU-positive cells under 10% O2 and 3% O2 showed an 88% and a 63% increase, respectively, as compared with the control (20% O2; Fig 1G–I) These results showed that hypoxia could increase the number of BrdU-positive NPCs C H C H C HIF-1α HIF-1α / 18S conditions, especially under 10%, more NPCs were in S phase and G2 ⁄ M phase of the cell cycle as compared with NPCs grown in 20% O2 (PI values were 23.87 ± 0.5 in the 20% group, 31.08 ± 1.7 in the 10% group, and 25.23 ± 0.3 in the 3% group; Fig 1D–F) The data here suggested that more neural stem cells entered the proliferative phase under hypoxia, which was consistent with the above data HIF-1a in hypoxia-driven proliferation of NPCs 3h 6h 12 h 72 h Fig Hypoxia increased the expression of HIF-1a in NPCs Cells were exposed to 20% O2 or 10% O2 for different periods of time, and then collected for RT-PCR and western blot assay (A) Representative photograph for HIF-1a mRNA tested by RT-PCR (C, control; H, hypoxia) (B) The level of HIF-1a mRNA expression measured by densitometry analysis The HIF-1a mRNA expression value was normalized to that of 18S (C) Representative photograph for HIF-1a protein tested by western blot (C, control; H, hypoxia) A strong signal was observed in the groups exposed to hypoxia from h to days, whereas no expression of HIF-1a protein could be detected in the control Overexpression of HIF-1a promotes NPC proliferation To investigate the role of HIF-1a in hypoxia-driven proliferation of NPCs, an adenovirus construct containing CMV HIF-1a was used to overexpress HIF-1a in NPCs [CMV-enhanced green fluorescent protein (eGFP) vector was used as control] As detailed in Experimental procedures, the NPCs were dissociated into single cells, and infected with adenovirus at a titer of 50 multiplicity of infection (m.o.i.) for h Then these cells were exposed to either hypoxia (10% O2) or normoxia (20% O2) for days The adenovirus at a FEBS Journal 275 (2008) 1824–1834 ª 2008 The Authors Journal compilation ª 2008 FEBS 1827 HIF-1a in hypoxia-driven proliferation of NPCs T Zhao et al titer of 50 m.o.i resulted in an infection rate of almost 95%, with no significant increase in viral toxicity The expression of HIF-1a protein showed an increase after infection with Ad–HIF-1a (Fig 3A) The total number of cells in NPCs infected with Ad–HIF-1a increased in comparison to those in the Ad–eGFP group under normal condition (Fig 3B) Flow cytometric analyses showed that overexpression of HIF-1a enhanced the PI of NPCs under normal conditions, and that the Ad–HIF-1a groups had a significantly increased PI (Fig 3C,D) These results suggest that overexpression A of HIF-1a could partially mimic the effect of hypoxia on proliferation of NPCs in vitro Knockdown of HIF-1a expression inhibits NPC proliferation To knock down HIF-1a expression, the pSilencer 1.0U6 plasmid was constructed as an HIF-1a-targeted RNA interference (RNAi) vector Three selected small interfering (si)RNAs targeting HIF-1a sequences were designed The efficiency of the RNAi was estimated by con/HIF 10% 10%/HIF HIF-1α β-Actin Number of total cells (x104·mL–1) B 250 ** # 200 ** 150 ** 100 50 con/HIF 10% 10%/HIF GFP HIF D Counts 90 180 270 360 450 1000 ** 30 1000 DNA content 10% GFP 10% HIF Counts 130 260 390 520 650 Counts 100 200 300 400 500 DNA content 1000 DNA content **# 35 Proliferation index (%) Counts 130 260 390 520 650 C * 25 20 15 10 0 1000 DNA content con/HIF 10% 10%/HIF Fig Overexpression of HIF-1a promoted proliferation of NPCs under normoxic conditions Cells infected with adenovirus at a titer of 50 m.o.i were exposed to either 10% or 20% O2 for days (A) Expression of HIF-1a protein was analyzed by western blot; expression of HIF-1a in NPCs infected with Ad–HIF under normoxia increased as compared with the control (B) Data for number of total cells counted by hematocytometer The total number of cells in the ⁄ HIF group infected with Ad–HIF under normoxia increased significantly as compared with that in the control group (C) Representative flow cytometric