Báo cáo khoa học: A fatty-acid-metabolizing enzyme fromArabidopsis potx

Báo cáo khoa học: "A Flexible Lexicon Design" potx

Báo cáo khoa học: "A Flexible Lexicon Design" potx

... natural language processing that use a phrasal lexicon have the advantage of easily handling linguistic constructions that might otherwise be ex- tragrammatical. However, current phrasal lexicons ... al., 1984]. Incorporating phrasal knowledge into such a hierarchy was suggested in some AI work [Wilensky and Arena, 198 0a] , but the actual implementation of a hier- 186 archical...

Ngày tải lên: 24/03/2014, 02:20

7 299 0
Báo cáo khoa học: A fatty-acid-metabolizing enzyme fromArabidopsis potx

Báo cáo khoa học: A fatty-acid-metabolizing enzyme fromArabidopsis potx

... and methyl jasmonate treated A. thaliana. Total RNAs were extracted from 2 g of Arabidopsis plants. RNAs (8 lg) were subjected to RNA blot analysis. 28S and 18S ribosomal RNA from A. thaliana was ... regulation occurs via a mechanism similar to that regulating x-hydroxy- lases participating in fatty acid degradation in mammals. Arachidonic acid (C20:4) is a major fatty acid in animals....

Ngày tải lên: 30/03/2014, 03:20

12 115 0
Tài liệu Báo cáo khoa học: a-Methylacyl-CoA racemase – an ‘obscure’ metabolic enzyme takes centre stage pptx

Tài liệu Báo cáo khoa học: a-Methylacyl-CoA racemase – an ‘obscure’ metabolic enzyme takes centre stage pptx

... adenomatous hyperplasia of the prostate. Am J Surg Pathol 26, 921– 925. 68 Ashida S, Nakagawa H, Katagiri T, Furihata M, Iiiz- umi M, Anazawa Y, Tsunoda T, Takata R, Kasahara K, Miki T et al. (2004) ... preventative and treatment strategies for cancer. Abbreviations ACOX, acyl-CoA oxidase; AMACR, a- methylacyl-CoA racemase; CYP, cytochome P450; FALDH, fatty aldehyde dehydrogenase; FAR and MC...

Ngày tải lên: 18/02/2014, 17:20

14 633 0
Tài liệu Báo cáo khoa học: A novel coupled enzyme assay reveals an enzyme responsible for the deamination of a chemically unstable intermediate in the metabolic pathway of 4-amino-3-hydroxybenzoic acid inBordetellasp. strain 10d doc

Tài liệu Báo cáo khoa học: A novel coupled enzyme assay reveals an enzyme responsible for the deamination of a chemically unstable intermediate in the metabolic pathway of 4-amino-3-hydroxybenzoic acid inBordetellasp. strain 10d doc

... only as a carbon source, but also as a nitrogen source for g rowth of the assimilating bacteria. Deaminases, which catalyze the release of ammonia, are a key enzyme in the metabolic pathways of ... (Osaka, Japan); meat extract (Extract Ehlrich) w as from Kyokuto Seiyaku Kogyo (Osaka, Japan); and pentafluorophenylhydrazine was from Pfaltz & Bauer. (Waterbury, CT, USA). DE52 cellulos...

Ngày tải lên: 19/02/2014, 16:20

7 613 1
Báo cáo khoa học: A novel metallocarboxypeptidase-like enzyme from the marine annelid Sabellastarte magnifica – a step into the invertebrate world of proteases pdf

Báo cáo khoa học: A novel metallocarboxypeptidase-like enzyme from the marine annelid Sabellastarte magnifica – a step into the invertebrate world of proteases pdf

... Molgula occidentalis and Pyura vittata); 11 species of Cnidaria (Bartholo- mea annulata, Budonosoma granulifera, Cassiopea xamachana, Condylactys gigantea, Gorgonia ventalina, Lebrunia danae, Palythoa ... different variants Fig. 1. S. magnifica Phylum Annelida, Class Polychaeta, Subclass Palpata, Order Canalipalpata, Suborder Sabellida, Family Sabellidae, Genus Sabellastarte [14] The ‘tentacle...

