Báo cáo khoa học: Genomic structure, promoter analysis and functional mutation pptx

Human aquaporin adipose (AQPap) gene Genomic structure, promoter analysis and functional mutation Hidehiko Kondo 1 , Iichiro Shimomura 1 , Ken Kishida 1 , Hiroshi Kuriyama 1 , Yasunaka Makino 2 , Hitoshi Nishizawa 1 , Morihiro Matsuda 1 , Norikazu Maeda 1 , Hiroyuki Nagaretani 1 , Shinji Kihara 1 , Yoshihisa Kurachi 2 , Tadashi Nakamura 1 , Tohru Funahashi 1 and Yuji Matsuzawa 1 1 Department of Internal Medicine and Molecular Science, Graduate School of Medicine, Department of Pharmacology II, and 2 Graduate School of Medicine, Osaka University, Yamadaoka, Suita, Japan Aquaporin adipose ( AQPap), which we identified from human adipose t issue, is a glycerol channel in adipocyte [Kishida et al. (2000) J. Biol. Chem. 275, 20896–20902]. In the c urrent study, we determined the genomic structure of the human AQPap gene, and identified three AQPap-like genes that resembled ( 95%) AQPap, with little expression in human tissues. The AQPap promoter contained a puta- tive peroxisome proliferator response element (PPRE) at )46 to )62, and a putative insulin response element (IRE) a t )542/)536. Deletion of the PPRE abolished the pioglita- zone-mediated induction of AQPap promoter activity in 3T3-L1 adipocytes. Deletion and single base pair substitu- tion analysis of the I RE abolished the insulin-m ediated suppression of the human AQPap gene. Analysis of AQPap sequence i n human subjects revealed three missense muta- tions (R12C, V59L and G264V), and two silent mutations (A103A and G250G). The cRNA injection of the missense mutants into Xenopus oocytes revealed the a bsence of the activity to transport glycerol and water in the AQPap- G264V protein. In the subject homozygous for AQPap- G264V, exercise-induced increase in plasma glycerol was not observed in spite of the increased plasma noradrenaline. We suggest that A QPap is responsible for the increase of plasma glycerol during exercise in humans. Keywords: mutation; aquaporin adipose; genome; glycerol channel; promoter. In response to energy demand in fasting and exercise, triglyceride stored in adipocytes is hydrolyzed to glycer ol and free fatty acid (FFA) by hormone-sensitive lipase, and both products are promptly released into the blood stream. M any studies have demonstrated that the transport of FFA is facilitated by several membrane proteins, such as fatty a cid transport p rotein (FATP) [1,2], plasma membrane fatty acid- binding proteins [3], and fatty acid translocase [1,4]. On the other hand, the molecular mechanism underlying glycerol transport across the cell membrane has not been well characterized. R ecently, from human adipose tissue, we cloned and identified a dipose-specific glycerol channel,which belonged to the aquaporin (AQP) family [5]. Therefore, we designated this molecu le as aquaporin adipose (AQPap). To date, 11 kinds of AQP have been identified and cloned from various mammalian tissues [5–17]. The members of t he AQP family can be classified i nto two subgroups: aquapo- rins that are selective water channels, and aquaglyceropo- rins that transport glycerol as well as water. Functional studies demonstrated that AQPap facilitated glycerol transport in Xenopus oocytes injected with its c RNA [5]. Thus, AQPap belongs to aquaglyceroporin together with AQP3andAQP9,whichareexpressedinthekidneyand liver, respectively [9,16]. It has b een shown that plasma glycerol accounts for around 90% substrates for hepatic gluconeogenesis at fasted condition in rodents [18]. Adipose t issue is the major source of plasma glycerol. We showed that AQPap mRNA levels increased after fasting and d ecreased with refeeding, in the white adipose tissue o f mice [19]. Insulin deficiency generated by streptozotocin enhanced the mRNA levels in adipose tissue. These changes of AQPap mRNA level were mediated through the heptanucleotide designated negative insulin response element (IRE) in the promoter of mouse AQPap gene [20]. The concentrations of plasma glycerol increased with the augmented function of AQPap in f asting and insulin deficient condition [19]. On the other hand, in the severe insulin resistant states of db/db mice, the mRNA expression levels of adipose AQPap were increased in spite of hyperinsu linemia, resulting in the higher concentrations of plasma glycerol and hepatic glucose production [19]. However, physi ological regulation and significance of AQPap in human has not been characterized. Correspondence to I. Shimomura, Department of Internal Medicine and Molecular Science, Graduate School of Medicine, Osaka University, 2-2 Yamadaoka, Suita, 565-0871, Japan. Fax: + 81 6 6879 3739, Tel.: + 81 6 6879 3732, E-mail: ichi@imed2.med.osaka-u.ac.jp Abbreviations: AQP, aquaporin; AQPap, aquaporin adipose; DMEM, Dulbecco’s modified Eagle’s medium; PPRE, peroxisome proliferator-activated receptor response element ; IRE, insulin response element; FFA, f ree fatty acid; FATP, fatty acid transport protein; PGZ, pioglitazone; BAC, bacterial artificial chr omosome; RH mapping, radiation-hybrid mapping; BMI, body mass index; PPAR, peroxisome proliferator-activated receptor; RXR, retinoid X receptor; PEPCK, phosphoenolpyruvate carboxykinase; IGFBP-1, insulin-like growth factor-binding protein-1; G6Pase, glucose-6- phosphatase; IRS-2, insulin receptor substrate-2. (Received 19 November 2001, revised 29 January 2002, accepted 4 February 2002) Eur. J. Biochem. 269, 1814–1826 (2002) Ó FEBS 2002 doi:10.1046/j.1432-1033.2002.02821.x In the current study, we determined the genomic structure of the human AQPap gene, analyzed the promoter region, searched the genetic mutation in human subjects and identified the nonfunctional genetic mutation of AQPap gene which caused the lack of increase in plasma glycerol by endurance exercise. MATERIALS AND METHODS Materials Total RNA prepared from hu man testis, heart, brain, lung, liver, kidney, spleen, and skeletal muscle RNAs were obtained from Clontech (Palo Alto, CA, USA). Bovine pancreatic insulin was purchased from Sigma (St Louis, MO, USA). Pioglitazone (PGZ) was generously given by Takeda Chemicals (Osaka, Japan). Human abdominal subcutaneous and mesenteric fat tissues were obtained from the subjects (age 35–53 years) after an overnight fast. Written informed consent was obtained from all subjects before their enrollment in the study. Isolation of the human AQPap gene Two bacterial artificial chromosome (BAC) clones (BAC- 33-J3 and BAC-6-J7) were isolated by screening the human BAC DNA library (Genomic Systems, Inc. St Louis, MO, USA) using a human AQPap cDNA fragment including (position 172–1120 in [5]) as a