Antibiotic resistant enterococci and staphylococci isolated from flies collected near confined poultry feeding operations Jay P. Graham ⁎ , Lance B. Price, Sean L. Evans, Thaddeus K. Graczyk, Ellen K. Silbergeld Johns Hopkins Bloomberg School of Public Health, Department of Environmental Health Sciences, Division of Environmental Health Engineering, Baltimore, MD 21205, USA ARTICLE DATA ABSTRACT Article history: Received 29 July 2008 Received in revised form 17 November 2008 Accepted 25 November 2008 Use of antibiotics as feed additives in poultry production has been linked to the presence of antibiotic resistant bacteria in farm workers, consumer poultry products and the environs of confined poultry operations. There are concerns that these resistant bacteria may be transferred to communities near these operations; however, environmental pathways of exposure are not well documented. We assessed the prevalence of antibiotic resistant enterococci and staphylococci in stored poultry litter and flies collected near broiler chicken houses. Drug resistant enterococci and staphylococci were isolated from flies caught near confined poultry feeding operations in the summer of 2006. Susceptibility testing was conducted on isolates using antibiotics selected on the basis of their importance to human medicine and use in poultry production. Resistant isolates were then screened for genetic determinants of antibiotic resistance. A total of 142 enterococcal isolates and 144 staphylococcal isolates from both fly and poultry litter samples were identified. Resistance genes erm(B), erm(A), msr(C), msr(A/B) and mobile genetic elements associated with the conjugative transposon Tn916, were found in isolates recovered from both poultry litter and flies. Erm(B) was the most common resistance gene in enterococci, while erm(A) was the most common in staphylococci. We report that flies collected near broiler poultry operations may be involved in the spread of drug resistant bacteria from these operations and may increase the potential for human exposure to drug resistant bacteria. © 2008 Elsevier B.V. All rights reserved. Keywords: Antibiotic resistance Enterococci Flies Poultry litter Staphylococci 1. Introduction There is growing public health concern over the contribution of agricultural antibiotic use to the global rise of drug resistant bacteria (Erb e t al., 2007 ; Levy and Marshall, 2004). The U.S. raises approximately 8.7 billion broiler chickens annually, resulting in an estimated 13–26 million metric tons of poultry litter (i.e., excreta, feathers, spilled feed, bedding material, soil and dead birds) (Moore et al., 1995; Paudel et al., 2004). Antibiotics are permittedas additivestofeed or waterinthe U.S.(NRC, 1999)and it is estimated that nearly 80% of poultry units in the U.S. use antibiotics in feed (Silbergeld et al., 2008). Poultry litter has been found to contain large amounts of antibiotic resistant bacteria and resistance genes associated with the use of antibiotics in poultry production (Nandi et a l., 2004). This has raised concern for environmental dispersal of antibiotic resistance. In this study, we report for the first time that houseflies may also participate inthe dispersion of antibiotic resistance from poultry houses into the environment. Houseflies have practically unconstrained access to this litter, both through entrance into SCIENCE OF THE TOTAL ENVIRONMENT XX (2009) XXX– XXX Abbreviations: ATCCAmerican Type Culture Collection; CLSIClinical and Laboratory Standards Institute; E.Enterococcus; MICminimum inhibitory concentration; PCRpolymerase chain reaction; ORFopen reading frame; rRNAribosomal ribonucleic acid; S.Staphylococcus. ⁎ Corresponding author. Johns Hopkins Bloomberg School of Public Health, Department of Environmental Health Science s, Division of Environmental Health Engineering, 615 N. Wolfe St., Room E6642, Baltimore, MD 21205, USA. Tel.: +1 443 286 8335; fax: +1 410 955 9334. E-mail address: jgraham@jhsph.edu (J.P. Graham). 