Báo cáo Y học: Mammalian mitochondrial endonuclease G Digestion of R-loops and localization in intermembrane space doc

Mammalian mitochondrial endonuclease G Digestion of R-loops and localization in intermembrane space Takashi Ohsato 1 , Naotada Ishihara 2 , Tsuyoshi Muta 1 , Shuyo Umeda 1 , Shogo Ikeda 3 , Katsuyoshi Mihara 2 , Naotaka Hamasaki 1 and Dongchon Kang 1 1 Department of Clinical Chemistry and Laboratory Medicine, Kyushu University Graduate School of Medical Sciences, Fukuoka, Japan; 2 Department of Molecular Biology, Graduate School of Medical Sciences, Kyushu University, Fukuoka, Japan; 3 Department of Biochemistry, Faculty of Science, Okayama University of Science, Japan Mammalian mitochondria contain strong nuclease activity. Endonuclease G (endoG), which predominantly resides in mitochondria, accounts for a large part of this nuclease activity. It has been proposed to act as an RNase H-like nuclease on RNAÆDNA hybrids (R-loops) in the D-loop region where the origins of mitochondrial replication are mapped, providing RNA primers for mtDNA replication. However, in contrast with this proposed activity, endoG has recently been shown to translocate to nuclei on apoptotic stimulation and act as a nuclease without sequence specif- icity. To clarify the role of endoG in mtDNA replication, we examined its submitochondrial localization and its ability to cleave R-loops. At low concentration, it preferentially produces double-stranded breaks in R-loops, but does not act as an RNase H-like nuclease. In addition, it exists in the mitochondrial intermembrane space, but not in the matrix where mtDNA replication occurs. These results do not support the involvement of endoG in mtDNA replication. Based on the fact that guanine tracts, which are preferential targets of endoG, tend to form triplex structures and that endoG produces double-stranded breaks in R-loops, we propose that three-stranded DNA may be the preferred substrate of endoG. Keywords: endonuclease G; mitochondria; mitochondrial DNA; R-loop; triplex DNA. Mammalian mitochondria contain strong nuclease activity which becomes evident when the membranes are disrupted by detergents. Endonuclease G (endoG) accounts for a large part of this mitochondrial nuclease activity. It is essentially a nonspecific nuclease for all nucleic acid species including double-stranded DNA, single-stranded DNA, single-stran- ded RNA, and RNAÆDNA duplexes [1,2]. As endoG predominantly resides in mitochondria [1], it has been thought to be involved in the metabolism of mtDNA. It is considered that mitochondrial transcripts stably hybridize with template strands around conserved sequence blocks (CSBs) during transcription, forming R-loops consisting of two DNA strands and one RNA strand, and serve as primers for mtDNA replication (Fig. 1A). EndoG cleaves the RNA of a linear RNAÆDNA duplex preferentially in the CSB region [3], raising the possibility that endoG can generate RNA primers for mtDNA replication [3]. How- ever, endoG is not a specific RNase. On the other hand, RNase MRP 1 , which is also thought to provide RNA primers by cleaving the RNA of R-loops, is a specific RNase. In addition, the endogenous RNAÆDNA hybrid is formed in supercoiled mtDNA and should be a triple-stranded R-loop [4]. The cleavage of the RNA of triple-stranded R-loops by endoG has never been shown, while RNase MRP has been shown to cleave the RNA of triple-stranded R-loops preferentially at the CSBs [5]. Furthermore, NUC1, which is a yeast homolog of endoG and is also found in mitochondria, is not essential for mtDNA replication in yeast, as disruption of the gene leads to no obvious derangement of the metabolism of mtDNA [6]. Thus the role of endoG in mtDNA replication is still ambiguous. EndoG has recently been reported to be an apoptotic nuclease [7]. It translocates to the nucleus upon apoptotic stimulus and extensively degrades nuclear DNA, suggesting that, in mitochondria, it has the potential to fully digest mtDNA. This raises another issue