probe. Double-stranded sequencing of the BAC clones was performed using the DYEnamic ET termination cycle sequencing kit (Amersham, Piscataway, NJ, USA) and sequence primers synthesized on the basis o f the published cDNA sequen ce of human AQPap [5]. Genomic structure of the clones was determined by primer walking. All exons and exon–intron boundaries were sequenced. Intron sequences, except f or introns 2 a nd 3, were also determined. Nucleotide sequences were analyzed and assembled using MACDNASIS PRO (Hitachi Software Engineering Co., Kanag- awa, Japan). The nucleotide sequence o f the AQPap cloned in BAC-33-J3 has been deposited in DDBJ under accession numbers AB052624, AB052625, and AB052626. T he sequence of the wAQPap-1 cloned in BAC-6-J7 has been deposited under accession numbers AB052627, AB052628, AB052629, and AB052630. The sizes of introns 2 and 3 w ere determined by PCR amplification. Southern blot analysis Southern blot analysis on human genomic DNA was performed by standard procedures [21]. The blot was hybridized to 784 bp of AQPap genomic probe (1 · 10 6 c.p.m. Æ mL )1 ) containing the region from exon 4 to the proximal part of exon 7. This probe was prepared by PCR amplification of the AQPap gene cloned in BAC-6-J7 using the following primers; 5¢-ATCTCTGGAGCCCA CATGAA-3¢ and 5¢-GACCACGAGGATGCCTATCA-3¢. RT-PCR analysis of AQPap and AQPap-like genes The first strand cDNA was synthesized by reverse tran- scriptase from the equal amount of total RNA (200 ng) prepared from various human tissues using oligo d(T) 12)16 primer. U sing this cDNA as a template, RT-PCR was carried out using the following primers. AQPap: 5¢-CAAA GATCCAGGAAATACTGC-3¢,and5¢-CCCAGCGCAC AGTTAGCA-3¢; AQPap-like; 5¢-AAATATGGTGCGAG GAAGATG-3¢,and5¢-CCCAGCGCACAGTTAGTG-3. PCR condition was a s fo llows: denaturation 94 °Cfor 1 min; annealing a t 60 °C for 2 min; and extension at 72 °C for 1.5 min. After 20–30 cycles of PCR, amplified DNAs were separated by a garose gel e lectrophoresis, and analyzed with a digital fluorodensitometer (FM-BIO100, Hitachi Software Engineering Co., Kanagawa, Japan) after ethidi- um bromide staining. RNA samples were tested for integrity by RT-PCR u sing b-actin primers ( 5¢-TGACAGGATG CAGAAGGAGAT-3¢ and 5¢-CTCCTGCTTGCTGATC CACAT-3¢). Radiation-hybrid mapping (RH Mapping) The chromosomal mapping of the AQPap gene was performed using the Gene Bridge 4 Radiation Hybrid p anel (Research Gen etics) according to the manufacturer’s instructions, using specific primers designed to amplify the 359-nucleotide sequence containing exon 3 and intron 3 o f AQPap gene. Primers used were: 5 ¢-CAAAGATCCA GGAAATACTGC-3¢ and 5¢-GCCTCTTCAATCTCTT TATC-3¢. Results were analyzed on the w eb site at http:// www-genome.wi.mit.edu/cgi-bin/contig/rhmapper. 5¢ RACE 5¢ RACE was performed using the 5¢ RACE System for Rapid Amplification of cDNA Ends, Version 2.0 (Life Technologies, Gaithersburg, MD, USA) according to the manufacturer’s instructions. Total RNA was prepared from human mesenteric fat by the standard acid guanidium phenol/chloroform method [22]. First strand cDNA was synthesized from the total RNA using AQPap-specific primer, 5¢-CCCAGCGCACAGTTAGCA-3¢. T he cDNA was tailed with terminal deoxynucleotidyl transferase and dCTP, and amplified by PCR using the 5¢ RACE Abridged Anchor Primer and nested primer, 5¢-CCCAAGTTGA CACCAAGGTA-3¢. P CR products were cloned into pGEM-T easy (Promega) and the nucleotide s equences were analyzed. Luciferase assay The human AQPap promoter regions ()681/+11 or )681/ +147) were amplified from the AQPap genomic clone using a MluI site-added 5 ¢ primer and XhoI site-added 3¢ primers. The human AQPap promoter–luciferase reporter plasmids were constructed by excising the amplified promoter fragment of AQPap and inserting it into the MluIand XhoI site of the control pGL3 basic luciferase expression vector (Promega). Partial deletion mutants o f p GL3- AQPap luciferase p lasmid were constructed u sing the QuickChange Site-Directed Mutagenesis kit. The peroxi- some proliferator response e lement (PPRE)-deleted con- struct was designed to lack the PPRE consensus region ()46/)62) from the w ild-type construct ()681/+11). IRE- deleted constructs were designed to lack the e ach IRE region ()629/)623, )542/)536, or )121/)115) from the wild-type construct ()681/+147). The plasmids for transfection were Ó FEBS 2002 Genetic analysis of human AQPap gene (Eur. J. Biochem. 269) 1815 purified using t he Endofree TM Plasmid kit (Qiagen, Valen- cia, CA, U SA). PCR-generated f ragments of full-length PPARc2 and AF-2-deleted mutant DPPARc were sub- cloned into t he XhoI site of the pcDNA3.1 expression vector (Invitrogen, Groningen, the Netherlands). The pcDNA3.1- PPARc expression vector was a generous gift from D. Mangelsdorf (University of Texas South-western Med- ical Center, Dallas, Texas, USA). The DPPARc mutant construct lacks 11 amino acids (PLLQEIYKDLY) in the activation function-2 (AF-2) d omain, at its C-terminus. 3T3-L1 preadipocytes were grown to confluence and then induced to differentiate i nto adipocytes according to the modified method of Rubin et al. [23]. Briefly, 3T3-L1 cells were grown o n a 12-well plate in Dulb ecco’s modified Eagle’s medium (DMEM) supplemented with 10% fetal bovine serum. The cells were grown to confluence a nd were differentiated by incubation in DMEM with 1 0% fetal bovine serum containing 0.5 m M 1-methyl-3-isobutyl- xanthine, 1 l M dexamethazone, a nd 5 lgÆmL )1 insulin for 48 h. The differentiated cells were maintained in DMEM with 10% f etal bovine serum until their use in the transfection experiments. For each 12-well culture plate, 1 lgoffirefly(Photinus pyralis) l uciferase plasmid co n- structed from pGL3-basic luciferase expression vector and 10 ng of a sea pansy (Re nilla reniformis)luciferasepRL- SV40 plasmid (Promega, Wisconsin, USA) were complexed with LipofectAMINE TM 2000 (Life Technologies, Tokyo, Japan) following the manufacturer’s protocol and then used for transfection. For analysis of the regulation by pioglit- azone (PGZ), an equal volume of DMEM containing 20% fetal bovine s erum and 20 l M PGZwasadded4hafter transfection, and the cells were maintained for an additional 44-h period. For analysis of the regulation by insulin, an equal volume of DMEM containing 20% fetal bovine serum was added 4 h a fter transfection. The transfection mixture was removed 24 h after t ransfection and the cells were maintained in DMEM containing 0.5% fatty acid f ree BSA and 1 l M insulin. The cells were harvested with passive lysis buffer (Promega). Luciferase activities were measured with the Dual L uciferase Reporter Assay System (Promega) according