Báo cáo khoa học: A fatty-acid-metabolizing enzyme fromArabidopsis potx

Characterization of a methyl jasmonate and woundingresponsive cytochrome P450 of Arabidopsis thaliana catalyzing dicarboxylic fatty acid formation in vitro Sylvie Kandel1, Vincent Sauveplane1, Vincent Compagnon1, Rochus Franke2, Yves Millet1, ` Lukas Schreiber2, Daniele Werck-Reichhart1 and Franck Pinot1 ´ ´ Institut de Biologie Moleculaire des Plantes, CNRS-Universite Louis Pasteur, Strasbourg, France Institut fur Zellula und Molekulare Botanik, Universitat Bonn, Germany ăre ă ă Correspondence F Pinot, IBMP-CNRS UPR 2357, Institut de Botanique, 28 Rue Goethe, F-67083 Strasbourg Cedex, France Fax: +33 90 24 19 21 Tel: +33 90 24 18 37 E-mail: franck.pinot@bota-ulp.u-strasbg.fr (Received July 2007, revised 31 July 2007, accepted August 2007) doi:10.1111/j.1742-4658.2007.06032.x A fatty-acid-metabolizing enzyme from Arabidopsis thaliana, CYP94C1, belonging to the cytochrome P450 family was cloned and characterized CYP94C1 was heterologously expressed in a Saccharomyces cerevisiae strain (WAT11) engineered for P450 expression When recombinant yeast microsomes were incubated with lauric acid (C12:0) for 15 min, one major metabolite was formed The product was purified and identified by GC ⁄ MS as 12-hydroxylauric acid Longer incubation (40 min) led to the formation of an additional metabolite identified by GC ⁄ MS as dodecadioic acid This diacid was also produced by incubation with 12-hydroxylauric acid These compounds were not produced by incubating microsomes from yeast transformed with a void plasmid, demonstrating the involvement of CYP94C1 This new enzyme also metabolized fatty acids of varying aliphatic chain lengths (C12 to C18) and in-chain modifications, for example, degree of unsaturation or the presence of an epoxide as an additional polar functional group Transcription of the gene encoding CYP94C1 is enhanced by stress, treatment with the hormone methyl jasmonate and wounding Treatment with methyl jasmonate also induced lauric acid metabolism in microsomes prepared from Arabidopsis The induction of hydroxylase activity was dose dependent and increased with exposure time, reaching 16· higher in microsomes from 24-h treated Arabidopsis compared with control plants Analysis of the metabolites showed a mixture of 12-, 11- and 10-hydroxylauric acids, revealing for the first time the presence of fatty acid in-chain hydroxylase in Arabidopsis There is increasing interest in the study of fatty-acidoxidizing enzymes in all organisms because the products appear to have important biological activities [1–3] Oxidized derivatives of the arachidonate cascade in mammals illustrate the diversity of structures and biological activities [4] In animals, cytochrome P450s of the CYP4A gene subfamily mainly catalyze the formation of x and x-1 hydroxyl derivatives of arachidonic acid (C20:4), the most abundant fatty acid Regulation of some CYP4A isoforms by peroxisome proliferator-activated receptors suggests a role in fatty acid catabolism [5] This is supported by the 5116 observation that fatty acids can be x-hydroxylated then further oxidized to the corresponding diacids [6,7], which are subjected to b-oxidation and eliminated in the urine [8,9] However, these oxidations cannot be considered as reactions leading only to catabolism, because dicarboxylic fatty acids have been shown to be bioactive metabolites [10] In yeast belonging to the genus Candida, x-hydroxylation of alkanes and fatty acids is catalyzed by members of the CYP52 family [11] These reactions have been clearly identified as part of catabolism CYP52A3 is able to catalyze a cascade of reactions from alkanes leading to FEBS Journal 274 (2007) 5116–5127 ª 2007 The Authors Journal compilation ª 2007 FEBS S Kandel et al mono- and dicarboxylic fatty acids which are further degraded by b-oxidation [12] This enables Candida maltosa to use aliphatic hydrocarbons as a source of carbon and energy In plants, as in other organisms, hydroxy fatty acids are produced mainly by enzymatic reactions catalyzed by cytochrome P450-dependent fatty acid hydroxylases Distinct fatty acid hydroxylases can be present in a single plant, raising the question of their respective roles in signaling and development [13,14] Depending on the regioselectivity, we distinguish between x- and in-chain (x–n) hydroxylases Most fatty acid x-hydroxylases belong to the CYP94 and CYP86 families of P450 enzymes [15] In-chain hydroxylases are poorly documented, despite their characterization about three decades ago [16–18] To date, only two in-chain hydroxylases, CYP81B1 [19] and CYP709C1 [20], have been identified in Heliantus tuberosus and wheat, respectively Most studies have thus been concerned with x-hydroxylases These enzymes have been investigated mainly in the context of cutin synthesis [21] However, it is now clear that they are involved in a whole range of biological processes Their products are involved in different aspects of plant development, and in response to biotic and abiotic stresses [15] Plants protect themselves against different stresses (i.e pathogens, chemicals and drought) with the cuticle, which is composed of wax and cutin Cutin is a biopolymer in which fatty acid monomers are cross-linked via ester bonds formed between carboxyl and x-hydroxyl groups [21] Evidence for fatty acid x-hydroxylation in plants was obtained from studies describing the x-hydroxylation of palmitic acid (C16:0) in Vicia faba microsomes [22] Characterization of P450-dependent x-hydroxylation reactions of C10 to C18 fatty acids followed in different plants [23–26] A strategy based on the use of a radiolabeled suicide substrate allowed us to isolate the gene encoding a plant fatty acid x-hydroxylase, CYP94A1, from Vicia sativa [27] The recombinant CYP94A1 enzyme was then shown to catalyze the formation of 18-hydroxy-9,10-epoxystearic and 9,10,18-trihydroxystearic acids, the major C18 cutin monomers, suggesting a potential role for this enzyme in cutin synthesis [28] Involvement of fatty acid x-hydroxylases in cutin synthesis was demonstrated in studies of Arabidopsis mutants Indeed, modification in the coding sequences of CYP86A8 and CYP86A2, two fatty acid x-hydroxylases, resulted in the production of Arabidopsis plants with an altered cuticle [29,30] The composition of Arabidopsis cutin has been determined only recently [31,32] Surprisingly, these analyses revealed that, although x-hydroxy fatty acids were present, the main compounds in Arabidopsis CYP94C1, a dicarboxylic fatty-acid-forming enzyme cutin are dicarboxylic fatty acids which have previously been reported only as minor cutin monomers in Brassica oleracea and Spinacia oleracea [33] To date, in Arabidopsis, no enzyme able to produce dicarboxylic fatty acids has been characterized We previously described CYP94A5 from tobacco, the only plant fatty acid x-hydroxylase described to date that is able to