0048-9697/$ – see front matter © 2008 Elsevier B.V. All rights reserved. doi:10.1016/j.scitotenv.2008.11.056 available at www.sciencedirect.com www.elsevier.com/locate/scitotenv ARTICLE IN PRESSSTOTEN-11054; No of Pages 10 Please cite this article as: Graham JP et al., Antibiotic resistant enterococci and staphylococci isolated from flies collected near confined poultry feeding operations, Sci Total Environ (2009), doi:10.1016/j.scitotenv.2008.11.056 poultry houses as well as access to poultry waste stored onsite in open sheds. Prior to land application, poultry litter is generally piled between 1 and 4 m deep andstored in open sheds until it is applied to land as a soil amendment. Populations of houseflies are known to be significantly increased within distances of upto 7 km away from poultry operations (Winpisinger et al., 2005). Synanthropic flies have evolved to live in proximity to humans and have been found to carry a number of different pathogenic microorganisms, including viruses and bacteria, and can play an important role in the epidemiology of infections in humans (Likirdopulos et al., 2005; Macovei and Zurek, 2006; Nichols, 2005). Flies have been implicated in the spread of a number of bacterial infections, such as: enteric fever, cholera, shigellosis, salmonellosis, and campylobacteriosis (Fotedar et al., 1992; Nichols, 2005). There is recent concern that flies may also contribute to the spread of avian influenza. A study in Denmark found that as many as 30,000 flies may enter a broiler facility during a single flock rotation in the summer months (Hald et al., 2004). In Japan, researchers reported that flies captured in proximity to broiler facilities during an outbreak of highly pathogenic avian influenza in Kyoto, Japan in 2004, were found to carry the same strains of H5N1 influenzavirus as found in the chickens of the infected poultry farm (Sawabe et al., 2006). The pathway of transfer is likely to occur as flies feed on excreta and decomposing carcasses, which results in ingestion of the bacteria or surface contamination of their feet, legs, proboscis, and wings. The flies can then mechanically transmit micro- organisms through physical contact or may defecate or regurgitate bacteria from the gut onto food or other fomites (Nichols, 2005). The quantity and type of microorganisms flies carry are inextricably linked to the presence of these same organisms in the excreta and other wastes upon which flies develop and feed (Nichols, 2005). The design and operational requirements of large scale broiler poultry production result in many obstacles to biocon- tainment (i.e., efforts to limit the dissemination of microbes from operations) (Graham et al., 2008). Ventilation rates from these houses are very high, owing to the need to prevent overheating for the 20–75,000 birds confined to a single house. Further, owing to methods of waste storage at farms, there is a large amount of fresh and stored poultry litter available outside the houses, which can serve also as a substrate for development of fly populations and a readily available source of food. Because antibiotic resistant enterococci and staphylococci have been isolated from poultry litter (Hayes et al., 2004; Lu et al., 2003; Simjee et al., 2007), we tested the hypothesis that flies may transfer these resistant pathogens, as well as resistance determinants, into the environment of local com- munities. This mode of inter-ecosystem spread has not been previously investigated. The current study is the first to assess resistance pheno- types and resistance genes in Enterococcus spp. and Staphylo- coccus spp. in both litter and flies collected near U.S. confined poultry feeding operations. 2. Methods Sampling was carried out on the Delmarva Peninsula of the United States (region comprising parts of Delaware, Maryland, and Virginia), one of the most heavily concentrated areas of U.S. poultry production (Fig. 1), producing nearly 600 million chick- ens each year (nearly 7% of U.S. production). It is also an area experiencing rapid development and increased human popula- tion density.Sussex County, Delaware, wherenearly 300 million chickens were produced last year, experienced a 15% increase in its human population between 2000 and 2006 (Delaware Population Consortium, 2002). 2.1. Poultry litter collection Poultry litter samples were collected from three conventional poultry farms that raised the birds under contract for two major producers. Litter samples were collected from three conventional broiler chicken farms over a period of 120 days (collected at Days: 0, 10, 20, 30, 60, 90, 120) in the summer of 2006. The first sampling visit at each farm occurred after the chickens were removed for processing, at which time the houses were decrusted, that is, removing the top 25–50 cm of poultry litter from the poultry house floor. This waste material was stored on-site in one large pile between 1 to 3 m high in a two-walled shed with a roof. No additional litter was added during the study period, nor were any chemicals added. A composite sample of four grab samples (~1 kg) from each litter pile was aseptically collected at each visit and