to the manufacturer’s protocol. Gel electromobility shift assays PCR-generated fragments of full-length RXRa was sub- cloned into t he XhoI site of the pcDNA3.1 expression vector (Invitrogen). cDNAs for PPARc2, RXRa and DPPARc were transcribed and translated in vitro from the plasmids pPPARc2, pRXRa and pDPPARc,usingtheTNTÒ Quick Coupled Transcription/Translation S ystems (Promega). The translation products were verified by SDS/PAGE. A double-stranded o ligonucleotide, PPREwt, spanning nucleotides )67 t o )33 of the human AQPap upstream sequence w ere 32 P-radiolabeled with polynucleotide kinase (Promega). A 15-lL reaction solution containing endlabeled PPRE oligonucleotide probe (2 · 10 5 c.p.m.) and 1 lLof in vitro translation reaction was incubated for 20 min at 25 °Cand15 minat4 °C in a buffer containing 20 m M N-2- hydroxyethylpiperazine-N¢-2-ethanesulfonic acid (pH 8.0), 60 m M KCl, 1 m M dithiothreitol, 10% glycerol, and 1 lg poly (dI-dC). The DNA–protein complexes were resolved from the free probe by electrophoresis on a 4% polyacryla- mide gel in 0.5 · Tris/borate/EDTA buffer (1 · Tris/ borate/EDTA contains 9 m M Tris, 90 m M boric acid, 20 m M EDTA). The gels were dried and autoradiographed at )80 °C. Double-stranded oligonucleotides composed of the following sequences were used for binding and compe- tition analysis. PPREwt, 5¢-GCTGCTCCTGCTC CTC CAGGGGAGAGGTCAGTAAG-3¢;PPREmut,5¢-GC TGCTCCTGCTC CTCCAGGGGtGtcGTCAGTAAG-3¢. PPRE sequence is underlined. The mutated b ases are shown in lowercase letters. Mutation analysis of the gene for AQPap We searched for the mutation of the AQPap gene in 160 unrelated adult Japanese subjects (84 men, average age (± SD) 57 ± 13 years old, and 76 women, average age (± SD) 60 ± 15 years old; BMI 25.1 ± 6.1 kg Æm )2 ). Sixty-four of the subjects (34 men and 30 women ) were patients of noninsulin-dependent diabetes mellitus with a BMI of less than 30 kgÆm )2 . Sixteen (seven men a nd nine women) were no ndiabetic obese subjects with a BMI g reater than 30 kg Æm )2 . Nine ( five male a nd four female) were diabetic obese subjects. The remaining 71 (38 male and 33 female) were nondiabetic and nonobese subjects. W e isolated the genomic DNA of the subjects from peripheral blood leukocytes. Written informed consent was obtained from all subjects before their enrolment in the study. The entire open reading frame of the AQPap gene (exons 2–8) was amplified as three fragments by PCR using specific primer sets. Amplification of exon 2 was performed using primers designed on t he basis of the flanking intron sequences (5¢-CAAGGTCTGATGGAAGTGTG-3¢ and 5¢-GCCAGAAAGCTAACAAGGCT-3¢). Exon 3 was amplified using primers consisting of the flanking intron sequences (5¢-C TCTCAAGTGTCTCCAATTCCA-3¢ and 5¢-GCCTCTTCA ATCTCTTTATC-3¢). Exons 4–8 were amplified as a single DNA fragment using the following primers: 5¢-CTCAGGTCTGAGAGGCCTCAGCA-3¢ derived from intron 3, and 5¢-TCGGACAAGCCTTGCT TTATTG-3¢ derived from the 3¢ untranslat ed region. The amplification conditions consisted of an initial denaturation step of 94 °C for 2 min, followed by 30–35 cycles of 94 °C for 1 min, 60 °Cfor2min,72°C for 1.5 m in. The PCR products were directly sequenced on an ABI377 automatic sequencer. Oligonucleotides used for sequencing are sum- marized in Table 1. Functional analysis of human AQPap A plasmid p SP/AQPap, in which human AQPap cDNA was inserted into t he BamHI and HindIII sites of the pSP poly(A) vector (Promega) [5], was used as a template for site-directed mutagenesis. Mutagenesis was performed using QuickChange Site-Directed Mutagenesis Kit (Promega) and mutagenic oligonucleotides. In vitro transcription of cRNA from the plasmids encoding AQPap and AQPap mutants, and injection of the resulting cRNA into Xenopus oocytes were performed a s previously described [5]. Oocytes were injected with 10 ng of AQPap cRNA (0.5 lgÆlL )1 ) and incubated in Barth’s buffer at 18 °C. After 48 h of incubation, osmotic water permeability and uptake of glycerol was measured. For measurement of the uptake of glycerol, groups of five to eight o ocytes were incubated in modified Barth’s buffer 1816 H. Kondo et al. (Eur. J. Biochem. 269) Ó FEBS 2002 (96 m M NaCl, 2 m M KCl, 1.8 m M CaCl 2 ,1m M MgCl 2 , 25 lgÆmL )1 gentamycin, 5 m M Hepes, pH 7.4) containing 2 lCiÆmL )1 of [U- 14 C]glycerol (Amersham; nonradioactive glycerol was a dded to give a 1 m M final concentration) at room temperature. After 20 min of incubation, oocytes were rapidly rinsed five times in i ce-cold Barth’s buffer. Th e oocytes were lysed in 400 lL of 5% SDS overnight, and the radioactivity was measured by liquid scintillation counting. For measurement of osmotic water permeability, th e oocytes were transferred from 200 to 20 mOsm modified Barth’s buffer, and the swelling was monitored w ith a Nikon phase-contrast microscope equipped for videore- cording. The oocyte volume was calculated from the recorded images with a microcomputer-imaging device (MCID-M2, Imaging Research Inc., Ontario, Canada). Osmotic water permeability (P f ,cmÆs )1 ) was calculated from the initial rates o f s welling, d( V/V 0 )/dt, oocyte surface- to-volume ratio (S/V 0 ¼ 50 cm )1 ) and partial molar vol- ume of water (V w ¼ 18 cm 3 Æmol )1 ) from the relation, P f ¼ (d(V/V 0 )/dt)/((S/V 0 )V w /(osm in ) osm out )) [24], where osm in ) osm out ¼ 180 mO sm. Immunoblotting For the isolation of total membranes, eight oocytes were homogenized in 160 lL of a homogenization buffer ( 20 m M Tris/HCl (pH 7 .4), 5 m M MgCl 2 ,5m M NaH 2 PO 4 ,80m M sucrose, 1 m M EDTA, 1 m M dithiothreitol, 1 m M phenyl- methanesulfonyl fluoride, and 5 lgÆmL )1 leupeptin and pepstatin), and centrifuged twice for 5 m in at 200 g at 4 °C. Next, the membranes were isolated by 20 min centrifuga- tion at 4 °C for 14 000 g, and resuspended in 15 lLof Laemmli buffer. The membrane proteins were denatured at 37 °C f or 30 min, electrophoresed through a 12.5% SDS/ polyacrylamide gel, and transferred to a nitrocellulose membrane (Schleicher & Shuell, Dassel, Germany). For immunodetection, the membrane was incubated with a 1 : 500 d ilution of rabbit polyclonal anti-(human AQPap) Ig (Chemicon International, Inc., Temecula, CA, USA). As a secondary antibody, a 1 : 1000 dilution of affinity-purified anti-(rabbit IgG) Ig conjugated to horseradish peroxidase (Amersham) was used. Proteins were visualized using enhanced chemiluminescence (Ame rsham). Exercise experiment One AQPap-G264V homozygous subject and two AQPap wild-type subjects gave their informed consent in accord- ance with the procedures approved by the Ethics Commit- tees of Osaka University. To determine the maximum oxygen