of how mtDNA escapes extensive digestion by endoG under steady-state conditions. To further elucidate the function of endoG, we examined its submitochondrial localization and its ability to cleave reconstituted R-loops. Here we show that it preferentially produces double-stranded breaks in the R-loops and that it is localized in the mitochondrial intermembrane space. We discuss the possibility that noncanonical DNA structures are preferential substrates for endoG. EXPERIMENTAL PROCEDURES Cloning and expression of human mature endoG A human cDNA library (Human HeLa S3 MATCHMA- KER cDNA Library; Clontec Laboratories, Palo Alto, CA, USA) was used for amplification of human mature endoG cDNA by PCR. A plasmid for mature human endoG with an N-terminal histidine tag was constructed by inserting the Correspondence to D. Kang, Department of Clinical Chemistry and Laboratory Medicine, Kyushu University Graduate School of Medical Sciences, Fukuoka 812-8582, Japan. Fax: + 81 92 642 5772, Tel.: + 81 92 642 5749, E-mail: kang@biochem2.med.kyushu-u.ac.jp Abbreviations: endoG, endonuclease G; CSB, conserved sequence blocks; mHSP70, mitochondrial heat shock protein 70. (Received 24 June 2002, revised 2 September 2002, accepted 6 September 2002) Eur. J. Biochem. 269, 5765–5770 (2002) Ó FEBS 2002 doi:10.1046/j.1432-1033.2002.03238.x cDNA coding for mature endoG (A49-K297) into pProEX- HTb (Clontec) and named pHis-hmEG. Recombinant histidine-tagged endoG (His-endoG) was expressed in Escherichia coli BL21 cells. The expressed recombinant protein formed inclusion bodies. The aggregated His-endoG was denatured and solubilized with buffer containing 6 M guanidine, 0.5 M NaCl, 50 m M Tris/HCl, pH 8.0, and 1 m M dithiothreitol. The solubilized protein was bound to Ni 2+ - chelating Sepharose resin (Amersham Pharmacia Biotech). The resin was washed with buffer consisting of 20 m M Tris/ HCl, pH 7.5, 0.5 M NaCl, 5 m M imidazole, 0.1% Triton X-100, 2 m M 2-mercaptoethanol, 10% glycerol, and 6 M urea. The denatured His-endoG was renatured on the resin by sequentially reducing the urea in the buffer from 6 M to 0 M , in 10 steps. The renatured His-endoG was finally eluted with buffer consisting of 20 m M Tris/HCl, pH 7.5, 0.5 M NaCl, 300 m M imidazole, 0.1% Triton X-100, 2 m M 2-mercaptoethanol, and 10% glycerol. The eluted sample was dialyzed against 20 m M Tris/HCl, pH 7.5, 0.5 M NaCl, 0.1% Triton X-100, 2 m M 2-mercaptoethanol, and 50% glycerol. The recombinant His-endoG was purified to apparent homogeneity as judged by SDS/PAGE (results not shown). After separation by SDS/PAGE, we deter- mined protein concentrations by Coomassie Brilliant Blue staining using a LAS-1000 CCD camera and IMAGE GAUGE TM image analysis software (Fuji Photo Film). BSA was used as a standard. Cleavage of R-loops by endoG The plasmid pGEMhmD was used for in vitro R-loop formation (Fig. 3A) [8]. Because we used SP6 RNA polymerase instead of mtRNA polymerase, the human mitochondrial D-loop region lacking authentic promoters for the light and heavy strands was inserted downstream of the SP6 promoter in pGEMhmD. R-loops were reconsti- tuted as described previously [8]. Briefly, a reaction mixture containing 5 n M pGEMhmD, 50 m M KCl, 20 m M Tris/ HCl, pH 8.0, 10 m M MgCl 2 ,1m M dithiothreitol, 0.1 m M NTPs, and 0.2 UÆlL )1 SP6 RNA polymerase was incubated for 30 min at 37 °C essentially as described by Lee & Clayton [9]. To remove NTPs, the reaction mixture was applied to a gel-filtration spin column. The R-loops in the eluate were ethanol-precipitated, dried, and resolubilzed in distilled water. R-loop resolution with RNase H was performed in 20 lL buffer containing 0.1 pmol R-loops, 20 m M Tris/HCl, pH 8.0, 50 m M KCl, 4 m M MgCl 2 ,1m M dithiothreitol, RNase H (6 U), and 0.05% BSA at 37 °Cfor 10 min. The reaction was stopped by the addition of 1 lgÆmL )1 proteinase K and 0.5% SDS, and then incubated for another 10 min. The cleavage reaction was performed in 20 lL buffer containing 0.1 pmol R-loops, 20 m M Tris/ HCl, pH 8.0, 50 m M KCl, 4 m M MgCl 2 ,1m M dithiothre- itol, 2 m M ATP, and 0.05% BSA in the presence of the indicated concentration of endoG for 10 min at 37 °C. The reaction was stopped by the addition of 1 lgÆmL )1 prote- inase K and 0.5% SDS, and then incubated for another 10 min. R-loops were analyzed by 0.7% agarose gel electrophoresis in buffer consisting of 89 m M Tris base, 89 m M boric acid, and 2 m M EDTA. Determination of cleavage sites After 1 lg R-loops or pGEMhmD had been treated with 50 ng endoG for 10 min, DNA was ethanol-precipitated, washed with 70% ethanol, dried, and solubilized in distilled water. To determine the 5¢ ends of cleavage sites, one cycle of primer extension reactions was performed using 5¢-fluorescein isothiocyanate (FITC)-labeled primers [FD7 (FITC-ctacgttcaatattacaggcg) and FpGEM (FITC- ctttatgcttccggctcgtatg) for the heavy and light strands, respectively]. DNA was denatured for 5 min at 95 °C, the primer was annealed for 0.5 min at 55 °C, and then an extension reaction was performed for 1 min at 72 °Cusing LA Taq polymerase (Takara, Seta, Japan). For sequence ladders, 25 cycles of primer extension reactions were similarly performed, but using a Thermo Sequence Core Sequencing kit (Amersham Pharmacia Biotech) and 0.5 lg pGEMhmD as a template in the presence of one of the dideoxy dNTPs according to the manufacturer’s instruc- tions. The products were resolved on a 7 M urea/5% Long Ranger TM sequencing gel (FMC Bioproducts, Rockland, ME, USA) and analyzed with FluorImager 595 (Amersham Pharmacia Biotech). Fig. 1. Cleavage of R-loops. (A) The scheme for R-loop formation in vivo.Forin vitro R-loop formation, we used SP6 RNA polymerase instead of mitochondrial RNA polymerase. Therefore, in pGEMhmD, the human mitochondrial D-loop region lacking authentic promoters for the light and heavy strands is inserted downstream of the SP6 pro- moter (see Fig. 3A). LSP, light strand promoter; TFAM, mitochondrial transcription factor A; CSBs, conserved sequence blocks; TAS, ter- mination associated sequence. (B) Supercoiled pGEMhmD plasmids (upper) or R-loops (lower) were treated with various concentrations of recombinant human endoG for 10 min at 37 °C and then resolved on a 0.7% agarose gel. rEG, recombinant human endonuclease G; OC, open circular form; L, linear form; SC, supercoiled form. 5766 T. Ohsato et al.(Eur. J. Biochem. 269) Ó FEBS 2002 Submitochondrial localization of endoG Anti-endoG sera were obtained by immunizing rabbits with the recombinant human His-endoG. The resulting antisera also reacted with human, bovine, mouse, and rat endoG. Mouse monoclonal antibodies against cytochrome c and mitochondrial heat shock protein 70 (mtHSP70) were purchased from Becton Dickinson and StressGen, respect- ively. Antisera against rat Tim23, Tim43, and Tom20 were as previously described [10,11]. Rat liver mitochondria were prepared as previously described [10]. For preparation of soluble and particulate fractions, intact rat mitochondria (1 mg proteinÆmL )1 ) were disrupted by sonication in low-salt isotonic buffer (10 m M Hepes/KOH, pH 7.4, 0.22 M sucrose, and 0.07 M mannitol), with 0.1 M Na 2 CO 3 added before sonication in some experiments. Next, 2.0 M NaCl and 1.0% Triton X-100 were added, and the samples were centrifuged at 100 000 g for 30 min and separated into pellets and supernatants. The pellets were suspended in the same volume of buffer, and each fraction was solubilized with an equal volume of SDS sample buffer. The outer membranes were disrupted by hypotonic treatment (10 m M Hepes/ KOH, pH 7.4), and the resulting mitoplasts were incubated with or without proteinase K (100 lgÆmL )1 ) in the low-salt isotonic buffer for 1 h at 4 °C.Outermembraneswerealso disrupted by treatment of intact mitochondria (1 mg proteinÆmL )1 ) with digitonin for 10 min in the low-salt isotonic buffer at 4 °C. Protein concentrations of mito- chondria were determined by the Lowry method using BSA as a standard. RESULTS Cleavage of R-loops by endoG