catalyze such a reaction in vitro [34] No catalytic function for P450 belonging to the CYP94C subfamily has been described to date CYP94Cs are found in higher plants from monocots to dicots (http://drnelson.utmem.edu/CytochromeP450 html) This means conserved and important biological functions Here, we present an approach to determine the catalytic and biological functions of CYP94C1 in the model plant Arabidopsis It was particularly interesting to begin functional analysis with CYP94C1, because it is the only member of the CYP94C subfamily in this plant It indicates an important function that precluded gene duplication CYP94C1 is encoded by a single gene, allowing efficient analysis of biological function via an insertional mutation In addition, CYP94C1 is found to be one of the major stress-inducible genes in all transcriptome analyses In this study, we report the heterologous and functional expression of CYP94C1 Substrate specificity and catalytic properties were explored using recombinant CYP94C1 expressed in engineered yeast We show that CYP94C1 is able to catalyze in vitro, the full conversion of a mono- to a dicarboxylic fatty acid Identification of CYP94C1 is of primary importance because working with Arabidopsis gives access to mutant studies that should help in the assessment of the physiological meaning of CYP94C1 in Arabidopsis and of members of the CYP94C subfamily in plants in general We also describe the presence of a cytochrome-P450-dependent enzymatic system able to catalyze fatty acids in-chain hydroxylations Results Cloning of CYP94C1 The coding sequence of CYP94C1 was cloned by PCR from an Arabidopsis cDNA library The deduced protein (495 amino acids) has a calculated mass of 56 566 Da and a pI of 8.12 Enzymatic characterization of CYP94C1 was carried out in microsomes of the yeast strain WAT11 transformed with the plasmid pYeDP60 [35] containing the coding sequence for CYP94C1 Only three cytochrome P450s are encoded by the yeast genome They are either not expressed or expressed at negligible levels under the growth FEBS Journal 274 (2007) 5116–5127 ª 2007 The Authors Journal compilation ª 2007 FEBS 5117 CYP94C1, a dicarboxylic fatty-acid-forming enzyme S Kandel et al conditions used and none is able to metabolize fatty acids, ensuring that the metabolism described here results from enzymatic reactions catalyzed by CYP94C1 Furthermore, WAT11 overexpresses a plant P450 reductase in order to optimize electron transfer during catalysis When the microsomal membrane fraction was isolated from CYP94C1-transformed yeasts, the expression level of the enzyme was evaluated on the basis of the differential absorbance values for reduced CO-bound versus reduced microsomes at 450 nm [36] The CYP94C1 content of the microsomal preparation used in our experiments was 2.4 nmol P450ỈmL)1 No absorbance at 450 nm was detected in microsomes from yeast transformed with a void plasmid, under the same growth conditions Substrate specificity In order to test the enzymatic activity and study the substrate specificity of CYP94C1, saturated and unsaturated fatty acids with chain lengths ranging from C12 to C18 were incubated at a concentration of 100 lm with microsomes from yeast expressing CYP94C1 Analysis of the reaction products showed that CYP94C1 is able to metabolize all the substrates assayed with the highest activity being found for epoxystearic acid (Fig 1) High levels of activity have also been determined for C18 unsaturated substrates, whereas activities for C16 and C14 substrates are low GC ⁄ MS analysis of the major metabolite generated with fatty acids of each chain length – C12, C14, C16 and 9,10-epoxystearic acid for the C18s – was performed All substrates are hydroxylated exclusively on the terminal methyl (x-position) by recombinant CYP94C1 whatever the length of the aliphatic chain Our model substrate, lauric acid (C12:0) is metabolized with one of the highest velocities determined Furthermore, it is not a substrate for other enzymes (i.e lipoxygenase, peroxygenase or epoxide hydrolase) which may interfere with our measurements, therefore, this substrate was used in this study Lauric acid metabolism Lauric acid was incubated with microsomes from yeast expressing CYP94C1 and the reaction products were resolved by thin-layer radiochromatography (Fig 2) Incubation was performed in the absence (Fig 2A) or presence (Fig 2B–D) of NADPH for either 15 (Fig 2A,B,D) or 40 (Fig 2C) After 15 min, a single major metabolite was formed (Fig 2B, peak 1) This compound was not formed in the absence of NADPH (Fig 2A) or with microsomes from yeast transformed using a void plasmid (Fig 2D) This compound was purified and identified by GC ⁄ MS as 12-hydroxylauric acid When the incubation time was increased to 40 min, almost all the lauric acid (90%) was converted to 12-hydroxylauric acid and two additional metabolites (Fig 2C, peaks and 3) were generated 12-Hydroxylauric acid metabolism Fig Substrate specificity of CYP94C1 Microsomes from yeast expressing CYP94C1 were incubated with 100 lM of radiolabeled substrate Incubations were performed for 10 at 27 °C and contained 24 pmol of CYP94C1 Activities were determined as described in ‘Experimental procedures’ by following on TLC the formation rate of the metabolites Epox, epoxystearic acid 5118 In order to determine the origin of these new metabolites and to show a precursor ⁄ product relationship, we incubated purified 12-hydroxylauric acid with microsomes from yeast expressing CYP94C1 (Fig 3) Incubation was performed for 30 in the absence (Fig 3A) or presence (Fig 3B,C) of NADPH Two metabolites were produced in the presence of NADPH (Fig 3B, peaks and 3) They were not produced in incubations using microsomes from yeast transformed with a void plasmid (Fig 3C) They showed the same Rf values as the two metabolites in peaks and obtained from lauric acid (Fig 2C) Based on previous studies, this mobility suggested that the metabolite in peak could be dodecadioic acid After purification, GC ⁄ MS analysis confirmed that this peak represents the dioic acid derivative of lauric acid, namely dodecadioic acid The metabolite in peak could be the intermediate aldehyde expected when oxidizing the hydroxyl to the carboxyl function A scheme of the reactions catalyzed by CYP94C1 using lauric acid as a substrate is presented in Fig FEBS Journal 274 (2007) 5116–5127 ª 2007 The Authors Journal compilation ª 2007 FEBS S Kandel et al Fig Radiochromatography resolution by TLC of metabolites generated in incubations of lauric acid with microsomes from yeast expressing CYP94C1 Microsomes were incubated with 100 lM [1-14C]lauric acid in the absence (A) or presence (B–D) of NADPH Incubations A, B and C were performed at 27 °C and contained 70 pmol of CYP94C1 (28 · 10)3 mg protein) Incubation D was performed with microsomes from yeast transformed with a void plasmid and contained 28 · 10)3 mg protein Reactions were stopped after 