consumption ( _ VV O2 max), each subject first underwent a test on an electrical braked cycle e rgometer, using a c ontinuous incremental workload test to the stage of volitional e xhaustion. Resist- ance was inc reased by 35 WÆmin )1 until exhaustion. Oxygen consumption ( _ VV O2 ) was acquired and recorded at 10-s intervals. The average _ VV O2 max (±SE) was 33.9 ± 1.7 (mL O 2 Ækg )1 Æmin )1 ). The exercise experiments were performed using a cycle ergometer after a 20-h fast. When the subjects had rested for 15 min on the cycle ergometer, they exercised for 30 m in at 50% of their _ VV O2 max. Venus blood was drawn at various times for the determination of plasma glycerol and noradrenaline. Plasma glycerol was measured by a fluorometric/colori- metric enzyme method [25]. C oncentration of plasma noradrenaline was determined by HPLC. RESULTS Genomic structure of human AQPap gene Two positive BAC clones (BAC-33-J3 and BAC-6-J7) were isolated by screening of the human BAC DNA library using full-length human AQPap cDNA as a probe. Primer walking and direct sequencing of the clone B AC-33-J3 revealed that it contained the entire coding sequence of AQPap gene. The nucleotide sequences of the exon/intron boundaries and the size of the exons and introns are shown in Fig. 1B. The human AQPap gene contained eight exons within 18 kb of genomic DNA with large second and third introns (Fig. 1A). All of the exon–intron boundaries were consistent with the GT/AG rule (Fig. 1B). The putative translation initiation codon was located in exon 2. Presence of multiple AQPap-like genes in human genome DNA sequencing of another BAC clone, BAC-6-J7, revealed that it contained the pseudogene designated wAQPap-1 which had high ( 95%) homology of its nucleotide sequence with AQPap (Fig. 2A). The genomic organization o f t he wAQPap-1 gene was very similar t o that of the genuine AQPap (Fig. 2A), and the exon–intron boundaries were completely consistent with the GT/AG rule. T he wAQPap-1 gene contained a termination codon in exon 3, and an insertion of single nucleotide in exon 7 resulting in a frame shift of the coding region. BLAST search analysis detected two BAC clones (RP11- 251017 and RP11–15E1) containing DNA sequences resembling the AQPap gene, which we designated wAQPap-2 and wAQPap-3, respectively (Fig. 2A). Both wAQPap-2 and -3 genes had  95% nucleotide sequence similarity with AQPap. The wAQ Pap-3 gene had  99% Table 1. Nucleotide sequences of th e sequencing primers used for mutation analysis. The entire open reading frame (exons 2 to 8) was amplified as three fragments by P CR as described in Mate rials and methods section. Both strands of the PCR products containing each exon were sequ en ced using the forward or reverse sequ encing p rimer. Exon Direction Sequence (5¢ to 3¢) 2 Forward CCCAAGTTCTGTGTCCTCCA Reverse CTGAGTGCAGTTGAGTTGAAG 3 Forward ACTCAGCTGGGAGTTGAAGAG Reverse CCAGTGCATGGTTTCATTTGAC 4 Forward GAGGAGCTAGAACTGAGCTCTGA Reverse TTGGGGACACCTGGTCTTG 5 Forward TTGTTTGTTCTGCTCTCACTC Reverse ACACTGAGGTCCAATCTGCCCAT 6 Forward TAACCTCATTTCTGGGACCCCGGT Reverse TGCTGGCTCCGTCCTGAGGG 7 Forward CCGAGGTCCTGTGGCTTGGG Reverse TGTGCTGCCCCTCACATCACC 8 Forward GGATGACTCCTCTGCTCAAC Reverse GATGGGATCACAAATAATCTCTG Ó FEBS 2002 Genetic analysis of human AQPap gene (Eur. J. Biochem. 269) 1817 homology with the wAQPap-1 gene, but had no frame shift mutation, unlike wAQPap-1. wAQPap-2 gene s howed high homology ( 98%) with the wAQPap-1 and -3 genes. We grouped together the sets of genes similar to AQPap, including wAQPap-1, -2 and -3, as AQPap-like genes. Figure 2B shows genomic Southern blotting using BamHI digested DNA and radiolabeled probe. The 0.8-kb probe fragment of genomic DNA was obtained from AQPap gene, and the probe region had  96% seq uence identity to wAQPap-1, -2 and -3. From t h e b lot, AQPapand wAQ Pap-2 genes appeared to exist a s a single copy gene. BamHI digestion was expected to produce a 7.7-kb band for wAQPap-1 and wAQPap-3, 5.6-kb signal for wAQPap-2, and 3.5-kb signal for AQPap, respectively. The signal intensity of the 7.7-kb band was around threefold greater than that of the 3.5-kb band for the AQPap gene in spite of the lower affinity of the probe, suggesting that the 7.7-kb band represents two or more AQPap-like genes including wAQPap-1 and -3 (Fig. 2 B). Indeed, the amplification of exon 7 using the specific primers for wAQPap-1 and -3 and the following direct sequencing revealed that the human genome contained gene(s) with frame-shift muta- tion (i.e. wAQPap-1) a nd gene(s) without the mutation (i.e. wAQPap-3) (data not shown). Figure 2C estimated by RT-PCR using specific primers the mRNA amounts of the AQPap and AQPap-like genes in various tissues. The signal for the AQPap transcript was detected most abundantly in white fat, in w hich the transcript signal emerged after 20 cycles of RT-PCR (Fig. 2 C, upper panel). Twenty-five cycles of PCR also detected trace amounts of the transcript in the testis, heart, and kidney. On the other hand, when the primers completely conserved in the wAQPap-1, -2 and -3 g enes were used, no PCR products were detected in any of the examined tissues by 25 cycles of PCR. Taken togeth er, the expression of AQPap-like genes was, if any, extremely low, strongly suggesting these three AQPap-like genes to be nonfunctional pseudogenes of the genuine AQPap. Chromosome localization of the AQPap gene Because of the presence of the multiple homologous genes of AQPap in the human genome, it was suspected that the genuine AQPap gene might be localized to the other chromosome region different from the region determined using fluorescent in situ hybridization (FISH) method [26]. Therefore, RH mapping using the AQPap-specific primer set was performed. The mapping revealed that AQPap gene was localized to the marker D 9S165 with 0.0 cR (LOD > 15) RH distance (Table 2). D9S165 has been mapped between the markers D9S1788 and WI-5340, both of which reside in chromosome 9p13.3-p21.1 in the Fig. 1. Genomic structure of the human AQPap gene. (A) G enomic structure of the human AQPap gene was organized. S izes of intron-2 and -3 were d etermined by P CR amplification using primers to the flanking region. Eight exons are represented by boxes and numbered; solid area s indicate coding regions. (B) Intron numbers and sizes in base pairs are sho wn. Bou nd ary exon sequences are capitalized. Intron sequences are shown in lowercase l etters. The dotted line indicates the intervening intron sequences. Fig. 2. Multiple AQPap-like genes. (A) Restriction map of AQPap (AL353675), wAQPap-1 (AB052627), wAQPap-2 (AL137070), a nd wAQPap-3 genes (AL136317). Exons are represented by solid boxes and are numbered. The BamHI restriction enzyme sites are indicated by a capital B . The closed box repre sents the region of the probe used for the So uthern blot analysis. (B ) Human genomic D NA (10 lg) was completely digested with BamHI and t hen subjected to Southern blot analysis using 32 P-radiolabeled genomic probe as d escribed in the Materials and methods. (C) Tissue distribution o f mRNAs fo r AQPap and AQPap-like genes. Total RNAs from indicated human tissues were subjected to RT-PCR analysis using primers specific for AQPap and AQPap-like, respectively, a s described in the Materials and methods. 