When supercoiled pGEMhmD plasmid was treated with recombinant human endoG, it was first converted into an open circular form (Fig. 1B, upper panel). With increasing endoG concentration, a linear form appeared accompanied by further degraded products. It is likely that endoG introduced nicks into the plasmids, and, in due course, the accumulation of nicks resulted in double-stranded breaks. We reconstituted R-loops using supercoiled pGEMhmD plasmids containing the human mitochondrial D-loop region [8]. The R-loops generated showed retarded mobility on a gel (Fig. 2, lane 1 in lower panel). R-loop formation was confirmed by the restoration of electrophoretic mobility after treatment with RNase H, which digests the RNA in an RNAÆDNA duplex (Fig. 2, lane 2 in lower panel). The R-loop mimics the endogenous RNAÆDNA hybrid better thandoesalinearRNAÆDNA duplex. R-loops were linearized at concentrations at which endoG converted ordinary supercoiled plasmids into open circular forms (Fig. 1B, lanes 2 and 3 in upper and lower panels). At higher concentrations, R-loops were eventually degraded into small pieces. These results suggest that endoG directly produced double-stranded breaks in the R-loop, instead of introducing nicks. Subsequently, the linearized DNA was further digested. Consistent with this, the linear form appeared as early as 1 min after the addition of endoG (Fig. 2, lower panel). At this time point, the ordinary supercoiled plasmid was hardly converted into a relaxed form at all (Fig. 2, upper panel). It is noteworthy that a closed circular form was never observed during endoG treatment of R-loops over the time course of the study (Fig. 2. lower panel). If RNA was first cleaved with RNase H activity of endoG, the R-loops would have reverted to closed circular plasmids as they were with RNase H (Fig. 2, lane 2 in lower panel). This suggests that cleavage of DNA is a primary event. Fig. 2. Time course of endoG digestion. Supercoiled pGEMhmD plasmids (upper) or R-loops (lower) were incubated with 50 ng endoG for the indicated periods (lanes 4–10). Supercoiled pGEMhmD plas- mids were incubated without endoG (lanes 2 and 3 in upper panel). R-loops (lane 1 in lower panel) were treated with RNase H (lane 2 in lower panel). Fig. 3. Cleavage sites of R-loops. (A) Diagram of pGEMhmD. (B) R-loops after cleavage by 50 ng endoG (lane 2), and after further cleavage with ScaI(lane3)orNaeI(lane4). Ó FEBS 2002 Endonuclease G in mitochondria (Eur. J. Biochem. 269) 5767 We mapped the cleavage sites of the R-loops. The R-loops were treated with endoG and then cleaved with a restriction enzyme (ScaIorNaeI) that cuts at a unique site on the plasmid pGEMhmD (Fig. 3A). ScaIcreatedtwo bands of about 2.1 and 1.9 kbp (Fig. 3B, lane 3). NaeI similarly produced two bands corresponding to about 2.8 and 1.2 kbp (Fig. 3B, lane 4). From these results, the cleavage site by endoG was mapped to the CSB region (Fig. 3A). The positions were further localized by primer extension. The cleavage signals were mapped to the guanine-rich region in CSB II of the mitochondrial heavy strand in the ordinary supercoiled plasmids (Fig. 4A, lanes 3 and 4). The signals were hardly observed at all at the opposite side, i.e. the cytosine-rich region of the light strand (Fig. 4B, lane 4), which is consistent with endoG having a preference for a G-tract over an opposite C-tract [12]. These observations also explain how endoG produced an open circular form in the case of ordinary supercoiled plasmids (Figs 1 and 2). In contrast, the cleavage sites in R-loops were clustered between the CSB II and SP6 promoter region in both the heavy (Fig. 4A, lanes 7 and 8) and light (Fig. 4B, lane 5) strands, and there seemed to be no sequence specificity. We observed nonspecific signals for the heavy strands (Fig. 4A, lanes 1–8, asterisk). Fig. 4. Precise mapping of cleavage sites. The 2 supercoiled pGEMhmD plasmids and R-loops were incubated with or without EcoRI or endoG. (A) Heavy strand. The cleavage sites were determined by primer extension using the primer FD7. Lanes T, G, C, and A indicate sequence ladders (lanes 9–12). Except for the sequence lanes, each sample was duplicated; the two lanes correspond to 0.5 lg(lanes1,3,5,and7)and1.0lg(lanes2,4,6, and 8) of template DNA, respectively. Signals marked with * may be nonspecific artifacts caused by stalling of the extension reaction. (B) Light strand. The reactions were performed as in (A), except the primer FpGEM was used. Except for the sequence lanes (lanes 6–9), each sample corresponds to 1.0 lg template DNA (lanes 1–5). 