analyses (D) Cartogram of flow cytometric analyses The data showed that overexpression of HIF-1a enhanced the PI of NPCs The data are the means ± SD **P < 0.01 as compared with the control group; # P < 0.01 as compared with the 10% O2 group 1828 FEBS Journal 275 (2008) 1824–1834 ª 2008 The Authors Journal compilation ª 2008 FEBS T Zhao et al HIF-1a in hypoxia-driven proliferation of NPCs testing the expression of HIF-1a after transfection We found that RNAi could significantly reduce the expression of HIF-1a, and RNAi was consequently used for the following experiment The NPCs were transfected with the pSilencer 1.0-U6 plasmid by Lipofectamine 2000, and then cells were exposed to either normoxia (20% O2) or hypoxia (10% O2) for days The percentage of GFP-positive cells was about 70% of that of total neural stem cells after days of transfection (Fig 4A) The expression of HIF-1a was detected by western blot, which showed that the level of HIF1a protein decreased in the RNAi group as compared with the negative control in the hypoxic condition (Fig 4B) Flow cytometric analyses showed that the PI of GFP-positive cells decreased in the RNAi group as compared with the negative control in the hypoxic A condition (Fig 4C,D) These results suggest that knockdown of HIF-1a could partially decrease the proliferation of NPCs induced by hypoxia (10% O2) Discussion In the present study, we demonstrated that hypoxia promoted the proliferation of NPCs in vitro and that HIF-1a played a key role in this process: (a) hypoxia, especially 10% O2, had a more potent proliferative effect on NPCs; (b) the level of HIF-1a mRNA and protein expression in NPCs increased significantly during proliferation of NPCs under hypoxia; and (c) overexpression of HIF-1a could mimic the hypoxia-driven proliferative effect in NPCs under 20% O2 Conversely, lowering HIF-1a levels by RNAi reduced the B conRNAi 10% 10%RNAi HIF-1α β-actin D 35 200 200 RNAi 1000 DNA content 1000 DNA content 10% RNAi 25 0 1000 DNA content ** 20 15 10 conRNAi 10% 10%RNAi Counts Counts 200 200 10% Proliferation index (%) ** 30 0 Counts Counts C 1000 DNA content Fig Knockdown of HIF-1a repressed hypoxia-driven proliferation of NPCs (A) Photographs of NPCs transfected with empty vector (green: GFP; scale bar = 200 lm) (B) Evaluation of HIF-1a protein expression (lane 1, normoxia + empty vector; lane 2, normoxia + RNAi vector; lane 3, hypoxia + empty vector; lane 4, hypoxia + RNAi vector) Downregulation of HIF-1a decreased the enhanced PI of NPCs induced by hypoxia (A) Cytometry analysis indicates that the PI of NPCs was decreased by downregulation of HIF-1a (B) Graph of the PI of NPCs Each bar represents the mean ± SD **P < 0.01 as compared with control; ##P < 0.01, as compared with 10% O2 FEBS Journal 275 (2008) 1824–1834 ª 2008 The Authors Journal compilation ª 2008 FEBS 1829 HIF-1a in hypoxia-driven proliferation of NPCs T Zhao et al ability of hypoxia to induce proliferation These suggest that mild hypoxia is a useful measure for expansion of embryonic NPCs in vitro and that HIF-1a is the causative molecule in this process Lowered O2 culture favors the proliferation of NPCs Standard conditions for culture of mammalian cells employ about 20% O2 in vitro Exposure of cells to O2 deprivation in vitro has been shown to reduce proliferation and ⁄ or lead to programmed cell death [24,25] However, there is considerable controversy in the literature regarding cellular responses under hypoxia [26–28], and most of the discrepancies can be explained by differences in O2 concentration, exposure time, and type of cells In general, O2 concentrations over 1%, rather than arresting the growth of most kinds of cells, promote the proliferation of some types of cells There is increasing evidence that mild hypoxia acts as a potent regulator of various types of stem cells [12] Therefore, the effects of hypoxia on the stem cells are extensive, cell-type specific, and O2-regulated The modulation of cell proliferation in NPCs is believed to play a role