1818 H. Kondo et al. (Eur. J. Biochem. 269) Ó FEBS 2002 Whitehead Y AC map. Thus the AQPap gene was assigned to chromosome 9p13.3-p21.1, close, but not identical, to the region described previously [26]. Computer analysis re- vealed both t he AQPap and A QP3 genes were colocalized in a B AC clone (RP11-115015) found by a BLAST search, indicating their close localization t o Chr9p13.3-p21.1. A mapping search revealed that both RP11-251017 containing wAQPap-2 gene and RP11-15E1 containing wAQP ap-3 gene were localizeded to Chr9p13.1, which i s a region that is more than 50 Mb closer to the centromere than AQPap and AQP3 gene locus. Promoter of the AQPap gene The 5¢ flanking region of the AQPap gene was sequenced, and transcriptional initiation sites of the AQPap gene were determined by 5¢ RACE using RNA isolated from human fat tissues (Fig. 3). Several different 5¢ ends were obtained by 5¢ RACE. RNase protection assay also revealed the presence of many transcription start sites using the RNA obtained from t he adipose tissues of five i ndividuals (data not shown). A search of the promoter region of the AQPap gene for canonical consensus sequences revealed the p resence of several putative binding sites f or transcription f actors (Fig. 3). Several binding sites f or CCAAT enhancer binding protein (C/EBP), and cAMP-regulatory element binding protein (CRE-BP), were identified in the promoter. An Alu repetitive sequence was detected in position )1276 to )1509 of the promoter o f the AQPap gene. Alu sequences were found also at the corresponding sites of wAQPap-1, -2 and -3, respectively (data not shown). The proximal promoter regions of the AQPap-like genes showed high similarity ( 98% homology) with that of AQPap downstream of the Alu sequences, whereas they quite differed from the AQPap promoter upstream of the Alu Table 2. Gene Bridge 4 Panel Radiation Hybrid mapping data. The chromosomal mapping of the AQPap gene was performed using the Gene Bridge 4 R adiation Hybrid panel and AQPap-specific primers as described in Materials and metho ds. Results were analyz ed on the w eb site. The results of PCR was expressed as a vector of 0’s and 1’s; 0 ¼ negative, 1 ¼ positive. The quoted LOD score is the highest, for which the linkage between AQPap and the flanking marker is supported. Gene/Locus Data vector LOD score Flanking marker AQPap 010000101100010101100010 15 D9S165 000000100101001100100100 110000011001010010010000 010010000000101000010 Fig. 3. Promoter sequence of AQPap gene. The sequence of the human AQPap promoter and its 5¢ flanking sequence are shown. The nucleotide corresponding to the 5¢ end of AQPap cDNA (5) is designated +1. Tran- scription start sites predicted by 5 ¢ RACE are marked by overscored filled circles. Putative transcription factor binding sites are predicted by the sequence m otif search pro gram, MATINSPECTOR PROFESSIONAL (http://www. genomatix.de/cgi-bin/matinspector/matin spector.pl). Three putative IREs and one putative PPRE are boxed with solid and broken lines, r espe ctively. T he i ntron s eque nce is shown in lowercase letters. Ó FEBS 2002 Genetic analysis of human AQPap gene (Eur. J. Biochem. 269) 1819 sequences, s uggesting t he evolutionar y link between the AQPap and wAQPap genes after the Alu sequence. The sequence dissimilarity upstream regions of the Alu sequence might account for the differential expression levels between the AQPap and AQPap-like genes. PPARc-mediated induction of AQPap transcription Inspection of the human AQPap promoter revealed a putative PPRE of the direct repeat 1 type at )46 to )62, which is similar to the consensus PPRE sequence (Fig. 4A) [27–31]. To determine the function of the AQPap promoter as well as its putative PPRE, transient reporter assays were performed using the wild-type ()681/+11) and PPRE- deleted constructs (Fig. 4B). These reporter plasmids were transfected to 3 T3-L1 p readipocytes or adipocytes, and treated with or without PGZ. The basal luciferase activity of the wild-type construct was increased significantly when transfected t o adipocytes, in comparison to preadipocytes. This differentiation mediated-modulation of AQPap pro- moter activity was totally abolished when the construct was deprived of PPRE in the DPPRE construct. The wild-type construct containing native )681/+11 regions showed a sixfold increase of luciferase activity when the cells were treated with PGZ. However, the construct lacking the PPRE region ()62/)46) specifically from the construct ()681/+11) showed no responses to treatment with PGZ (Fig. 4B). These results indicate tha t the P PRE site i n the human AQPap promoter is important for a high AQPap mRNA expression in differentiated adipose cells, and that Fig. 4. PPAR c-mediated induction of human AQPap gene transcription through PPRE. (A) The putative PPRE sequence in the promoter region of the human AQPap gene, compared with the classical PPRE consensus sequence. The bold (upp er case) letters de note conserved base(s) . (B) Firefly luciferase constructs of pAQPap-P PRE wild-type, pAQPap-PPRE deleted construct, or control pGL3-basic were cotransfected with pRL-SV40 into 3T3-L1 preadipo cytes (left) o r differentiated 3T3-L1 ad ipocytes (right), and incu bated in th e medium containing P GZ (final 10 l M ;solidbar) or co ntrol dimethylsulfoxide (DMSO) (open bar) as d escribed in the Materials and methods. The cells were harvested for the measurement of luciferase activity. The value of pAQPap-luciferase activity in the v ehicle (DMSO)-treated g roup was arbitrarily set as 1 .0. The n ormalized luci ferase activities are shown as mean ± SE (n ¼ 3). An a sterisk denotes a significant difference (P < 0.01, Student’s t-test) b etween the control (DMSO) group and the PGZ-treated group. (C) Direct an d specific binding o f PPARc/RXRa complex to the human AQPap PPRE. Electrophoretic mobility shift assays were performed as described in the Materials and methods. The 32 P-radiolabeled PP REwt o ligonucleot ide was in cu bated with in vitro synthesized PPARc and/or RXRa proteins. The competitive gel mobility sh ift assay was performed using 32 P-radiolabeled PPREwt as the input probe and unlabeled oligonucleotides (PPREwt or PPREmut) as competitors at 10-, and 50-fold molar excess. ( D) Schematic illustrations of PPARc and DPPAR c expression vecto rs, and t he effect o f DPPARc on human AQPap transcription. DPPARc construct was deprived of th e last 11 amino acids in the carboxyl terminus in the AF-2 d omain of PPARc. 