15 (A,B,D) or 40 (C) by addition of 20 lL of acetonitrile (containing 0.2% of acetic acid) and directly spotted onto TLC plates [diethyl ether ⁄ light petroleum (boiling point 40–60 °C) ⁄ formic acid; 50 : 50 : 1; v ⁄ v ⁄ v] Peak S, lauric acid; peak 1, 12-hydroxylauric acid; peak 2, dodecan-1,12-dioic acid; peak 3, not determined CYP94C1, a dicarboxylic fatty-acid-forming enzyme Fig Radiochromatography resolution by TLC of metabolites generated in incubations of 12-hydroxylauric acid with microsomes from yeast expressing CYP94C1 Microsomes were incubated with 100 lM of 12-hydroxy[1-14C]lauric acid in the absence (A) or presence (B,C) of NADPH Incubations A and B were performed at 27 °C and contained 94 pmol of CYP94C1 (37 · 10)3 mg protein) Incubation C was performed with microsomes of yeast transformed with a void plasmid and contained 37 · 10)3 mg protein Reactions were stopped after 30 by addition of 20 lL acetonitrile (containing 0.2% of acetic acid) and directly spotted on TLC plates [diethyl ether ⁄ light petroleum (boiling point 40–60 °C) ⁄ formic acid; 50 : 50 : 1; v ⁄ v ⁄ v] Peak 1, 12-hydroxylauric acid; peak 2, dodecan-1,12-dioic acid; peak 3, not determined CYP94C1 induction by methyl jasmonate and wounding Total RNA from 5-week-old Arabidopsis was extracted immediately after harvest or after transfer for different periods in distilled water or distilled water containing 250 lm of the stress hormone methyl jasmonate CYP94C1 expression was followed by northern blot analysis (Fig 5) No transcript was detected in control plants just after harvest (lane Co) Transfer to water led to a rapid increase in CYP94C1 expression This was probably due to wound induction when plants were removed from MS agar plates and transferred to water or a solution containing methyl jasmonate Fig Oxidation of dodecanoic acid (lauric acid) to dodecadioic acid by CYP94C1 (A) Dodecanoic acid, (B) 12-hydroxy-dodecanoic acid, (C) 12-oxo-dodecanoic acid, (D) dodecadioic acid FEBS Journal 274 (2007) 5116–5127 ª 2007 The Authors Journal compilation ª 2007 FEBS 5119 CYP94C1, a dicarboxylic fatty-acid-forming enzyme S Kandel et al Fig Northern blot analysis of CYP94C1 expression in control and methyl jasmonate treated A thaliana Total RNAs were extracted from g of Arabidopsis plants RNAs (8 lg) were subjected to RNA blot analysis 28S and 18S ribosomal RNA from A thaliana was used as an internal standard Lane C (control), RNAs from plants exposed to water; lane T (treated), RNAs from plants exposed to a 250 lM methyl jasmonate solution Lane Co, RNAs from plants not exposed to water or to water containing methyl jasmonate Induction of CYP94C1 expression was much higher in plants exposed to methyl jasmonate and maximum expression was observed after h of treatment (Fig 5) After 24 h CYP94C1 transcript accumulation was no longer detected in plants incubated in water but was still present in plants treated with methyl jasmonate We also monitored the effect of wounding, by four transversal razor-blade cuts, on CYP94C1 expression using quantitative real-time RT-PCR The results reported in Table show an almost 900-fold increase in CYP94C1 transcript accumulation only 30 after wounding, followed by a rapid decrease Lauric acid metabolism in Arabidopsis microsomes Hydroxylation of lauric acid was measured in microsomes from 5-week-old Arabidopsis treated for 24 h with various concentrations of methyl jasmonate Lauric acid hydroxylation was correlated with increasing concentrations of methyl jasmonate (Fig 6) Even at the lowest concentration tested (20 lm), activity was enhanced fourfold compared with controls (30 versus pmolỈmin)1Ỉmg)1 protein) Lauric acid hydroxylation Fig Dose effect of methyl jasmonate on lauric acid hydroxylation in microsomes from A thaliana Hydroxylation was measured in microsomes from A thaliana (5 weeks old) induced 24 h in a solution containing increasing concentrations of methyl jasmonate Data are expressed as mean ± SD of activity assays performed in triplicate in plant microsomes also increased with increasing exposure up to 24 h (Fig 7) The effect of methyl jasmonate was detectable after h of treatment; activity was threefold higher in microsomes from plants treated with the stress hormone (15 versus pmolỈ min)1Ỉmg)1 protein) Activity increased with exposure and after 24 h it was 16-fold higher in microsomes from treated plants compared with microsomes from control plants (160 versus 10 pmolỈmin)1Ỉmg)1 protein) In order to identify the products of lauric acid metabolism in plant microsomes, we incubated microsomes from plants treated for h with 250 lm methyl jasmonate with lauric acid Incubation was performed in the absence (Fig 8A) or presence (Fig 8B) of NADPH Three metabolites were generated only when NADPH was present (Fig 8B, peaks 1–3) The metabolites in peaks 1, and were identified by GC ⁄ MS as 11-, 10- and 12-hydroxylauric acids, respectively After 24 h of treatment 11- and 10-hydroxylauric acids represented > 90% of the metabolites (not shown) Table Quantitative real-time RT-PCR of CYP94C1 gene expression using the comparative Ct method Ct DCt CYP94C1 Nonwounded control plant 0.5 h after wounding h after wounding h after wounding h after wounding 30.7 21.2 23.3 27.13 28.5 19.53 19.82 19.7 18.85 19.25 2–DDCt CYP94C1 act2 a ± ± ± ± ± 0.1 0.05 0.03 0.17 0.5 ± ± ± ± ± 0.01 0.01 0.02 0.05 0.05 CYP94C1 11.7 1.38 3.6 8.28 9.25 885 190 7.4 3.8 ± ± ± ± ± 0.01 0.025 0.13 0.03 0.27 (0.99–1.01)b (864–907) (172–209) (7.31–7.41) (3.16–4.5) The amounts of CYP94C1 transcripts (2–DDCt) are normalized to the endogenous reference gene act2, and relative to the wild-type nonwounded plants a Threshold cycle; mean values of duplicate assays carried out with two plants b The range given for CYP94C1 expression relative to wild-type plants is given in parentheses 5120 FEBS Journal 274 (2007) 5116–5127 ª 2007 The Authors Journal compilation ª 2007 FEBS S Kandel et al CYP94C1, a dicarboxylic fatty-acid-forming enzyme Fig Effect of time of treatment with methyl jasmonate on lauric acid hydroxylation in microsomes from A thaliana Hydroxylation was measured in microsomes from A thaliana (5 weeks old) induced for different periods in water (white bar) or water containing 250 lM methyl jasmonate (black bar) Hydroxylation in microsomes from plants not exposed to water or water containing methyl jasmonate is also reported (hatched bar) Data are expressed as the mean ± SD of activity assays performed in triplicate Discussion This study describes the heterologous expression and characterization of a new fatty acid hydroxylase of the cytochrome P450 family in Arabidopsis CYP94C1 has been expressed in the engineered yeast WAT11 previously used to study other plant cytochrome P450s [20,27] This heterologous system avoids problems related to the presence of inhibitors, proteases or pigments during the characterization of P450 activity in plant microsomes We were able