in neuronal regeneration In 2000, Morrison and Studer reported for the first time that culturing NPCs from E12 rat mesencephalon and peripheral nerve crest in a decreased O2 (3 ± 2%) environment promoted their survival, proliferation, and differentiation [13,14] They also found that the cells yielded greater numbers of precursors and showed less apoptosis after being grown in low O2 (3 ± 2%) for days Storch and colleagues cultured human mesencephalic neural precursor cells in low O2 (3%), and found long-term proliferation of these cells, which could grow and survive for up to 11 months [11,30] To mimic physiological or pathological hypoxia, in the present study different O2 concentrations were adopted to investigate the effects of hypoxia on NPC proliferation in vitro The results of BrdU administration, neurosphere counting and PI determination demonstrated that hypoxia (3% O2) promoted NPC proliferation in vitro, which is consistent with previous reports [13,14] In addition, we also found that 10% O2 is more beneficial to NPC proliferation in vitro than 3% O2 The above data indicate that mild hypoxia promoted the proliferation of NPCs in both the peripheral nervous system and CNS of rat and human in vitro These results suggest that lowered O2 conditions favor neural NPCs, and that a suitable level of hypoxia could be a useful tool for expansion of NPCs for ex vivo cell therapy and for a mechanism study of neural development 1830 Possible role of HIF-1a in hypoxia-driven proliferation of NPCs HIF-1 has been identified as an important transcription factor that mediates the cellular response to hypoxia, promoting either cellular survival or apoptosis under different conditions [24,25] Activation of HIF-1a under < 1% O2 in the pathogenesis of cancer cells has been widely studied, and the involvement of HIF-1a in antiproliferation, migration and invasion of cancer cells has been shown [31–35] However, the role of HIF-1a in hypoxia-driven proliferation is less well understood HIF-1 is composed of two subunits: HIF-1a and HIF-1b HIF-1b, also called ARNT, is expressed constitutively in all cells and does not respond to changes in O2 tension, whereas HIF-1a is specific in its response to hypoxia [36] It has been reported that hypoxia induces the transcription of HIF-1a mRNA, which increases the level of HIF-1a protein in the presence of continued hypoxia [37,38] Expression of HIF-1 (protein level) was markedly upregulated by hypoxia [36,39] Consistent with the above, our data showed that the expression of HIF-1a mRNA in NPCs increased from h to 72 h during exposure to hypoxia (Fig 2A) Under normoxic conditions, HIF-1a is constitutively synthesized and sent to be destroyed by the ubiquitin–proteasome pathway (half-life < min), so HIF-1a protein is absent or nearly absent in most normoxic cells [40,41] Consistent with this, we did not detect the expression of HIF-1a protein in NPCs under normoxic conditions With the onset of hypoxia (10% O2), we found that HIF-1a protein in NPCs was highly expressed and that this lasted for at least days Therefore, HIF-1a protein expression is stable under hypoxic conditions from to 72 h as compared with the control at each time point (Fig 2C) From our quantification of the data in Fig 2D, the expression of HIF-1a protein indicates a very dynamic regulation pattern during hypoxia Under hypoxia, HIF-1a subunits are stabilized, translocated to the nucleus, dimerized with the stable b-subunit ARNT, and promote O2-regulated gene expression These results indicate that HIF-1a might play an important role in this process To determine whether HIF-1a plays a key role in hypoxia-driven NPC proliferation, overexpression of HIF-1a and RNAi were applied to study the role of the HIF-1a gene in NPCs First, overexpression of HIF-1a by transient adenovirus transfection caused the same proliferative effect under normal conditions as that in hypoxia HIF-1a overexpression could mimic the proliferation of NPCs under normal conditions This suggests that activation