3T3-L1 preadipocytes were transiently transfected with 10 ng pRL-SV40 plasmids, 1 lg pAQPap-Luciferase ()681/+11), 200 ng PPARc-, and increasing amoun ts of DPPARc- expression vectors for 4 h, and then the medium was supplemented with or without 10 l M PGZ for 24 h before harvest. The total amount of DNA added was adjusted to 2.21 lgusing empty pcDNA3.1. The value of pAQPap-luciferase activity in lane 1 was arbitrarily set as 1.0. The normalized luciferase activities are shown as mean ± SE ( n ¼ 3). 1820 H. Kondo et al. (Eur. J. Biochem. 269) Ó FEBS 2002 the site is responsible for t he induction of AQPap transcription by thiazolidinedione. PPARc’s partner f or transcriptional activation is RXR a [32]. To determine whether PPARc binds to the AQPap PPRE as complexes with RXRa, gel mobility shift assays were performed with double-stranded oligonucleotides containing AQPap PPRE (Fig. 4C). The 32 P-radiolabeled double-stranded PPREwt oligonucleotides were incubated with in vitro translated PPARc protein (Fig. 4C). Neither PPARc nor RXRa alone bound to AQPap PPRE (lanes 2 and 3). When PPARc and RXRa were produced together, the mobility of 32 P-radiolabeled PPRE oligonucleotides were shifted to a higher range, which indicated binding of the PPARc/RXRa complex to AQPap PPRE (lane 4). The addition of excessive unlabelled PPREwt oligonucleotides distinguished the signal of the 32 P-radiolabeled PPREwt oligonucleotides’ binding to PPAR c/RXRa (lanes 5 and 6). On the other hand, addition of PPREmut oligonucleotides containing three-base substitutions, previously reported t o diminish the binding of PPARc to P PRE in t he promoter o f FATP1 gene [ 29], did not affect the specific signal (lanes 7 and 8). These results indicate the specific binding of PPARc/ RXRa complex to the human AQPap PPRE. To further confirm the PPARc-dependent enhancement of AQPap gene expression, we generated dominant negative PPARc expression constructs. In t he other nuclear receptor- type transcriptional factors, the mutant construct lacking the c arboxyl activation function-2 (AF-2) domain possessed a dominant n egative effect on transcription of the target genes [33,34]. We generated a mutant PPARc expression construct, designated DPPAR c, which lacked the last 1 1 amino a cids in the AF-2 domain (Fig. 4D). The mutant protein derived from the DPPARc construct had the ability to bind to the AQPap PPRE oligonucleotides as a complex with RXRa, at a similar strength to the wild-type P PARc iprotein (data not shown). Figure 4 D demonstrates that the expression of PPARc induced the basal luciferase activity of the AQPap promoter in 3T3-L1 preadipocytes (lane 6 vs. lane 1), a nd a further increase was observed following incubation with PGZ (lane 16). These increases in promoter activities were re duced by transfection of the DPPARc construct, in a dose-dependent manner (lanes 6–10, and lanes 16–20). These data a lso confirmed the specific activation of AQPap gene transcription by PPARc.We identified the PPRE site ()93/)77) in the promoter of the mouse AQPap gene and observed similar findings in the characterization of the promoter [35]. Negative IRE in the human AQPap gene promoter Recently, we reported that mRNA expression and promoter activities of the m ouse AQPap gene were negatively regulated by insulin through an IRE in its promoter. In the p romoter of the human AQPap gene, we identified three regions identical or similar to the core negative IRE [T(G/ A)TTTT(G/T)], which were found previously in the promoters of genes such as PEPCK [36], IGFBP-1 [36], G6Pase [37], and IRS-2 [38] (Fig. 5A). These three core regions were designated as IRE1, IRE2 and IRE3, respec- tively (Fig. 5A). To determine whether there is a specific region required for insulin-mediated repression of AQPap transcription, deletion mutants of each IRE in the human AQPap promoter were subcloned into luciferase vectors (Fig. 5B). The wild-type construct contained native )681/ +147 regions having all t hree IREs, a nd showed 50% inhibition of luciferase activity after treatment with insulin (Fig. 5B). Constructs lacking IRE1 and IRE3 also showed insulin-mediated suppression of luciferase activity, to a similar degree to that of the wild-type construct ( )681/ +147). In contrast, constructs lacking IRE2 were t otally resistant to the inhibitory effect of insulin on promoter activities by reducing the basal promoter activity. These results demonstrate that the IRE2 sequence ()542/)536) is required for mediation o f the suppressing effect of insulin on the transcription of the human AQPap gene. We co nducted a detailed analysis of the promoter activity between t he wild-type ()681/+147) and IRE2-deleted mutant ()681/+147, DIRE1) (Fig. 5C). Insulin suppressed the wild-type luciferase activity in 3 T3-L1 adipocytes, in dose- and time-dependent fashions. In the absence of insulin, the wild-type AQPap promoter produced a higher luciferase activity than the deletion mutant ()681/+147, DIRE2) promoter. In the presence of insulin, the activity of the wild-type AQPap p romoter was reduced to the level of the mutant promoter, which was not affected by insulin. To further elucidate the significance of IRE2 for the insulin- mediated repression of the human AQPap gene, we prepared the luciferase plasmids with a single transversion mutation in IRE2 of the human AQPap promoter ( )681/ +147). The activity of the wild-type AQPap promoter was reduced by 51% in the presence of insulin, similar to Fig. 5B,C. Each mutation in base pairs 2 and 3 of the heptanucleotide sequence completely blocked the insulin- sensitive repression of human AQPap transcription (Fig. 5D), indicating that IRE2 was responsible for the insulin-mediated suppression of the human AQPap tran- scription, similar to mouse AQPap [20]. Genetic mutations of the AQPap gene in human subjects and functional analysis of the mutant proteins The entire coding regions of the AQPap genes were amplified from the genomic DNA derived f rom 160 Japanese subjects, and then d irectly sequ enced. Primers used for this analysis are shown in Table 1. Direct sequencing revealed that the genuine AQPap gene could be amplified without contamination of the AQPap-like genes. We