5768 T. Ohsato et al.(Eur. J. Biochem. 269) Ó FEBS 2002 Because these signals were observed even in nondigested plasmids (Fig. 4A, lanes 1 and 2), the DNA polymerase used in the primer extension reaction may tend to pause around the sites, and the signals may be technical artifacts. We also saw several signals for the light strand when nondigested R-loops were used (Fig. 4B, lane 3). Because such signals were not observed when normal pGEMhmD was used (Fig. 4B, lane 2), primer extension reactions would frequently and artificially terminate only when using R-loops. Although the exact reason for the termination is not clear, considering that R-loops are fairly stable to heat [9] and the template light strand was originally hybridized with RNA, one possibility is that RNAÆDNA hybrids that remain even after denaturation by heat may block the extension reaction. Submitochondrial localization of endoG Next we examined the submitochondrial localization of endoG. When rat liver mitochondria were disrupted by sonication in low-salt isotonic buffer, endoG was mainly recovered from a particulate fraction (Fig. 5A, lanes 7 and 8). On the other hand, it was released into the soluble fraction in the presence of 2.0 M NaCl, 0.1 M Na 2 CO 3 ,or 0.5% nonionic detergent Triton X-100 (Fig. 5A, lanes 1–6), indicating that it is peripherally associated with the mitochondrial membranes. Cytochrome c, a protein loosely associated with inner membranes on the inter- membrane-space side, showed the same behavior as endoG (results not shown). EndoG in intact mitochondria was resistant to proteinase K (Fig. 5B, lanes 1 and 2), but when the outer membranes were disrupted by hypotonic treatment, it was digested by proteinase K (Fig. 5B, lanes 3 and 4). This indicates that it is localized in the intermembrane space, because the inner membranes remained intact, protecting mHSP70 (a mitochondrial matrix protein) from digestion (Fig. 5B, lane 4). Although a trace of endoG remained even after the proteinase K treatment (Fig. 5B, lane 4), cytochrome c also remained to a similar extent (Fig. 5B, lane 4), suggesting that the residual endoG is due to incomplete disruption of the outer membranes. To confirm this localization, the outer membranes were disrupted with digitonin and then digested with proteinase K. At 500 lgÆmL )1 digitonin (Fig. 5C, lane 3), Tim23, an inner membrane protein facing the intermembrane space, was completely digested with proteinase K, whereas neither mHSP70 nor Tim44, an inner membrane protein facing the matrix side, was digested. This indicates that the protease has access to the outside of the inner membranes but not the matrix side. Under these conditions, both cytochrome c and endoG were digested (Fig. 5C, lane 3). Both mHSP70 and Tim44 were completely digested with proteinase K when mito- chondria were solubilized with 0.5% Triton X-100 (results not shown). Thus, endoG and mtDNA are localized to different compartments, which may protect mtDNA from extensive digestion by endoG. DISCUSSION EndoG is essentially a nonspecific nuclease [1,2], which is evident in vivo after apoptotic stimulation, when endoG Fig. 5. Submitochondrial localization of endoG. (A) Intact rat mitochondria (lane 9) were disrupted by sonication in low-salt isotonic buffer (lanes 7 and 8). Then 2.0 M NaCl (lanes 5 and 6) and 1.0% Triton X-100 (lanes 1 and 2) were added. In some preparations, 0.1 M Na 2 CO 3 was added before sonication and there was no