of HIF-1a is the primary hypoxia-driven FEBS Journal 275 (2008) 1824–1834 ª 2008 The Authors Journal compilation ª 2008 FEBS T Zhao et al signaling pathway in NPCs, as well as in human pulmonary artery fibroblasts [26,39] and human vascular smooth muscle cells [42] Second, specific inhibition of HIF-1a by RNAi technology was achieved With this approach, it was found that short hairpin RNA (shRNA) targeting human HIF-1a was transferred into human endothelial progenitor cells by an adenoviral vector HIF-1a mRNA and protein expression were dramatically and specifically downregulated after siRNA–HIF-1a infection in cells under hypoxia HIF-1a knockdown via adenoviral siRNA transfer inhibited endothelial progenitor cell colony formation, differentiation, and proliferation [43] Consistent with this, this effect in our study persisted for at least 72 h and was accompanied by suppression of HIF-1a protein expression (Fig 4B) Knockdown of HIF-1a expression inhibits NPC proliferation induced by 10% O2 These observations suggest that HIF-1a plays an important role in hypoxia-induced NPC proliferation The above data support the conclusion that HIF-1a is critical in hypoxia-induced NPC proliferation Conclusion Efficient generation of NPCs in vitro may serve as a source of cells for brain repair and treatment of neurodegenerative diseases Moreover, to eliminate the risk of transformation in culture, an ideal expansion protocol would produce rapid proliferation without the need for prolonged passage in cell culture In this study, we found that hypoxia provides an easily expandable source of NPCs in vitro for transplantation, and we confirmed for the first time that the HIF-1 signaling pathway was activated and critical in hypoxia-driven proliferation of NPCs On the basis of this result, we believe that elucidation of the molecular mechanisms mediating this phenomenon may stimulate new strategies for expansion of NPCs Experimental procedures Animals Pregnant 13.5-day-old Wistar rats were used The Institutional Animal Care and Use Committee (IACUC) of the Academy of Military Medical Science gave consent for the use of rats in all of the experiments Isolation and culture of NPCs Cells derived from Wistar rat mesencephalon (E13.5) were mechanically dissociated and grown in DMEM ⁄ F-12 (1 : 1) medium containing mm l-glutamine, IU of penicillin, HIF-1a in hypoxia-driven proliferation of NPCs lgỈmL)1 streptomycin, 1% N2, 1% B27 (Invitrogen, Grand Island, NY, USA), 20 ngỈmL)1 EGF (Sigma, St Louis, MO, USA) and 20 ngỈmL)1 basic fibroblast growth factor (Invitrogen) The primary neurospheres were defined as passage zero (P0) NPCs The NPCs were subcultured into two to five generations, and used in the following experiments Hypoxic conditions For decreased O2 conditions, an incubator chamber (Therm 3111; Billups-Rothenberg, Del Mar, CA, USA), which is adjustable for the desired O2 concentration, was used The incubator chamber was flushed with 5% CO2 (balance N2) The actual concentrations of 20% O2, 10% O2 and 3% O2 inside the chamber were based on direct measurement with a microelectrode (Animus Corp., Malvern, PA, USA) The time of hypoxia was calculated from the measurement indicating the desired O2 concentration Neurosphere formation Cells were seeded in four-well plates at · 104 cells per well (Costar, Cambridge, MA, USA; culture area per well 1.9 cm2) The total number of neurospheres (size>5 cells) in each well was counted, after exposure to hypoxia for days The observers were blinded to the experimental conditions Each experiment was repeated three times independently Cell counting Cells infected with adenovirus were seeded at a density of · 105 cellsỈmL)1 in 35 mm plates (Costar) and then placed in either the hypoxic or normoxic condition for days; the neurospheres were trypsinized, and cells were counted with a hemocytometer Cell cycle analysis The neural spheres under hypoxic or normal conditions were dissociated by using 0.25% trypsin ⁄ EDTA Single cell suspensions were obtained and