found three missense mutations (Fig. 6A): a C fi T substitution at nucleotide 206 in exon 3 led to the amino-acid substitution from arginine to cysteine at posi- tion 12, which resides in the N-terminal cytoplasmic domain (R12C); a G fi C substitution at nucleotide 347 in exon 4 caused the amino-acid substitution from valine to l eucine at position 59, which resides in first transmembrane domain (V59L); and a G fi T substitution at nucleotide 9 63 in exon 8 led to the amino-acid substitution from glycine to valine at position 2 64, which resides in the sixth transmembrane domain. The other two were G fi A substitutions at nucleotide 480 in exon 5 and nucleotide 922 in exon 8, neither of which caused an amino-acid conversion (A103A and G250G, respectively). Among the 160 subjects exam- ined, these mutations were found in one subject for R12C, 13 for V59L, eight for A103A, one for G250G, a nd six for G264V. One subject was homozygous for G264V. The frequency of e ach mutation were not significantly associated with the phenotype of diabetes or obesity (Table 3). Ó FEBS 2002 Genetic analysis of human AQPap gene (Eur. J. Biochem. 269) 1821 Next we examined the functions of these mutant AQPap proteins. Glycerol and water permeabilities of oocytes microinjected w ith cRNA for mutant or wild-type AQPap were compared (Fig. 6). Two days after the injection of 50 ng of cRNA, the protein expressions of the wild-type and each mutant were confirmed by immunoblotting (Fig. 6 B). Under this condition, the g lycerol permeability of oocytes expressing AQPap-R12C, and AQPap-V59L was similar to that of wild-type AQPap (Fig. 6C). However, t he glycerol permeability of oocytes expressing the G264V mutant was lower, and comparable to that of c ontrol oocytes injected with H 2 O (Fig. 6C). Furthermore, the oocytes expressing AQPap-G264V showed much lower w ater permeability, comparable to that of the control oocytes, whereas the water permeabilities of oocytes expressing wild-type AQPap, AQPap-R12C, and AQPap-V59L were similar (Fig. 6D). As mentioned a bove, one subject (48-year-old-man) was homozygous for the nonfunctional G264V mutation. In the subject, BMI (23.7 kgÆm )2 ) and plasma concentra- tions of glycerol (104 lmolÆL )1 ), glucose (4.74 mmolÆL )1 ), total c holesterol (4.32 mmolÆL )1 ), HDL-cholesterol (1.23 mmolÆL )1 ), triglyceride (1.06 mmolÆL )1 )werewithina normal range. His fertility has not been disturbed because he has three children. Figure 7 shows the changes of plasma noradrenaline and glycerol levels after cycle ergometer exercise in the G264V homozygous subject and two control s ubjects. Endurance exercise on a cycle ergometer c aused remarkable i ncrease i n t he plasma noradrenaline level in the control and mutant subjects (Fig. 7 B). The plasma glycerol level increased markedly in the control subjects during t he exercise as has been described p reviously [39] (Fig. 7 B). However, t he plasma Fig. 5. Insulin-mediated suppression of human AQPap gene transcription through the IRE. (A) Consensus sequence of IRE and the p utative IREs of the AQPap gene (IR E 1: )629/)623, IRE2: )542/)536, IRE3: )121/)115). (B) S chemat ic p resentation o f the plasm id c onstru cts u sed t o i de ntify t he insulin response sequence in the promoters of the human AQPap gene. 3T3-L1 adipocytes were cotransfected with pRL-SV40 plasmid and the indicated constructs, and in cubated in the presence (solid bar) or absence (open bar) o f insulin as described in t he Materials and methods. T welve hours later, cells were harvested for the measurement of luciferase activity. T he value for noninsulin treated pGL 3-AQPap luciferase activity was arbitrarily set as 1.0. The normalized luciferase activities are shown as me an ± SE (n ¼ 5). An asterisk d enotes a significant difference (P < 0.05, Student’s t-test) between the control group and the insulin-treated g roup. (C) Dose- and time-curve of insulin-mediated inhibition of AQPap promoter activity in the 3T3-L1 adipocytes. 3T 3-L1 ad ipocytes were cotran sfected with p RL-SV40 plasmids, and e ither pAQPap (WILD )- Luciferase (closed circle) or pAQPap (DIRE2)-Luciferase (open circle) for 18 h, and then incubated for 12 h with the indicated concentration o f insulin (left) or incubated with 1 l M insulin for t he indicated time (right). T he cells were harvested for meas urement of luciferase a ct ivities. The value for pAQPap (WILD)-luciferase activity, in the absence of insulin (left) or 0 time of insulin incubation (right), was arbitrarily set as 1.0, respectively. Data are expressed as mean ± SE (n ¼ 4). (D) Cells were cotransfected with 10 ng pRL-SV40, and 1.0 lgofpAQPap-Luciferase(WILD)orthe indicated m utant plasmids i n which the indicated single base p air was substituted in t he IRE2 sequence. After incubation for 1 8 h, t he serum-free DMEM containin g 0.5% BSA was sup plemen ted in the absence (open bar) o r p resen ce (c losed b ar) of 1 l M insulin for 1 2 h. The percent inhibition of AQPap-mediated luciferase activity by insulin is shown (mean ± SE, n ¼ 5). An asterisk denotes a significant d ifferen ce (P <0.05,Student’s t-test) between the insu lin-treated and th e nontreated group s. 1822 H. Kondo et al. (Eur. J. Biochem. 269) Ó FEBS 2002 glycerol level was not increased in a subject homozygous for G264V mutation during exercise. DISCUSSION In the current study, w e demonstrated that the human AQPap gene is composed of eight exons, which span  18 kb, and is mapped to chromosome 9p13.3–21.1. Ishibashi et al. cloned AQP7 from human testis independ- ently [26]. Human AQP7 had an identical sequence in the coding region to that of human AQPap. A previous study claimed that the human AQPap/AQP7 gene was composed of six exons distributed over 6.5 kb [26]. In the current analysis, we identified two additional exon–intron bound- aries in the part of exon 1 that was originally described [26]. This discrepancy w as unlikely t o have arisen from the existence of another AQPap-related gene, because such an exon including exon-1, -2, and -3 was not amplified by PCR (data not shown). Furthermore, we identified t hree AQPap-like genes through the course of screening the human genomic library and the database search. T he wAQPap-1 g ene isolated from BAC genomic library was a pseudogene, because it had an inframe termination codon in exon 3, and a frame shift mutation in exon 7. The two AQPap-like genes were also identified by BLAST search analysis. RT-PCR a nalysis showed that the AQPap-like genes were little, if any, expressed in human tissues, which strongly suggested that these three AQPap-like genes were pseudogenes. RH mapping revealed that the AQPap