further treatment (lanes 3 and 4). The samples were centrifuged and separated into pellets (P) and supernatants (S). Samples corresponding to 20 lg mitochondrial protein were applied to each lane. EndoG was detected by Western blotting. (B) Intact mito- chondria were incubated without proteinase K (lane 1) or with proteinase K (lane 2) for 1 h at 4 °C. Outer membranes were disrupted by hypotonic treatment. The mitoplasts were then incubated without proteinase K (lane 3) or with proteinase K (lane 4) in the low-salt isotonic buffer for 1 h at 4 °C. Tom20, endoG, cytochrome c, Tim44, and mHSP70 were detected by Western blotting. (C) Intact mitochondria were treated with digitonin for 10 min in the low-salt isotonic buffer at 4 °C followed by proteinase K digestion (lanes 1–3). mHSP70, Tim44, Tim23, endoG, and cytochrome c were detected by Western blotting. Ó FEBS 2002 Endonuclease G in mitochondria (Eur. J. Biochem. 269) 5769 translocates en masse from mitochondria to nuclei and extensively digests nuclear DNA [7]. Under these condi- tions, endoG at high concentration appears to act as a nonspecific nuclease. However, at low concentration, it appears to be quite specific for kinked DNA, such as that in R-loops (Fig. 1). We have shown that endoG preferentially introduced double-stranded breaks in a specific region of R-loops. RNA consistently forms a hybrid in CSB II [9], and transcription for R-loop formation starts from the SP6 region in our in vitro transcription system. Therefore, the starting point of the RNAÆDNA hybrid formation must be located between these two regions. Considering that there was no sequence specificity, endoG may recognize a three-stranded junction structure formed at the starting point of the RNAÆDNA hybrid. Alternatively, it may recognize the looping-out single-stranded DNA and an A-form helix that an RNAÆDNA duplex is likely to take on. As reported elsewhere, endoG preferentially cleaves damaged DNA [13]. Many kinds of DNA damage cause distortion of the DNA helix. Guanine-rich DNA, which is a preferential target of endoG [12], tends to form irregular structures such as triplexes and quadruplexes [14]. Taken together with our observations of the activity of endoG on R-loops, it is evident that noncanonical structures of DNA, e.g. damaged DNA, triplex DNA, and R-loops, may generally be preferential substrates for endoG. Triplex or quadruplex DNA strands can be formed intramolecularly or intermolecularly in vivo in purine-rich regions [14]. These structures block transcription and replication. For instance, it has been reported that expansion of the GAA triplet repeat of the frataxin gene results in triplex structures, thereby causing tran- scription to be paused [15]. R-loop formation can occur in a nonspecific manner during transcription [16] and can serve as a primer for DNA synthesis [17], although the nascent RNA molecule is normally displaced from the DNA template strand shortly after synthesis. Accumula- tion of R-loops is hazardous to cells, because of induction of unregulated replication [18]. In addition, guanine-rich RNA can participate in very stable three- stranded structures by establishing both Watson–Crick and Hoogsteen-type hydrogen bonds [19], the formation of which inhibits transcription. Given that endoG is normally regulated to exist in nuclei at a very low level, it may have a role in survival in normal states by eliminating kinked DNA formed in guanine-rich regions. EndoG has been proposed to provide primers for mtDNA replication by cleaving the RNA moiety of RNAÆDNA hybrids formed at the origin of replication [3]. However, based on our observations, endoG would not act as an RNase in these conditions, but would instead preferentially degrade mtDNA in an R-loop. Further- more, we have shown that endoG exists in the intermem- brane space (Fig. 5B,C), whereas mtDNA replication should take place in the matrix. On the other hand, RNase MRP has been shown to cleave RNA of triple- stranded R-loops preferentially at the CSBs [5], and is another RNase proposed to create RNA primers. The role of endoG in mtDNA replication may require careful re-evaluation. ACKNOWLEDGEMENTS This work was supported in part by Grants-in Aid for Scientific Research from the Ministry of Education, Science, Technology, Sports, and Culture of Japan. REFERENCES 1.Gerschenson,M.,Houmiel,K.L.