washed with NaCl ⁄ Pi three times After fixation with 75% ethanol, cells were digested with DNase-free RNase in NaCl ⁄ Pi containing lgỈmL)1 propidium iodide for DNA staining (45 at 37 °C) [44] The propidium iodide fluorescence and forward light scattering were detected with a flow cytometer (FACS scan; Beckton Dickinson) equipped with cellquest (Largo, FL, USA) software BrdU administration and immunohistochemistry Cells were plated on 35 mm dishes (Costar) precoated with polylysine BrdU (Sigma) (10 lm) was added to the FEBS Journal 275 (2008) 1824–1834 ª 2008 The Authors Journal compilation ª 2008 FEBS 1831 HIF-1a in hypoxia-driven proliferation of NPCs T Zhao et al medium, and cells were exposed to hypoxia for days The cells were then fixed with 4% paraformaldehyde at °C for h For BrdU immunohistochemistry, the cells were pretreated with m HCl to denature the DNA and incubated with a mouse mAb against BrdU (Molecular Probes, NY, USA; diluted : 1000) for 48 h at °C After being washed in 0.1 m phosphate buffer, the cells were incubated with biotinylated anti-(mouse IgG; Vector Laboratories, Burlingame, CA, USA; diluted : 1000) at °C overnight BrdUpositive cells were visualized as a black nuclear precipitate, using a nickel-intensified 3,3V-diaminobenzidine procedure [45] RNA extraction and RT-PCR Cultures were washed once with NaCl ⁄ Pi before solubilization in Trizol (Invitrogen) and then stored at )80 °C Total RNA extraction was performed according to the recommendations of the manufacturer The program for PCR was as follows: primers for HIF-1a (5¢-TGCTTGGT GCTGATTTGTGA-3¢ and 5¢-GGTCAGATGATCAGA GTCCA-3¢) were used to yield a 209 bp product for 30 cycles at 58 °C; m18S rRNA primers (forward, 5¢-TT ATGGTTCCTTTGGTCGCT-3¢; reverse, 5¢-ATGTGGTA GCCGTTTCTCAG-3¢) were used to yield a 355 bp product for 30 cycles at 56 °C The level of HIF-1a mRNA expression was semiquantified relative to the endogenous expression level of 18S rRNA Construction of the recombinant adenoviral vector Ad–HIF-1a The recombinant adenovirus overexpressing the human HIF-1a gene was a kind gift from T Hong (Institute of Microbiology, Chinese Academy of Science) The AdEasy system was used to generate recombinant adenoviruses The complete cDNA of human HIF-1a with a length of 3720 bp contained an ORF of 2478 bp and a 1242 bp 5¢-UTR and 3¢-UTR An ORF of 2478 bp, which encoded a sequence of 826 amino acids, was constructed into the recombinant adenoviral vector The recombinant adenoviral vector, digested with PacI to linearize the plasmid and ethanol-precipitated, was used for transfection into HEK293 cells The recombinant virus produced in HEK293 cells could then be further purified and then viral titers were assayed Adenovirus infection assay Neurospheres were dissociated into single cells before infection with adenovirus After h of incubation, the viruscontaining medium was replaced by fresh complete growth medium Then, the NPCs were cultured for 72 h, and the expression of HIF-1a was measured The modified constructs contained HIF-1a coupled to GFP in separate expression cassettes The rate of infection with the adenovirus was determined by the percentage of GFP-positive cells detected by flow cytometry Protein extraction and western blot Cells were harvested quickly after either hypoxic or normoxic culture for the desired times, and the total protein was extracted with lysis buffer, which contained 100 mm Tris ⁄ HCl (pH 7.5), 300 mm NaCl, 2% (v ⁄ v) Tween-20, 0.4% NP-40, and 20% glycerol, supplemented with protease inhibitors (1 lgỈmL)1 leupeptin and pepstatin, lgỈmL)1 aprotinin, and mm phenylmethanesulfonyl fluoride) and phosphatase inhibitors (10 mm NaF and mm Na3VO4) Then, western blot analyses were carried out Extracts were quantified with a protein assay kit (Bio-Rad, Hercules, CA, USA), fractionated by 6% SDS ⁄ PAGE, and transferred to a poly(vinylpyrrolidone difluoride) membrane (Immobilon-P; Millipore, Bedford, MA, USA) The membrane was blocked with NaCl ⁄ Tris containing 5% dry milk at room