gene was localized to chromosome 9p13.3-p21.1. AQPap-like genes were found Fig. 6. Protein expression and functional analysis of the mutant human AQPap genes. (A) Three identified m issense mutations in the topology of AQPap. NAA and NPS are amino-acid residues composed of NPA motifs highly conserved a mong the AQP family proteins. (B) On day 2 after the injection of water (H 2 O) or 10 ng of cRNA encoding wild type-AQPap (WT), AQPap-R12C ( R12C), AQPap-V59L ( V59L), an d AQPap-G264V (G264V), total m embrane proteins were purified from the oocytes. Immunoblotting for AQPap proteins was performed as described in the Materials and methods section. (C) Glycerol per- meabilities of the oocytes injected with water o r c RNAs wer e measur ed on da y 2 after injection. Data are represen ted as mean ± SE ( n ¼ 4). (D) Water permeability (P f ) of the oocytes injected with water or cRNA was measured in a standard swelling assay on day 2 after injection. Data are expressed as mean ± SE (n ¼ 5). Table 3. Frequency of mutation in AQPap gene. Mutation analysis AQPap gen e was performed for a total of 160 Japan ese subjects as described in Materials and methods. Frequencies of the subjects carrying AQPap mutations were indicated. n R12C V59L A103A G250G G264V Non-DM, non-obese 71 0 5 2 0 3 a DM 64 1 6 3 0 3 Obese 16 0 1 2 1 0 DM + obese 9 0 1 1 0 0 Total 160 1 13 8 1 6 a One of the three subjects was homozygous for G264V mutation. The other mutations were identified in heterozygous form. Fig. 7. Exercise-induced changes in plasma noradrenaline and glycerol in the control and the AQPap-G264V homozygous subjects. (A) Sche- matic illustration of the protocol of exercise experiment. (B) T he plasma noradrenaline (left) and glycerol (right) levels of a subject homozygous for G264V mutation (d)werecomparedwiththoseof two control subjects with wild type-AQPap gene (s,n). T ime 0 rep- resents the base-line (i.e. resting). Concentration of plasma noradren- alineattime0was105pgÆmL )1 in the G264V homozygote, and 195 and 227 pgÆmL )1 in the control subjects. Concentration of plasma glycerol at time 0 w as 104.4 lmol ÆL )1 in the G264V hom ozygote, and 55.7 and 97.2 lmolÆL )1 in the control subjects. Ó FEBS 2002 Genetic analysis of human AQPap gene (Eur. J. Biochem. 269) 1823 [...]... study demonstrated that the promoter activity of the human AQPap gene was increased by PGZ, a synthetic PPARc agonist, through the PPRE site at )62/)46 in the promoter region An identical PPRE site was found in the promoter of the mouse AQPap [35] The AQPap mRNAs were increased in 3T3-L1 cells following PPARc induction during the differentiation into adipocytes [35] Promoter analysis of human AQPap in... tissue of humans [5] was also attributed to the specific and abundant expression of PPARc in human adipose tissue The promoter of the human AQPap gene had the site that was negatively regulated by insulin In our recent study, the mRNA and the promoter activity of mouse AQPap were suppressed by the action of insulin [20] IRE in the human AQPap gene promoter which was accountable for insulinmediated suppression... sequence similar to those in the promoters of the mouse AQPap [20], rat PEPCK [36], mouse FATP1 [40] and human IRS-2 [38] genes The deletion mutant of this specific IRE decreased basal transcription activity in the absence of insulin and abolished insulin-mediated repression Previous in vivo studies using mice have demonstrated that AQPap mRNA increased and decreased during fasting and refeeding, respectively,... regulation of the AQPap and FATP1 genes by insulin should be efficient for supplying glycerol and FFA in accordance with nutritional conditions However, in the adipose tissue of insulin-resistant animals, AQPap and FATP1 mRNA levels were increased, despite high concentrations of plasma insulin, leading to higher plasma glycerol and FFA levels [19,41] Increased influx of glycerol and FFA into the liver... liver enhances hepatic glucose production and output [18,42] Insulin-mediated suppression of the human AQPap gene through functional IRE similar to mouse AQPap, suggests that human AQPap gene transcription is also regulated in response to nutritional conditions through the IRE, and is augmented in insulinresistant states, resulting in increased plasma glycerol and hepatic glucose production in obese,... production in obese, insulin-resistant subjects Among three missense mutations (R12C, V59L, and G264V) identified in human subjects, G264V mutant protein was incapable of transporting glycerol as well as water Murata et al [43] documented that the conserved GxxxGxxxG motif [44] in the third and sixth transmembrane domains was important for functional conformation of the AQP family protein; glycine can be... Hospital), Kazuya Yamagata, and Kikuko Hotta for providing the samples We are grateful to Yuko Matsukawa and Sachiyo Tanaka for excellent technical assistance This work was supported in part by the fund from the ÔResearch for the FutureÕ Program from the Japan Society for the Promotion of Science: JSPSRFTF97L00801 and Grants-in-Aid from the Ministry of Education, Science, Sports and Culture of Japan (09307019,... peroxisome proliferator-activated receptor a and c activators in a tissue- and inducer-specific manner J Biol Chem 273, 16710–16714 2 Schaffer, J.E & Lodish, H.F (1994) Expression cloning and characterization of a novel adipocyte long chain fatty acid transport protein Cell 79, 427–436 3 Stremmel, W., Strohmeyer, G., Borchard, F., Kochwa, S & Berk, P.D (1985) Isolation and partial characterization of a fatty... Marumo, F & Sasaki, S (1997) Cloning and functional expression of a new water channel abundantly expressed in the testis permeable to water, glycerol, and urea J Biol Chem 272, 20782–20786 14 Koyama, Y., Yamamoto, T., Kondo, D., Funaki, H., Yaoita, E., Kawasaki, K., Sato, N., Hatakeyama, K & Kihara, I (1997) Molecular cloning of a new aquaporin from rat pancreas and liver J Biol Chem 272, 30329–30333... 162, 156–159 23 Rubin, C.S., Hirsch, A., Fung, C & Rosen, O.M (1978) Development of hormone receptors and hormonal responsiveness in vitro Insulin receptors and insulin sensitivity in the preadipocyte and adipocyte forms of 3T3-L1 cells J Biol Chem 253, 7570–7578 24 Zhang, R & Verkman, A.S (1991) Water and urea permeability properties of Xenopus oocytes: expression of mRNA from toad urinary bladder Am . Human aquaporin adipose (AQPap) gene Genomic structure, promoter analysis and functional mutation Hidehiko Kondo 1 , Iichiro Shimomura 1 ,. gene. Analysis of AQPap sequence i n human subjects revealed three missense muta- tions (R12C, V59L and G264V), and two silent mutations (A103A and G250G).