to show that CYP94C1 is a fatty acid x-hydroxylase but in addition to this activity, which has already been described for CYP86A8 and CYP86A1 from Arabidopsis [29,37], it is also able to transform an x-hydroxy fatty acid into the A corresponding dicarboxylic fatty acid This is the first in vitro demonstration of such activity with an enzyme from Arabidopsis Database searches show the existence, in plants from diverse phyla, of members of the CYP94C subfamily, suggesting that cytochrome-P450dependent dicarboxylic fatty acids forming enzymes are widespread in plants The physiological meaning of these enzymes in plants remains to be established In animals, their role is well documented and two enzymatic pathways have been described The first involves x-hydroxylation of the methyl group by enzymes belonging to the cytochrome P450 4A subfamily [38] The x-derivative is further oxidized to the final dicarboxylic acid by alcohol and aldehyde dehydrogenases [7,10,39] In the second pathway, dicarboxylic fatty acids are formed via a cytochrome-P450-mediated route where a single enzyme can catalyze the complete oxidation of the methyl to the carboxyl group [6,7] In both pathways, the resulting dicarboxylic fatty acid can then be eliminated either by urine excretion or b-oxidation in mitochondria or peroxisomes [40] The key role of x-hydroxylases in fatty acid catabolism is also established for yeast belonging to the genus Candida Members of the CYP52 family enable C maltosa to grow on media containing aliphatic hydrocarbons as a sole source of carbon and energy [11,12] In plants, peroxisomal fatty acid b-oxidation is of primary importance in both germinating seeds and mature photosynthetic tissues [41,42] However, no direct involvement of x-hydroxylases in fatty acid catabolism has been demonstrated, although there are clues in favor of such an implication In mammals, members of the CYP4A subfamily involved in fatty acid catabolism are regulated by peroxisome proliferators (i.e clofibrate) via activation of the peroxisome proliferators-activated receptor a [43] Prostaglandins B Fig Radiochromatographic resolution by RP-HPLC of metabolites generated in incubations of lauric acid with microsomes from A thaliana treated with methyl jasmonate Microsomes from A thaliana treated for h with 250 lM methyl jasmonate were incubated with 100 lM lauric acid for 30 at 27 °C in the absence (A) or presence (B) of NADPH Incubation media were directly subjected to HPLC analysis Acetonitrile ⁄ water ⁄ acetic acid (30 : 70 : 0.2, v ⁄ v ⁄ v) at a flow rate of mLỈmin)1 was used to elute 12-, 11- and 10-hydroxylauric acids A linear gradient (0–100%) of 80% acetonitrile in aqueous acetic acid was used to elute residual lauric acid Peak 1, 11-hydroxylauric acid; peak 2, 10-hydroxylauric acid; peak 3, 12-hydroxylauric acid FEBS Journal 274 (2007) 5116–5127 ª 2007 The Authors Journal compilation ª 2007 FEBS 5121 CYP94C1, a dicarboxylic fatty-acid-forming enzyme S Kandel et al and fatty acid derivatives are among the best peroxisome proliferators-activated receptor activators described [44,45] Previously, we have shown that plant fatty acid x-hydroxylases can also be upregulated at the transcriptional level by peroxisome proliferators [13,24,27] There is a striking resemblance between methyl jasmonate and prostaglandins, both stress-signaling molecules from plants and mammals, respectively, and both derived from fatty acids It is thus tempting to speculate that CYP94C1 could play a role in fatty acid catabolism and that its regulation occurs via a mechanism similar to that regulating x-hydroxylases participating in fatty acid degradation in mammals Arachidonic acid (C20:4) is a major fatty acid in animals There is growing evidence that the dicarboxylic form exhibits a broad range of biological activity [10] Recently, Abaffy et al [46] showed that mouse odorant receptors can bind dicarboxylic fatty acids with chain lengths ranging from C8 to C12 In contrast, dicarboxylic fatty acids are poorly documented in plants Traumatic acid, which is a dicarboxylic fatty acid (10E-dodeca-1,12-dicarboxylic acid), was one of the first biologically active molecules to be isolated from plants [47] It is generated during the metabolism of fatty acid hydroperoxides and is involved in the wound response in plants [48] As proposed for x-hydroxylases from mammals [7] and yeast [12], it is likely that the transformation of x-hydroxy fatty acid to the corresponding dicarboxylic fatty acid by CYP94C1 occurs via an intermediate terminal aldehyde Interestingly, fatty-acid-derived aldehydes, generally produced by fatty acid hydroperoxide lyase [49], exhibit antibacterial [50] and antifungal activities [51,52] These observations suggest the participation of CYP94C1 in plant defense Rapid induction of CYP94C1 by stress, the hormone methyl jasmonate and wounding further supports its involvement in plant defense In line with this, it is noteworthy that tobacco CYP94A5, the only other plant fatty acid x-hydroxylase able to produce dicarboxylic fatty acids, was rapidly induced upon infection with tobacco mosaic virus [34] As mentioned previously, plant fatty acid x-hydroxylases have been studied mainly in the context of cutin synthesis, a biopolymer that is part of the protective plant cuticle [21] In the majority of plants studied to date, cutin is composed of fatty acids linked via ester bonds between carboxyl and x-hydroxyl groups Because the A thaliana cuticle is very thin and fragile [53], it is only recently that analysis of its cutin has been successful [31,32] The results were unexpected because the most prominent monomers in Arabidopsis 5122 cutin were dicarboxylic fatty acids, which had previously been reported as only minor components in Brassica oleracea and Spinacia oleracea [33] Analysis of the Arabidopsis lacerata mutant demonstrated the involvement of CYP86A8 in cuticle formation However, because of their catalytic properties, this enzyme, as well as other fatty acid x-hydroxylases described in Arabidopsis, CYP86A2 and CYP86A1 [30,37], cannot account for dicarboxylic fatty acid formation Our study indicates that CYP94C1 may be involved in the formation of dicarboxylic fatty acids in Arabidopsis cutin Recently, Kurdyukov et al [54] described the Arabidopsis hothead mutant, which exhibited a decrease in dicarboxylic fatty acid content in leaf HOTHEAD protein product showed sequence similarities to fatty acid x-hydroxyl dehydrogenases, suggesting a possible role in dicarboxylic fatty acid formation However, cutin compositional changes in hothead were only moderate and enzyme activity of the protein remains to be confirmed This study is also the first report of successful fatty acid hydroxylation measurement in microsomes prepared from Arabidopsis The study with methyl jasmonate showed that the highest levels of lauric acid hydroxylation in Arabidopsis microsomes was measured after 24 h of