temperature for h Membranes were incubated with mouse mAb to HIF-1a (Chemicon, Temecula, CA, USA; dilution : 500) in NaCl ⁄ Tris containing 5% nonfat dry milk Membranes were treated with secondary antibody, goat anti-(mouse IgG), conjugated with horseradish peroxidase (Santa Cruz, CA, USA; dilution : 1000) in NaCl ⁄ Tris containing 5% nonfat dry milk Immune complexes on the membrane were visualized by using an enhanced chemiluminescence detection system (Amersham Biosciences, Piscataway, USA) 1832 HIF-1a-targeted RNAi plasmid construction and transfection in NPCs The sequence of HIF-1a mRNA was found in GenBank (GenBank accession no for rat HIF-1a: NM_024359) and segments of siRNA targeting HIF-1a mRNA were designed by using siRNA-designing software The sense strand containing 19 nucleotides was followed by a short space (TTCAAGAGA), and the reverse complement of the sense strand was followed by six thymidines as an RNA polymerase III transcriptional stop signal The sequences were: forward, 5¢-GCCTTAACCTATCTGTCACTTCAAGAGAGT GACAGATAGGTTAAGGC TTTTTT-3¢; and reverse, 5¢-AATTAAAAAAGCCTTAACCTATCTGTCACTCTCT TGAAGTGACAGATAGGTTAAGGC GGCC-3¢ (reverse complement sequences to form stem-loop structure in RNAi are underlined) The oligonucleotides were annealed in the buffer [100 mmolỈL)1 potassium acetate, 30 mmolỈL)1 Hepes ⁄ KOH (pH 7.4), magnesium acetate mmolỈL)1], and the mixture was incubated at 90 °C for min, and then at 37 °C for h The double-stranded oligonucleotides were cloned into an ApaI–EcoRI site in the pSilencer 1.0-U6 vector (Ambion, Austin, TX, USA), in which shRNAs were expressed under the control of the U6 promoter A negative control scrambled siRNA, which FEBS Journal 275 (2008) 1824–1834 ª 2008 The Authors Journal compilation ª 2008 FEBS T Zhao et al had no significant homology to rat gene sequences, was designed to detect any nonspecific effects The plasmids were transfected into NPCs by using Lipofectamin 2000 (Invitrogen, CA, USA), and the transfection rate was determined by the percentage of GFP-positive cells Statistical analysis All the experimental data shown were from experiments that were repeated at least three times, unless otherwise indicated Data are presented as mean ± SD Statistical analysis was performed by t-test A statistical probability of P < 0.05 was considered to be significant Acknowledgements This work was supported by grants from the National Basic Research Program of China (nos 2006CB504100 and 2006CB943703), the Nature and Sciences Foundation of China (no 30393130), the Hi-tech Research and Development Program of China (no 2006AA02A101) and Grant of Beijing for Tibet (no Z0006342040191) HIF-1a in hypoxia-driven proliferation of NPCs 10 11 12 13 14 References Reynolds BA, Tetzlaff W & Weiss S (1992) A multipotent EGF-responsive striatal embryonic progenitor cell produces neurons and astrocytes J Neurosci 12, 4565–4574 McKay R (1997) Stem cells in the central nervous system Science 276, 66–71 Gage FH (2000) Mammalian neural stem cells Science 287, 1433–1438 Svendsen CN, Clarke DJ, Rosser AE & Dunnett SB (1996) Survival and differentiation of rat and human epidermal growth factor-responsive precursor cells following grafting into the lesioned adult central nervous system Exp Neurol 137, 376–388 Svendsen CN, Caldwell MA, Shen J, ter Borg MG, Rosser AE, Tyers P, Karmiol S & Dunnett SB (1997) Long-term survival of human central nervous system progenitor cells transplanted into a rat model of Parkinson’s disease Exp Neurol 148, 135–146 Storch A & Schwarz J (2002) Neural stem cells and neurodegeneration Curr Opin Investig Drugs 3, 774–781 Storch A, Sabolek M, Milosevic J, Schwarz SC & Schwarz J (2004) Midbrain-derived neural stem cells: from basic science to therapeutic approaches Cell Tissue Res 318, 15–22 Ishibashi S, Sakaguchi M, Kuroiwa T, Yamasaki M, Kanemura Y, Shizuko I, Shimazaki T, Onodera M, Okano H & Mizusawa H (2004) Human neural 15 16 17 18 19 20 21 22 stem ⁄ progenitor cells, expanded in long-term neurosphere culture, promote