Ngày tải lên: 07/03/2014, 02:20

16 628 0
Báo cáo khoa học: A characteristic Glu17 residue of pig carnitine palmitoyltransferase 1 is responsible for the low Km for carnitine and the low sensitivity to malonyl-CoA inhibition of the enzyme docx

Báo cáo khoa học: A characteristic Glu17 residue of pig carnitine palmitoyltransferase 1 is responsible for the low Km for carnitine and the low sensitivity to malonyl-CoA inhibition of the enzyme docx

... pGEMT–5¢HumanCPT1B as a template in a PCR reaction with primers DH673 (5¢-AGCTGAATTC ATGGCGGAAGCTCACCAG-3¢) and DH803 (5¢-TCCA CCCATGGTAGCAGAGAAGCAGCTT AAGGGTTTGG CGGA-3¢). The PCR reaction yielded a ... (5¢-GGAGTTGCTGGCC AAAGA GTTCCAGGACAAGACTGCCC-3¢) and DH870 J. Relat et al. D17E as a malonyl-CoA sensitivity determinant of CPT1B FEBS Journal 276 (2009) 210–218 ª 2008 The Authors Jo...

Ngày tải lên: 16/03/2014, 04:20

9 551 0
Báo cáo khoa học: A mitochondrial cytochrome b mutation causing severe respiratory chain enzyme deficiency in humans and yeast doc

Báo cáo khoa học: A mitochondrial cytochrome b mutation causing severe respiratory chain enzyme deficiency in humans and yeast doc

... MwoI, separated through a 12% nondenaturing poly- acrylamide gel, and the radioactivity in each fragment quantified using imagequant software (Molecular Dynam- ics, Amersham Biosciences, Chalfont ... biochemical defect; point mutations in mitochondrial tRNA genes and large-scale mtDNA rearrangements cause multiple respiratory chain abnor- malities through impairment of mitochondrial trans- l...

Ngày tải lên: 16/03/2014, 22:20

10 317 0
Báo cáo khoa học: A single mutation in Escherichia coli ribonuclease II inactivates the enzyme without affecting RNA binding pot

Báo cáo khoa học: A single mutation in Escherichia coli ribonuclease II inactivates the enzyme without affecting RNA binding pot

... the enzyme without affecting RNA binding Mo ´ nica Amblar and Cecı ´lia M. Arraiano Instituto de Tecnologia Quı ´ mica e Biolo ´ gica ⁄ Universidade Nova de Lisboa, Oeiras, Portugal The balance ... Escherichia coli: implications for mRNA decay and cell metabolism. Mol Microbiol 20, 1033–1042. 29 Cairra ˜ o F, Chora A, Zilha ˜ o R, Carpousis J & Arraiano CM (2001) RNase II levels change...

Ngày tải lên: 30/03/2014, 15:20

12 320 0
Tài liệu Báo cáo khoa học: A DExD⁄ H box RNA helicase is important for K+ deprivation responses and tolerance in Arabidopsis thaliana docx

Tài liệu Báo cáo khoa học: A DExD⁄ H box RNA helicase is important for K+ deprivation responses and tolerance in Arabidopsis thaliana docx

... information for the functional analysis of plant DEVH box RNA helicases, and suggest that AtHELPS, as an impor- tant negative regulator, plays a role in K + deprivation stress. Abbreviations ABA, abscisic ... a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J 16, 735–743. 60 Jefferson RA, Kavanagh TA & Bevan MW (1987) GUS fusions: beta-glucur...

Ngày tải lên: 14/02/2014, 18:20

11 786 0
Tài liệu Báo cáo khoa học: a-enolase: a promising therapeutic and diagnostic tumor target ppt

Tài liệu Báo cáo khoa học: a-enolase: a promising therapeutic and diagnostic tumor target ppt

... (IMMONC), Ricerca Sanitaria Finalizzata, Ricerca Sanitaria Applicata; Ribovax Biotechnologies (Geneva, Switzerland) and Fondazione Italiana Ricerca sul Cancro (FIRC). References 1 Pancholi V (2001) ... G, Giallongo A, Milella M et al. (2009) An integrated humoral and cellular response is elicited in pancreatic cancer by alpha-enolase, a novel pancreatic ductal adenocarcinoma-associated ant...

Ngày tải lên: 14/02/2014, 19:20

11 722 0
Từ khóa:
w