exposition when the level of CYP94C1 transcript had already dropped This delay can be explained by the fact that the major lauric acid metabolites produced are in-chain hydroxy derivatives At least one other enzymatic system is thus operating in methyl jasmonate but the kinetics of its induction is unknown because no Arabidopsis in-chain fatty acid hydroxylases have been reported to date Recently, we characterized CYP709C1 from wheat as an in-chain hydroxylase [20] and we have cloned the Arabidopsis members of this family (CYP709B1, CYP709B2 and CYP709B3) However, expression in yeast failed to demonstrate any activity for the Arabidopsis enzymes Enzymes responsible for this activity thus remain to be characterized Some good candidates are the cytochrome P450s belonging to the CYP81 family, which includes plants in-chain fatty acid hydroxylases [19] No physiological functions have been assigned to plant fatty acid in-chain hydroxylases In conclusion, we cloned and characterized CYP94C1 a novel fatty acid x-hydroxylase from Arabidopsis Understanding its physiological role can, in part, be achieved by studying its substrate specificities and catalytic properties In order to so, we heterologously expressed CYP94C1 and showed that it can catalyse the formation of dicarboxylic fatty acids Regulation studies suggest a potential role in defense For plants, defense is fundamental to survival because they are FEBS Journal 274 (2007) 5116–5127 ª 2007 The Authors Journal compilation ª 2007 FEBS S Kandel et al sessile organisms and rely on a battery of chemical defenses for protection against predators and environmental stress For this reason, they have developed a complex metabolic network that is largely reflected by the evolution of large gene families of cytochrome P450 The catalytic and biological activities of most of the members of these gene families remain unexplored They usually contribute to the synthesis of signals, defense molecules (phytoalexins) or to formation of physical barriers (i.e cutin) to block the growth or the invasion of pathogens [55] Lipid metabolism is a major player in this defense network and CYP94C1 could be involved in plant defense by contributing to cutin synthesis or by producing metabolites with properties similar to those described for traumatic acid or for fatty acids derivatives produced by hydroperoxide lyases also implicated in defense [49] Finally, establishment of a defense mechanism requires energy which could be produced by b-oxidation of dicarboxylic fatty acids produced by CYP94C1 These hypotheses will be verified by functional genetics and mutants studies currently in progress We are also in the process of identifying the enzyme(s) responsible for the in-chain hydroxylation of fatty acids described for the first time in Arabidopsis Experimental procedures Chemicals Radiolabeled [1-14C]lauric acid (45 CiỈmol)1) was from CEA (Gif sur Yvette, France) [1-14C]Myristic acid (55 CiỈmol)1), [1-14C]palmitic acid (54 CiỈmol)1), [1-14C]oleic acid (50 CiỈmol)1), [1-14C]linoleic acid (58 CiỈmol)1) and [1-14C]linolenic (52 CiỈmol)1) were from Perkin-Elmer Life Sciences (Courtaboeuf, France) 9,10-Epoxy[1–14C]stearic acid was synthesized from [1-14C]oleic acid using m-chloroperoxybenzoic acid The silylating reagent N,O-bistrimethylsilyltrifluoroacetamide containing 1% of trimethylchlorosilane was from Pierce (Rockford, IL) NADPH was from Sigma (St Louis, MO) Thin-layer plates (Silica Gel G60 F254; 0.25 mm) were from Merck (Darmstadt, Germany) Cloning of CYP94C1 The coding sequence of CYP94C1 (AT2g27690) was cloned by PCR from a siliques cDNA library of Arabidopsis ecotype Columbia-0 Primers 5¢-CCCCCCCCCCCGGGAT GTTACTAATCATATCATTC-3¢ and 5¢-CCCCCCCCG AGCTCCTAATGGTGATGGTGACTCCTTTCTTGGAT CAT-3¢ were used as the forward and reverse primers, respectively The PCR was carried out with Hifi DNA poly- CYP94C1, a dicarboxylic fatty-acid-forming enzyme merase (Roche Applied Science, Meylan, France) and for 34 thermal cycles (1 at 94 °C, at 54 °C, 30 s at 72 °C) Purified PCR product was cloned into pGEM-T vector (Promega, Madison, WI), sequenced and transfered in the pYeDP60 vector using the SmaI and SacI restriction sites The sequence was verified by DNA sequencing after the cloning step in the yeast vector Heterologous expression of CYP94C1 in yeast For functional expression of the full-length CYP94C1 clone, we used a yeast-expression system specifically developed for the expression of P450 enzymes and consisting of plasmid pYeDP60 and Saccharomyces cerevisiae WAT11 strain [35] Only three P450s are present in yeast and none is able to hydroxylate fatty acids Strain WAT11 had its NADPH– P450 reductase deleted and replaced by the Arabidopsis NADPH–P450 reductase which allows excellent electron transfer and probably increases the stability of the plant P450 in the yeast endoplasmic reticulum Yeast cultures were grown and induced as described previously [35] from one isolated transformed colony After growth, cells were harvested by centrifugation and manually broken with glass beads (0.45 mm diameter) in 50 mm Tris ⁄ HCl buffer (pH 7.5) containing mm EDTA and 600 mm sorbitol The homogenate was centrifuged for 10 at 10 000 g using a JA14 rotor (Beckman, Roissy, France) The resulting supernatant was centrifuged for h at 100 000 g using a 45Ti rotor (Beckman) The pellet consisting of microsomal membranes was resuspended in 50 mm Tris ⁄ HCl (pH 7.4), mm EDTA and 30% (v ⁄ v) glycerol with a Potter-Elvehjem homogenizer and stored at )30 °C The volume of resuspension buffer is proportional to the weight of yeast pellet: microsomes extracted from g of yeast are resuspended in mL of buffer All procedures for microsomal preparation were carried out at 0– °C The cytochrome P450 content was measured using the method described by Omura and Sato [36] Plant material and microsomal preparation After sterilization, Arabidopsis (ecotype Col-0) seeds were grown on Murashige and Skoog medium (4.2 gỈL)1, sucrose 10 gỈL)1, pastagar B gỈL)1, myoinositol 100 mgỈL)1, thiamine 10 mgỈL)1, nicotinic acid mgỈL)1 and pyridoxine mgỈL)1; final pH 5.7) for weeks For controls, Arabidopsis plants were harvested, rinsed to eliminate Murashige and Skoog medium and incubated in 2-L Erlenmeyer flasks containing 1.5 L distilled water For treatment, plants were incubated in 2-L Erlenmeyer flasks containing 1.5 L distilled water with methyl jasmonate as previously described [20] The incubation medium was aerated by a stream of air (5 LỈmin)1) at 25 °C The duration of treatment and the concentration of methyl jasmonate are specified for each experiment FEBS Journal 274 (2007) 5116–5127 ª 2007 The Authors Journal compilation ª 2007 FEBS 5123 CYP94C1, a dicarboxylic fatty-acid-forming enzyme S Kandel et al Approximately 10 g of Arabidopsis plants were homogenized with a pestle and mortar in 50 mL of extraction buffer (250 mm tricine, 50 mm NaHSO3, gỈL)1 BSA, mm EDTA, 100 mm