placed in sealed plastic bags for transport in a cooler with ice to the laboratory. Samples were analyzed within 24 h of collection. All three farmers reported that no recognized disease outbreaks had occurred during the flock cycle such that no therapeutic drug use was applied, but no specific information on antibiotic feed additives was available as this is considered confidential business information by the producers (Graham et al., 2007). Each poultry litter sample was mixed in the sealed plastic bag by vigorously agitating the bag by hand for 1 min. Five grams of litter were then placed in 45 ml of 0.1% peptone water in a sterile 50 ml polypropylene conical tube, and vortexed for 1 min (Islam et al., 2004). The sample was allowed to settle for 15 min. Three serial dilutions (1:10) were prepared from each sample using 0.1% peptone water, and 0.1 ml portions of each dilution were plated in triplicate onto standard BBL Enter- ococcosel agar (Becton Dickinson, Cockeysville, MD, USA) and Staphylococcus agar (US Biological, Swampscott, MA, USA). Samples were plated on agar supplemented with antibiotics at break point concentrations described below. Samples were incubated for 24 h at 37 °C, and unique black enterococcal and yellow/white staphylococcal colonies were selected. Isolates were purified twice on the same medium on which they were isolated. All isolates were stored in a 20% glycerol tryptic soy broth at − 80 °C until testing for antibiotic susceptibility. 2.2. Fly collection and bacterial isolation Flies were caught using Victor Fly Magnet ® Traps at the same time period as when the last poultry litter samples were collected (i.e., day 120). A total of eight fly traps were set in accessible locations within 15–100 m of poultry farms, and placed approximately 2 m off the ground. Although the fly traps were not set near the farms where litter samples were collected, we hypothesized that similar resistance patterns among the fly and litter isolates would be observed. The traps were collected 2 SCIENCE OF THE TOTAL ENVIRONMENT XX (2009) XXX– XXX ARTICLE IN PRESS Please cite this article as: Graham JP et al., Antibiotic resistant enterococci and staphylococci isolated from flies collected near confined poultry feeding operations, Sci Total Environ (2009), doi:10.1016/j.scitotenv.2008.11.056 Fig. 1 – Map of study area (Delmarva Peninsula) with sample locations and resistance genes or mobile genetic elements recovered from bacterial isolates. The exact location of farms was not provided in order to maintain farmer anonymity. 3SCIENCE OF THE TOTAL ENVIRONMENT XX (2009) XXX– XXX ARTICLE IN PRESS Please cite this article as: Graham JP et al., Antibiotic resistant enterococci and staphylococci isolated from flies collected near confined poultry feeding operations, Sci Total Environ (2009), doi:10.1016/j.scitotenv.2008.11.056 36 h after set up, and transported to the laboratory and stored at 4 °C. Flies caught in each trap were treated as one composite sample because of likely contact and mixing, and were analyzed within 24 h of collection. An external wash of the flies was carried out as follows: flies were placed into a plastic tube with 50 ml of eluting buffer, consisting of 0.1% Tween80, 0.1% sodium dodecyl sulfate, 0.001% anti-foam, and phosphate-buffered saline, and then gently vortexed for 1 min (Graczyk et al., 1999). One ml of the eluant was then aseptically transferred in a 15 ml plastic tube with 10 ml of tryptic soy broth for a 24 h enrichment. Following this exterior wash, a homogenized sample of the flies (i.e., internalized bacteria) was made as follows: flies from each trap were placed together in an Eppendorf tube (BWR, Piscataway, NJ) with 50 ml of phos- phate-buffered saline and were macerated with a glass rod for 1 min. One ml of the homogenate was then enriched as described above. Following the enrichment, 0.1 ml portions of the enriched samples were plated onto standard BBL Enter- ococcosel agar (Becton Dickinson, Cockeysville, MD, USA) and Staphylococcus agar (US Biological, Swampscott, MA, USA). 