&Low,R.L.(1995) Endonuclease G from mammalian nuclei is identical to the major endonuclease of mitochondria. Nucleic Acids Res. 23, 88–97. 2. Widlak, P., Li, L.Y., Wang, X. & Garrard, W.T. (2001) Action of recombinant human apoptotic endonuclease G on naked DNA and chromatin substrates: cooperation with exonuclease and DNase I. J. Biol. Chem. 276, 48404–48409. 3. Cote, J. & Ruiz-Carrillo, A. (1993) Primers for mitochondrial DNA replication generated by endonuclease G. Science 261, 765–769. 4. Shadel, G.S. & Clayton, D.A. (1997) Mitochondrial DNA main- tenance in vertebrates. Annu. Rev. Biochem. 66, 409–435. 5. Lee, D.Y. & Clayton, D.A. (1997) RNase mitochondrial RNA processing correctly cleaves a novel R loop at the mitochondrial DNA leading-strand origin of replication. Genes Dev. 11, 582–592. 6. Zassenhaus, H.P., Hofmann, T.J., Uthayashanker, R., Vincent, R.D. & Zona, M. (1988) Construction of a yeast mutant lacking the mitochondrial nuclease. Nucleic Acids Res. 16, 3282–3296. 7. Li, L.Y., Luo, X. & Wang, X. (2001) Endonuclease G is an apoptotic DNase when released from mitochondria. Nature (London) 412, 95–99. 8. Ohsato, T., Muta, T., Fukuoh, A., Shinagawa, H., Hamasaki, H. & Kang, D. (1999) R-loop in the replication origin of human mitochondrial DNA is resolved by RecG, a Holliday junction- specific helicase. Biochem. Biophys. Res. Commun. 255,1–5. 9. Lee, D.Y. & Clayton, D.A. (1996) Properties of primer RNA– DNA hybrid at the mouse mitochondrial DNA leading origin of replication. J. Biol. Chem. 271, 24262–24269. 10. Ishihara, N. & Mihara, K. (1998) Identification of the protein import components of the rat mitochondrial inner membrane, rTIM17, rTIM23, and rTIM44. J. Biochem. (Tokyo) 123,722– 732. 11. Iwahashi, J., Yamazaki, S., Komiya, T., Nomura, N., Nishikawa, S., Endo, T. & Mihara, K. (1997) Analysis of the functional domain of the rat liver mitochondrial import receptor Tom20. J. Biol. Chem. 272, 18467–18472. 12. Ruiz-Carrillo, A. & Renaud, J. (1987) Endonuclease G: a (dG) n X (dC) n-specific DNase from higher eukaryotes. EMBO J. 6, 401–407. 13. Ikeda, S. & Ozaki, K. (1997) Action of mitochondrial endonuclease G on DNA damaged by L -ascorbic acid, peplomy- cin, and cis-diamminedichloroplatinum (II). Biochem. Biophys. Res. Commun. 235, 291–294. 14. Gilbert, D.E. & Feigon, J. (1999) Multistranded DNA structures. CurR Opinion Sruct. Biol. 9, 305–314. 15. LeProust, E.M., Pearson, C.E., Sinden, R.R. & Gao, X. (2000) Unexpected formation of parallel duplex in GAA and TTC trinucleotide repeats of Friedreich’s ataxia. J. Mol. Biol. 302, 1063–1080. 16. Masse, E. & Drolet, M. (1999) Escherichia coli DNA topoisome- rase I inhibits R-loop formation by relaxing transcription-induced negative supercoiling. J. Biol. Chem. 274, 16659–16664. 17. Asai, T. & Kogoma, T. (1994) D-loops and R-loops: alternative mechanisms for the initiation of chromosome replication in Escherichia coli. J. Bacteriol. 176, 1807–1812. 18. Hong, X., Cadwell, G.W. & Kogoma, T. (1995) Escherichia coli RecG and RecA proteins in R-loop formation. EMBO J. 14, 2385–2392. 19. Praseuth, D., Guieysse, A.L. & Helene, C. (1999) Triple helix formation and the antigene strategy for sequence-specific control of gene expression. Biochim. Biophys. Acta. 1489, 181–206. 5770 T. Ohsato et al.(Eur. J. Biochem. 269) Ó FEBS 2002 . Blue staining using a LAS-1000 CCD camera and IMAGE GAUGE TM image analysis software (Fuji Photo Film). BSA was used as a standard. Cleavage of R-loops by endoG The. using 5¢-fluorescein isothiocyanate (FITC)-labeled primers [FD7 (FITC-ctacgttcaatattacaggcg) and FpGEM (FITC- ctttatgcttccggctcgtatg) for the heavy and light strands, respectively].