ascorbic acid and mm dithiothreitol; final pH 8.2) The homogenate was filtered through 50 lm nylon filtration cloth and centrifuged for 10 at 10 000 g using a JA14 rotor (Beckman) The resulting supernatant was centrifuged for h at 100 000 g using a 45Ti rotor (Beckman) The microsomal pellets were resuspended in the buffer at pH 8.2 (50 mm NaCl, 100 mm tricine, 250 mm sucrose, mm EDTA and mm dithiothreitol), with a Potter-Elvehjem homogenizer and stored at )30 °C All procedures for microsomal preparation were carried out at 0–4 °C Microsomal protein content was estimated by a microassay procedure from Bio-Rad (Hercules, CA) using BSA as standard Northern blot analysis Total RNAs were isolated from g of 5-week-old Arabidopsis plants For northern blot analysis, total RNAs (8 lgỈ lane)1) were denatured, subjected to electrophoresis on 1.2% agarose gel containing formaldehyde, and transferred onto a Hybond N+ membrane (Amersham Biosciences, Uppsala, Sweden) The blot was hybridized with 32P-labeled cDNA corresponding to the coding region of CYP94C1 at 65 °C for 16 h in the solution at pH7 [750 mm NaCl, 75 mm sodium citrate (w/w)] After hybridization, the blot was washed twice with the solution 300 mm NaCl, 30 mm sodium citrate, 0.1% SDS (w/v) at room temperature for 15 min, and twice with the solution 30 mm NaCl, mm sodium citrate, 0.1% SDS (w/v) at 55 °C for 30 The 28S and 18S ribosomal RNAs from Arabidopsis were used as an internal control Quantitative real-time RT-PCR Arabidopsis plants (5 weeks old), were injured on four leaves of the rosette by four transversal razor-blade cuts Total RNA were isolated from pooled leaf tissues using NucleoSpin RNA Plant kit (Macherey-Nagel, Hoerdt, 10 France) A reverse transcription reaction was performed on lg of total RNA with 200 units of M-MLV reverse transcriptase (SuperScipt III, Invitrogen, Carlsbad, CA), 200 ng of random hexamers (Boeringher Mannheim, Ridgefield, CO) and 500 lm dNTPs in a final volume of 20 lL Real-time RT-PCR assays were performed with SYBR Green PCR master mix (Applied Biosystems, Foster City, CA) in a final volume of 25 lL including appropriate primer pairs designed with the software Primer Express (Applied Biosystems) Assays were run in triplicate on a GeneAmp 5700 sequence detection system (Applied Biosystems) and using the primer pair: 94C1F (5¢-GAGGTGGTTGGATAACGAAGG-3¢) and 94C1R (5¢-CTAGCTCCGGCCTGGAAAA-3¢) The amplification 5124 program consisted of 40 cycles (95 °C for 15 s, then 60 °C for min) The relative quantification of gene expression was performed using the comparative Ct (threshold cycle) method in which the amount of target, normalized to an endogenous reference and relative to a calibrator, is given by the formula 2–Ct [56] The Arabidopsis gene act2 (at3g18780) was used as an endogenous reference The amplification reaction on the reference target was carried out using the primer’s pair SK77 (5¢-TTCAATGT CCCTGCCATGTATG-3¢) and SK78 (5¢-AATACCGGTT GTACGACCAC-3¢) Enzyme activities All radiolabeled substrates were dissolved in ethanol that was evaporated before the addition of microsomes into the glass tube Resolubilization of the substrates was confirmed by measuring the radioactivity of the incubation media Enzymatic activities of CYP94C1 or Arabidopsis microsomes were determined by following the formation rate of metabolites The standard assay (0.1 mL) contained 20 mm sodium phosphate (pH 7.4), mm NADPH, plus a regenerating system (consisting of a final concentration of 6.7 mm Glc6P and 0.4 units Glc6P-dehydrogenase) and radiolabeled substrate (100 lm) The reaction was initiated by the addition of NADPH and was stopped by the addition of 20 lL acetonitrile (containing 0.2% acetic acid) The reaction products were resolved by TLC or HPLC as described below Chromatography methods Incubation media were directly spotted on TLC plates To separate hydroxy fatty acids from residual substrate, TLC were developed with a mixture of diethyl ether ⁄ light petroleum (boiling point, 40–60 °C) ⁄ formic acid (50 : 50 : 1, v ⁄ v ⁄ v) Plates were scanned with a radioactivity detector (Raytest Rita Star) The area corresponding to the metabolites was scraped into counting vials and quantified by liquid scintillation, or they were eluted from the silica with 10 mL diethyl ether, which was removed by evaporation They were then subjected to GC ⁄ MS analysis For HPLC analysis, reaction products were directly injected after incubations The metabolites were resolved by RP-HPLC (Waters equipped with two 600 pumps and a Packard 500 TR series radiodetector) on a lm Ultrasphere C18 column (150 · 4.6 mm, Beckman Institute, France) using isocratic solvent at a flow of mLỈmin)1 A mixture of acetonitrile ⁄ water ⁄ acetic acid (30 : 70 : 0.2, v ⁄ v ⁄ v) at a flow rate of mLỈmin)1 was used to elute 12-, 11- and 10-hydroxylauric acids A linear gradient (0–100%) of 80% acetonitrile in aqueous acetic acid was used to elute residual lauric acid FEBS Journal 274 (2007) 5116–5127 ª 2007 The Authors Journal compilation ª 2007 FEBS S Kandel et al GC/MS analysis Authentic 12-hydroxydodecanoic (12-hydroxylauric), dodecadioic acid, 16-hydroxyhexadecanoic and hexadecadioic 11 acids (purchased from Aldrich, Saint Quentin, France) were trimethylsilylated with N,O-bistrimethylsilyltrifluoroacetamide containing 1% (v ⁄ v) trimethylchlorosilane (1 : 1, v ⁄ v) and subjected to GC ⁄ MS analysis carried out on a gas chromatograph (Agilent 6890 Series) equipped with a 30-m capillary column with an internal diameter of 0.25 mm and a film thickness of 0.25 lm (HP-5MS) The gas chromatograph was combined with a quadrupole mass selective detector (Agilent 5973 N) Mass spectra were recorded at 70 eV For analysis of products generated by recombinant CYP94C1, in incubation with lauric acid, metabolite of peak (Fig 2B) was eluted from silica with 10 mL of diethyl ether ⁄ hexane (50 : 50, v ⁄ v), trimethylsilylated and subjected to GC ⁄ MS analysis as described above Mass spectrum showed ions at m ⁄ z (relative intensity) 73 (100%) (CH3)3Si+, 75 (97%) [(CH3)2Si+ ¼ O], 103 (19%) [CH2(OSi(CH3)3)], 117 (18%), 129 (18%), 147 (39%), 149 (24%), 204 (12%), 217 (13%), 255 (27%), 329 (24%), 345 (76%) (M-15) (loss of CH3 from TMSi group), 360 (1%) (M) This fragmentation pattern is identical to that obtained with authentic derivatized 12-hydroxylauric acid (M ẳ 360 gặmol)1) After elution from silica, metabolite of peak (Fig 3B) was trimethylsilylated and subjected to GC ⁄ MS analysis Its mass spectrum showed ions at m ⁄ z (relative intensity) 73 (100%) (CH3)3Si+, 75 (95%) [(CH3)2Si+ ¼ O], 117 (27%), 129 (45%), 204 (24%), 217 (23%), 243 (30%), 359 (89%) (M-15) (loss of CH3 from TMSi group), 374 (1%) (M) This fragmentation pattern is identical to the one of authentic derivatized dodecadioic acid (M ẳ 374 gặmol)1) The major metabolite generated during incubation of hexadecanoic acid (C16:0) with recombinant CYP94C1, was eluted from silica with 