functional recovery after focal ischemia in Mongolian gerbils J Neurosci Res 78, 215–223 Zhu J, Zhou L & XingWu F (2006) Tracking neural stem cells in patients with brain trauma N Engl J Med 355, 2376–2378 Kuhn HG, Winkler J, Kempermann G, Thal LJ & Gage FH (1997) Epidermal growth factor and fibroblast growth factor-2 have different effects on neural progenitors in the adult rat brain J Neurosci 17, 5820–5829 Storch A, Paul G, Csete M, Boehm BO, Carvey PM, Kupsch A & Schwarz J (2001) Long-term proliferation and dopaminergic differentiation of human mesencephalic neural precursor cells Exp Neurol 170, 317–325 Zhu LL, Wu LY, Yew DT & Fan M (2005) Effects of hypoxia on the proliferation and differentiation of NSCs Mol Neurobiol 31, 231–242 Studer L, Csete M, Lee SH, Kabbani N, Walikonis J, Wold B & McKay R (2000) Enhanced proliferation, survival, and dopaminergic differentiation of CNS precursors in lowered oxygen J Neurosci 20, 7377–7383 Morrison SJ, Csete M, Groves AK, Melega W, Wold B & Anderson DJ (2000) Culture in reduced levels of oxygen promotes clonogenic sympathoadrenal differentiation by isolated neural crest stem cells J Neurosci 20, 7370–7376 Genbacev O, Zhou Y, Ludlow JW & Fisher SJ (1997) Regulation of human placental development by oxygen tension Science 277, 1669–1672 Caniggia I, Mostachfi H, Winter J, Gassmann M, Lye SJ, Kuliszewski M & Post M (2000) Hypoxia-inducible factor-1 mediates the biological effects of oxygen on human trophoblast differentiation through TGFbeta(3) J Clin Invest 105, 577–587 Lennon DP, Edmison JM & Caplan AI (2001) Cultivation of rat marrow-derived mesenchymal stem cells in reduced oxygen tension:effects on in vitro and in vivo osteochondrogenesis J Cell Physiol 187, 345–355 Semenza G (1999) Regulation of mammalian O2 homeostasis by hypoxia-inducible factor1 Annu Rev Cell Dev Biol 15, 551–578 Wang GL & Semenza GL (1993) General involvement of hypoxia-inducible factor1 in transcriptional response to hypoxia Proc Natl Acad Sci USA 90, 4304–4308 Wang GL, Jiang BH, Rue EA & Semenza GL (1995) Hypoxia-inducible factor is a basic-helix-loop-helixPAS heterodimer regulated by cellular O2 tension Proc Natl Acad Sci USA 92, 5510–5514 Wang GL & Semenza GL (1995) Purification and characterization of hypoxia-inducible factor1 J Biol Chem 270, 1230–1237 Milosevic J, Maisel M, Wegner F, Leuchtenberger J, Wenger RH, Gerlach M, Storch A & Schwarz J (2007) FEBS Journal 275 (2008) 1824–1834 ª 2008 The Authors Journal compilation ª 2008 FEBS 1833 HIF-1a in hypoxia-driven proliferation of NPCs 23 24 25 26 27 28 29 30 31 32 33 34 T Zhao et al Lack of hypoxia-inducible factor-1 alpha impairs midbrain neural precursor cells involving vascular endothelial growth factor signaling J Neurosci 27, 412–421 Wu EH, Li HS, Zhao T, Fan JD, Ma X, Xiong L, Li WJ, Zhu LL & Fan M (2007) Effect of hypoxia on the gene profile of human bone marrow-derived mesenchymal stem cells Acta Physiol Sin 59, 227–232 Marx J (2004) How cells endure low oxygen Science 303, 1454–1456 Goda N, Dozier SJ & Johnson RS (2003) HIF-1 in cell cycle regulation, apoptosis, and tumor progression Antioxid Redox Signal 5, 467–473 Rose F, Grimminger F, Appel J, Heller M, Pies V, Weissmann N, Fink L, Schmidt S, Krick S, Camenisch G, et al (2002) Hypoxic pulmonary artery fibroblasts trigger proliferation of vascular smooth muscle cells: role of hypoxia-inducible transcription factors FASEB J 16, 1660–1661 Cogo A, Napolitano G, Michoud MC, Barbon DR, Ward M & Martin JG (2003) Effects of hypoxia on rat airway smooth muscle cell proliferation J Appl Physiol 94, 1403–1409 Galvin DJ, Watson RW, O’Neill A, Coffey RN, Taylor C, Gillespie JI & Fitzpatrick JM (2004) Hypoxia inhibits human bladder smooth muscle cell proliferation: a potential mechanism of bladder dysfunction Neurourol Urodyn 23, 342–348 Kung AL, Wang S, Klco JM, Kaelin WG & Livingston DM (2000) Suppression of tumor growth through disruption of hypoxia-inducible transcription Nat Med 6, 1335–1340 Milosevic J, Schwarz SC, Krohn K, Poppe