10 mL of diethyl ether ⁄ hexane (50 : 50, v ⁄ v), trimethylsilylated and subjected to GC ⁄ MS analysis as described above Mass spectrum showed ions at m ⁄ z (relative intensity) 73 (97%) [(CH3)3Si+], 75 (100%) [(CH3)2Si+ ¼ O], 103 (21%) [CH2(OSi(CH3)3)], 117 (20%), 129 (19%), 147 (23%), 204 (22%), 217 (17%), 311 (30%), 385 (33%), 401 (82%) (M-15) (loss of CH3 from TMSi group), 416 (1%) (M) This fragmentation pattern is identical to that obtained with authentic derivatized 16-hydroxyhexadecanoic acid (M ¼ 416 gỈmol)1) Major metabolites generated during incubation of tetradecanoic (C14:0) and 9,10-epoxystearic acids with recombinant CYP94C1 were eluted from silica with 10 mL of diethyl ether ⁄ hexane (50 : 50, v ⁄ v), methylated with diazomethane and trimethylsilylated Mass spectrum of tetradecanoic acid metabolite after derivatization showed ions at m ⁄ z (relative intensity) 73 (23%) ((CH3)3Si+), 75 (27%) [(CH3)2Si+ ¼ O], 103 (11%), 283 (100%) (M-47) [loss of methanol from the (M-15) fragment], 299 (4%) (M-31) (loss CYP94C1, a dicarboxylic fatty-acid-forming enzyme of OCH3 from the methyl ester), 301 (1%) (M-29), 315 (30%) (M-15) (loss of a methyl from the TMSi group) This fragmentation pattern is characteristic of the derivative of 14-hydroxytetradecanoic acid (M ẳ 330 gặmol)1) The mass spectrum of 9,10-epoxystearic acid metabolite after derivatization showed ions at m ⁄ z (relative intensity) 73 (80%) [(CH3)3Si+], 75 (100%) [(CH3)2Si+ ¼ O], 353 (5%) (M-47) [loss of methanol from the (M-15) fragment], 367 (8%) (M-15–18) [loss of H2O from the (M-15) fragment], 369 (3%) (M-31) (loss of OCH3 from the methyl ester), 371 (1%) (M-29), 385 (3%) (M-15) (loss of a methyl from the TMSi group) We also observed ions at m ⁄ z 171 (8%), 185 (6%), 199 (15%), 213 (14%), 215 (11%), 243 (19%) resulting from cleavage on both sides of the epoxide [20] This fragmentation pattern is characteristic of the derivative of 18-hydroxy-9,10-epoxystearic acid (M ẳ 400 gặmol)1) Metabolites generated in incubation of Arabidopsis microsomes (Fig 8B, peaks 1–3) with lauric acid were derivatized and identified as 11-, 10- and 12-hydroxylauric acids as described previously [20] Acknowledgements S Kandel is grateful to the French Ministry of Research for supporting her PhD thesis The authors thank Professor F Bernier and Dr I Benveniste for critical reading of the manuscript References Funk CD (2001) Prostaglandins and leukotrienes: advances in eicosanoid biology Science 294, 1871–1875 ´ Blee E (2002) Impact of phyto-oxylipins in plant defense Trends Plant Sci 7, 315–322 Noverr MC, Erb-Downward JR & Huffnagle GB (2003) Production of eicosanoids and other oxylipins by pathogenic eukaryotic microbes Clin Microbiol Rev 16, 517–533 Spector AA, Fang X, Snyder GD & Weintraub NL (2004) Epoxyeicosatrienoic acids (EETs): metabolism and biochemical function Prog Lipid Res 43, 55–90 Simpson AECM (1997) The cytochrome P450,4 (CYP4) family Gen Pharmacol 28, 351–359 Sanders RJ, Ofman R, Duran M, Kemp S & Wanders RJ (2006) Omega-oxidation of very long-chain fatty acids in human liver microsomes Implications for X-linked adrenoleukodystrophy J Biol Chem 281, 13180–13187 Sanders RJ, Ofman R, Valianpour F, Kemp S & Wanders RJ (2005) Evidence for two enzymatic pathways for omega-oxidation of docosanoic acid in rat liver microsomes J Lipid Res 46, 1001–1008 Ferdinandusse S, Denis S, Van Roermund CW, Wanders RJ & Dacremont G (2004) Identification of FEBS Journal 274 (2007) 5116–5127 ª 2007 The Authors Journal compilation ª 2007 FEBS 5125 CYP94C1, a dicarboxylic fatty-acid-forming enzyme 10 11 12 13 14 15 16 17 18 19 20 S Kandel et al the peroxisomal beta-oxidation enzymes involved in the degradation of long-chain dicarboxylic acids J Lipid Res 45, 1104–1111 Kolvraa S & Gregersen N (1986) In vitro studies on the oxidation of medium-chain dicarboxylic acids in rat liver Biochim Biophys Acta 876, 515–525 Collins XH, Harmon SD, Kaduce TL, Berst KB, Fang X, Moore SA, Raju TV, Falck JR, Weintraub NL, Duester G et al (2005) Omega-oxidation of 20-hydroxyeicosatetraenoic acid (20-HETE) in cerebral microvascular smooth muscle and endothelium by alcohol dehydrogenase J Biol Chem 280, 33157–33164 Craft DL, Madduri KM, Eshoo M & Wilson CR (2003) Identification and characterization of the CYP52 family of Candida tropicalis ATCC 20336, important for the conversion of fatty acids and alkanes to alpha, omega-dicarboxylic acids Appl Environ Microbiol 69, 5983–5991 Scheller U, Zimmer T, Becher D, Schauer F & Schunck W (1998) Oxygenation cascade in conversion of n-alkanes to alpha,omega-dioic acids catalyzed by cytochrome P450 52A3 J Biol Chem 273, 32528–32534 Benveniste I, Bronner R, Wang Y, Compagnon V, Michler P, Schreiber L, Salaun J-P, Durst F & Pinot F ă (2005) CYP94A1, a plant cytochrome P450-catalyzing fatty acid x-hydroxylase, is selectively induced by chemical stress in Vicia sativa seedlings Planta 221, 881–890 Duan H & Schuler MA (2005) Differential expression and evolution of the Arabidopsis CYP86A subfamily Plant Physiol 137, 1067–1081 Kandel S, Sauveplane V, Olry A, Diss L, Benveniste I & Pinot F (2006) Cytochrome P450-dependent fatty acids hydroxylases in plants Phytochem Rev 5, 359–372 Soliday CL & Kolattukudy PE (1978) Midchain hydroxylation of 16-hydroxypalmitic acid by the endoplasmic reticulum fraction from germinating Vicia faba Arch Biochem Biophys 188, 338–347 Salaun JP, Benveniste I, Reichhart D & Durst F (1978) ă A microsomal (cytochrome P-450) linked lauric-acidmonooxygenase from aged Jerusalem-artichoke-tuber tissues Eur J Biochem 90, 155–159 Salaun J-P, Benveniste I, Reichhart D & Durst F (1981) ă Induction and specicity of a cytochrome P450 dependent lauric acid in-chain hydroxylase from higher plant microsomes Eur J Biochem 119, 651–655 Cabello-Hurtado F, Batard Y, Salaun JP, Durst F, ă Pinot F & Werck-Reichhart D (1998) Cloning, expression in yeast, and functional characterization of CYP81B1, a plant cytochrome P450 that catalyzes inchain hydroxylation of fatty acids J Biol Chem 273, 7260–7267 Kandel S, Morant M, Benveniste I, Blee E, WerckReichhart D & Pinot F (2005) Cloning, functional expression, and characterization of CYP709C1, the first 5126 21 22 23 24 25 26 27 28 29 30 31 sub-terminal hydroxylase of long chain fatty acid in plants Induction by chemicals and methyl jasmonate J Biol Chem 280, 35881–35889 Kolattukudy PE (1981) Structure, biosynthesis and biodegradation of cutin and suberin Annu Rev Plant Physiol 32, 539–567 Soliday CL & Kolattukudy PE (1977) Biosynthesis of cutin x-Hydroxylation of fatty acids by a microsomal preparation from germinating Vicia faba Plant Physiol 59, 1116–1121 Benveniste I, Salaun JP, Simon A, Reichhart D & Durst ă F (1982) Cytochrome P450 dependent x-hydroxylation of lauric acid by microsomes from pea seedlings Plant Physiol 70, 122–126 Salaun JP, Simon A & Durst F (1986) Specic inducă tion of lauric acid x-hydroxylase by clobrate, diethylhexyl-phtalate