M, Storch A & Schwarz J (2005) Low atmospheric oxygen avoids maturation, senescence and cell death of murine mesencephalic neural precursors J Neurochem 92, 718–729 Semenza GL (2000) HIF-1: mediator of physiological and pathophysiological responses to hypoxia J Appl Physiol 88, 1474–1480 Swinson DE & O’Byrne KJ (2006) Interactions between hypoxia and epidermal growth factor receptor in nonsmall-cell lung cancer Clin Lung Cancer 7, 250–256 Krieg M, Haas R, Brauch H, Acker T, Flamme I & Plate KH (2000) Up-regulation of hypoxia-inducible factors HIF-1alpha and HIF-2alpha under normoxic conditions in renal carcinoma cells by von HippelLindau tumor suppressor gene loss of function Oncogene 19, 5435–5443 Chen J, Zhao S, Nakada K, Kuge Y, Tamaki N, Okada F, Wang J, Shindo M, Higashino F, Takeda K, et al (2003) Dominant-negative hypoxia-inducible factor-1 alpha reduces tumorigenicity of pancreatic cancer cells through the suppression of glucose metabolism Am J Pathol 162, 1283–1291 1834 35 Stoeltzing O, McCarty MF, Wey JS, Fan F, Liu W, Belcheva A, Bucana CD, Semenza GL & Ellis LM (2004) Role of hypoxia-inducible factor 1alpha in gastric cancer cell growth, angiogenesis, and vessel maturation J Natl Cancer Inst 96, 946–956 36 Greijer AE, van der Groep P, Kemming D, Shvarts A, Semenza GL, Meijer GA, van de Wiel MA, Belien JA, van Diest PJ & van der Wall E (2005) Up-regulation of gene expression by hypoxia is mediated predominantly by hypoxia-inducible factor (HIF-1) J Pathol 206, 291–304 37 Wenger RH (2002) Cellular adaptation to hypoxia: O2-sensing protein hydroxylases, hypoxia-inducible O2-regulated gene expression, Transcription factors, and O2 FASEB J 16, 1151–1162 38 Ratcliffe PJ, O’Rourke JF, Maxwell PH & Pugh CW (1998) Oxygen sensing, hypoxia-inducible factor-1 and the regulation of mammalian gene expression J Exp Biol 201, 1153–1162 39 Krick S, Hanze J, Eul B, Savai R, Seay U, Grimminger ă F, Lohmeyer J, Klepetko W, Seeger W & Rose F (2005) Hypoxia-driven proliferation of human pulmonary artery fibroblasts: cross-talk between HIF-1alpha and an autocrine angiotensin system FASEB J 19, 857– 859 40 Salceda S & Caro J (1997) Hypoxia-inducible factor1a (HIF-1a) protein is rapidly degraded by the ubiquitin– proteasome system under normoxic conditions Its stabilization by hypoxia depends on redox-induced changes J Biol Chem 272, 22642–22647 41 Huang LE, Gu J, Schau M & Bunn HF (1998) Regulation of hypoxia-inducible factor 1alpha is mediated by an O2-dependent degradation domain via the ubiquitinproteasome pathway Proc Natl Acad Sci USA 95, 7987–7992 42 Schultz K, Fanburg BL & Beasley D (2006) Hypoxia and hypoxia-inducible factor-1alpha promote growth factor-induced proliferation of human vascular smooth muscle cells Am J Physiol Heart Circ Physiol 290, H2528–2534 43 Jiang M, Wang B, Wang C, He B, Fan H, Guo TB, Shao Q, Gao L & Liu Y (2006) Inhibition of hypoxiainducible factor-1alpha and endothelial progenitor cell differentiation by adenoviral transfer of small interfering RNA in vitro J Vasc Res 43, 511–521 44 Krishan A (1975) Rapid flow cytofluorometric analysis of mammalian cell cycle by propidium iodide staining J Cell Biol 66, 188–193 45 Zhu LL & Onaka T (2002) Involvement of medullary A2 noradrenergic neurons in the activation of oxytocin neurons after conditioned fear stimuli Eur J Neurosci 16, 2186–2198 FEBS Journal 275 (2008) 1824–1834 ª 2008 The Authors Journal compilation ª 2008 FEBS ... the growth of most kinds of cells, promote the proliferation of some types of cells There is increasing evidence that mild hypoxia acts as a potent regulator of various types of stem cells [12]... of GFP-positive cells was about 70% of that of total neural stem cells after days of transfection (Fig 4A) The expression of HIF-1a was detected by western blot, which showed that the level of. .. the neural stem cells derived from the embryonic mesencephalon (E13.5) were used in the present study Generally, neural stem cells were grown to form as neurospheres in vitro The ability of stem