and 2,4-dichlorophenoxyacetic acid in higher plants Lipids 21, 776–779 Pinot F, Salaun JP, Bosch H, Lesot A, Mioskowski C ă & Durst F (1992) x-Hydroxylation of Z9-octadecenoic, Z9,10-epoxystearic and 9,10-dihydroxystearic acids by microsomal cytochrome P450 systems from Vicia sativa Biochem Biophys Res Commun 184, 183– 193 Pinot F, Alayrac C, Mioskowski C, Durst F & Salaun ă JP (1994) New cytochrome P450-dependent reactions from wheat: terminal and sub-terminal hydroxylation of oleic acid by microsomes from naphtalic acid anhydride and phenobarbital induced wheat seedlings Biochem Biophys Res Commun 198, 795–803 Tijet N, Helvig C, Pinot F, Le Bouquin R, Lesot A, Durst F, Salaun JP & Benveniste I (1998) Functional ă expression in yeast and characterization of a clofibrate-inducible plant cytochrome P450 (CYP94A1) involved in cutin monomers synthesis Biochem J 332, 583–589 Pinot F, Benveniste I, Salaun JP, Loreau O, Noel JP, ă ă Schreiber L & Durst F (1999) Production in vitro by the cytochrome P450 CYP94A1 of major C18 cutin monomers and potential messengers in plant–pathogen interactions Enantioselectivity studies Biochem J 342, 27–32 Wellesen K, Durst F, Pinot F, Benveniste I, Nettesheim K, Wisman E, Steiner-Lange S, Saedler H & Yephremov A (2001) Functional analysis of the LACERATA gene of Arabidopsis provides evidence for different roles of fatty acid x-hydroxylation in development Proc Natl Acad Sci USA 98, 9694–9699 Xiao F, Goodwin SM, Xiao Y, Sun Z, Baker D, Tang X, Jenks MA & Zhou JM (2004) Arabidopsis CYP86A2 represses Pseudomonas syringae type III genes and is required for cuticle development EMBO J 23, 2903– 2913 Bonaventure G, Beisson F, Ohlrogge J & Pollard M (2004) Analysis of the aliphatic monomer composition FEBS Journal 274 (2007) 5116–5127 ª 2007 The Authors Journal compilation ª 2007 FEBS S Kandel et al 32 33 34 35 36 37 38 39 40 41 42 43 44 of polyesters associated with Arabidopsis epidermis: occurrence of octadeca-cis-6,cis-9-diene-1,18-dioate as the major component Plant J 40, 920–930 Franke R, Briesen I, Wojciechowski T, Faust A, Yephremov A, Nawrath C & Schreiber L (2005) Apoplastic polyesters in Arabidopsis surface tissues, a typical suberin and a particular cutin Phytochemistry 66, 2643– 2658 Holloway PJ (1982) The chemical constitution of plant cutins In The Plant Cuticle (Cutler DF, Alvin KL & Price CE, eds), pp 45–85 Academic Press, London Le Bouquin R, Skrabs M, Kahn R, Benveniste I, Salaun JP, Schreiber L, Durst F & Pinot F (2001) ă CYP94A5, a new cytochrome P450 from Nicotiana tabacum is able to catalyze the oxidation of fatty acids to the omega-alcohol and to the corresponding diacid Eur J Biochem 268, 3083–3090 Pompon D, Louerat B, Bronine A & Urban P (1996) Yeast expression of animals and plants P450s in optimized redox environment Methods Enzymol 272, 51–64 Omura T & Sato R (1964) The carbon monoxide binding pigment of liver microsomes Evidence for its hemoprotein nature J Biol Chem 239, 2370–2378 Benveniste I, Tijet N, Adas F, Philipps G, Salaun JP & ¨ Durst F (1998) CYP86A1 from Arabidopsis thaliana encodes a cytochrome P450-dependent fatty acid omega-hydroxylase Biochem Biophys Res Commun 243, 688–693 Okita RT & Okita JR (2001) Cytochrome P450, 4A fatty acid omega hydroxylases Curr Drug Metab 2, 265–281 Mitz MA & Heinrikson RL (1961) Omega hydroxy fatty acids deshydrogenase Biochim Biophys Acta 46, 45–50 Vamecq J, Draye JP & Brison J (1989) Rat liver metabolism of dicarboxylic acids Am J Physiol 256, G680– G688 Gerhardt B (1992) Fatty acid degradation in plants Prog Lipid Res 31, 416–417 Poirier Y, Ventre G & Caldelari D (1999) Increased flow of fatty acids toward beta-oxidation in developing seeds of Arabidopsis deficient in diacylglycerol acyltransferase activity or synthesizing medium-chain-length fatty acids Plant Physiol 121, 1359–1366 Capdevila JH, Harris RC & Falck JR (2002) Microsomal cytochrome P450 and eicosanoid metabolism Cell Mol Life Sci 59, 780–789 Forman BM, Chen J & Evans RM (1997) Hypolipidemic drugs, polyunsaturated fatty acids, and eicosanoids are CYP94C1, a dicarboxylic fatty-acid-forming enzyme 45 46 47 48 49 50 51 52 53 54 55 56 ligands for peroxisome proliferator-activated receptors alpha and delta Proc Natl Acad Sci USA 94, 4312–4317 Forest C, Franckhauser S, Glorian M, Antras-Ferry J, Robin D & Robin P (1997) Regulation of gene transcription by fatty acids, fibrates and prostaglandins: the phosphoenolpyruvate carboxykinase gene as a model Prostag Leukotr Ess 57, 47–56 Abaffy T, Matsunami H & Luetje CW (2006) Functional analysis of a mammalian odorant receptor subfamily J Neurochem 97, 1506–1518 English J, Bonner J & Haagen-Smit AJ (1939) Structure and synthesis of a plant wound hormone Science 30, 329–329 Farmer EE (1994) Fatty acid signalling in plants and their associated microorganisms Plant Mol Biol 26, 1423–1437 Stumpe M & Feussner I (2006) Formation of oxylipins by CYP74 enzymes Phytochem Rev 5, 347–357 Cho MJ, Buescher RW, Johnson M & Janes M (2004) Inactivation of pathogenic bacteria by cucumber volatiles (E,Z)-2,6-nonadienal and (E)-2-nonenal J Food Protect 67, 1014–1016 Hamilton-Kemp TR, McCracken CT Jr, Loughrin JH, Andersen RA & Hildebrand DF (1992) Effects of some natural volatiles compounds on the pathogenic fungi Alternaria alternata and Botrytis cinerea J Chem Ecol 18, 1083–1091 Matsui K, Minami A, Hornung E, Shibata H, Kishimoto K, Ahnert V, Kindl H, Kajiwara T & Feussner I (2006) Biosynthesis of fatty acid derived aldehydes is induced upon mechanical wounding and its products show fungicidal activities in cucumber Phytochemistry 67, 649–657 Nawrath C (2002) Unraveling the complex network of cuticular structure and function Curr Opin Plant Biol 9, 281–287 Kurdyukov S, Faust A, Trenkamp S, Bar S, Franke R, Efremova N, Tietjen K, Schreiber L, Saedler H & Yephremov A (2006) Genetic and biochemical evidence for involvement of HOTHEAD in the biosynthesis of long-chain alpha-omega-dicarboxylic fatty acids and formation of extracellular matrix Planta 224, 315–329 Nelson DR (2006) Plant cytochrome P450s from moss to poplars Phytochem Rev 5, 193–204 Livak KJ & Schmittgen TD (2001) Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C (T) method Methods 25, 402– 408 FEBS Journal 274 (2007) 5116–5127 ª 2007 The Authors Journal compilation ª 2007 FEBS 5127 ... thaliana Total RNAs were extracted from g of Arabidopsis plants RNAs (8 lg) were subjected to RNA blot analysis 28S and 18S ribosomal RNA from A thaliana was used as an internal standard Lane C (control),... speculate that CYP94C1 could play a role in fatty acid catabolism and that its regulation occurs via a mechanism similar to that regulating x-hydroxylases participating in fatty acid degradation... primer’s pair SK77 (5¢-TTCAATGT CCCTGCCATGTATG-3¢) and SK78 (5¢-AATACCGGTT GTACGACCAC-3¢) Enzyme activities All radiolabeled substrates were dissolved in ethanol that was evaporated before the addition