2.3. Isolation of antibiotic resistant bacteria Samples of the enrichment media were plated on agar supple- mented with selected antibiotics in order to increase the like- lihood of detecting resistant enterococci and staphylococci Table 1 – List of positive controls and DNA oligonucleotides used as primers in PCR reactions Genus/species (single/ multiplex PCR) Positive control Direction Sequence (5′–3′) Annealing temp (°C) Product size (bp) Reference Enterococci a F TCAACCGGGGAGGGT 60 733 Deasy et al. (2000)R ATTACTAGCGATTCCGG E. faecalis a ATCC 29212 F TCAAGTACAGTTAGTCTTTATTAG 54 941 Dutka-Malen et al. (1995)R ACGATTCAAAGCTAACTGAATCAGT E. faecium a ATCC 19434 F TTGAGGCAGACCAGATTGACG 54 658 Dutka-Malen et al. (1995)R TATGACAGCGACTCCGATTCC E. casseliflavus a ATCC 49605 F CGGGGAAGATGGCAGTAT 54 484 Kariyama et al. (2000)R CGCAGGGACGGTGATTTT E. gallinarum a ATCC 700425 F GGTATCAAGGAAACCTC 54 822 Kariyama et al. (2000)R CTTCCGCCATCATAGCT Staphylococci F GGCCGTGTTGAACGTGGTCAAATCA 55 370 Morot-Bizot et al. (2004)R TIACCATTTCAGTACCTTCTGGTAA S. aureus ATCC 43300 F AATCTTTGTCGGTACACGATATTCTTCACG 55 108 Morot-Bizot et al. (2004)R CGTAATGAGATTTCAGTAGATAATACAACA S. xylosus ATCC 29971 F AACGCGCAACGTGATAAAATTAATG 55 539 Morot-Bizot et al. (2004)R AACGCGCAACAGCAATTACG S. epidermidis ATCC 49461 F ATCAAAAAGTTGGCGAACCTTTTCA 55 124 Morot-Bizot et al. (2004)R CAAAAGAGCGTGGAGAAAAGTATCA S. saprophyticus ATCC 49453 F TCAAAAAGTTTTCTAAAAAATTTAC 55 221 Morot-Bizot et al. (2004)R ACGGGCGTCCACAAAATCAATAGGA a Multiplex PCR was used for all of the Enterococci primers. Table 2 – List of PCR primers used in the amplification of resistance genes in isolates of enterococci and staphylococci Resistance gene/ determinant GenBank access. no Direction Primer sequence (5′–3′) Annealing temp (°C) Product size (bp) Reference erm(A) K02987 F TCAAAGCCTGTCGGAATTGG 52 441 Jensen et al. (2002)R AAGCGGTAAACCCCTCTGAG erm(B) AF406971 F GAAAAGGTACTCAACCAAATA 52 639 Sutcliffe et al. (1996)R AGTAACGGTACTTAAATTGTTTAC erm(C) J01755 F ATCTTTGAAATCGGCTCAGG 52 294 Sutcliffe et al. (1996)R CAAACCCGTATTCCACGATT vat(D) L12033 F GCTCAATAGGACCAGGTGTA 52 271 Soltani et al. (2000)R TCCAGCTAACATGTATGGCG vat(E) AF139725 F ACTATACCTGACGCAAATGC 52 511 Soltani et al. (2000)R GGTTCAAATCTTGGTCCG msr(C) AF13494 F TAT AAC AAA CCT GCA AGT TC 55 1,040 McDermott et al. (2005)R CTT CAA TTA GTC GAT CCA TA msr(A/B) AJ243209 F GCAAATGGTGTAGGTAAGACAACT 55 350 Wondrack et al. (1996)R ATCATGTGATGTAAACAAAAT int (Tn916/Tn1545) NC006372 F GCGTGATTGTATCTCACT 50 1,046 Macovei and Zurek (2006)R GACGCTCCTGTTGCTTCT ORF13 (Tn916) NC006372 F GGCTGTCGCTGTAGGATAGAG 50 589 Macovei and Zurek (2006)R GGGTACTTTTAGGGCTTAGT 4 SCIENCE OF THE TOTAL ENVIRONMENT XX (2009) XXX– XXX ARTICLE IN PRESS Please cite this article as: Graham JP et al., Antibiotic resistant enterococci and staphylococci isolated from flies collected near confined poultry feeding operations, Sci Total Environ (2009), doi:10.1016/j.scitotenv.2008.11.056 strains among an expected mix of resistant and susceptible strains within the litter sample. All but one of the following antibiotics (i.e. vancomycin) or similar analogs were selected based on their reported use in poultry production and added to agar (concentrations added to enterococcosel a nd staphylococcus agar are indicated respectively): ciprofloxacin (2 μg/ml, 2 μg/ml), clindamycin (1 μg/ml, 2 μg/ml), tetracycline (8 μg/ml, 8 μg/ml), vancomycin (16 μg/ml, 1 6 μg/ml), erythromycin (4 μg/ml, 4 μg/ml), quinupristin-dalfopristin (2 μg/ml, 2 μg/ml), penicillin (8 μg/ml, 0.125 μg/ml), and g entamicin ( 500 μg/ml in enterococcosel only). Samples were incubated for 24 h a t 37 °C, and representative unique colonies based on colony morpholog y were se lected. Isolates were purified and stored as described previously. The antibiotic quinupristin-dalfopristin is an analog of v irginiamycin, an antibiotic used in poult ry production. Both qui nupristin- dalfopristin and v irginiamycin are i n the sam e class o f antibiotics. Table 3 – Characteristics of samples of flies and stored poultry litter Fly samples Number of flies Distance in meters/ direction from nearest poultry farm Number of enterococcal isolates characterized Number of staphylococcal isolates characterized MDR enterococci =2 drugs ≥ 3 drugs MDR staphylococci =2 drugs ≥ 3 drugs Trap 1 3 60 m 1 4 + − Southeast −− Trap 2 28 100 m 8 4 + + East + − Trap 3 6 30 m 3 4 + + South ++ Trap 4 8 20 m 2 3 + − Southeast −− Trap 5 7 15 m 3 4 + − Southeast −− Trap 6 28 50 m 7 1 + − Southeast + − Trap 7 140 100 m 12 5 + + South + − Trap 8 42 30 m 0 4 −− Southeast −− Poultry litter samples Number of samples Number of enterococcal isolates characterized Number of staphylococcal isolates characterized MDR enterococci =2 drugs ≥ 3 drugs MDR staphylococci =2 drugs ≥ 3 drugs Farm A 7 36 35 + + ++ Farm B 5 25 30 + + ++ Farm C 7 45 50 + + ++ Fig. 2 – Percent of recovered enterococcal isolates phenotypically resistant to antibiotics. Multi-drug resistance (MDR) indicates resistance to two or more drugs. (cip – ciprofloxacin; clin – clindamycin; ery – erythromycin; pen – penicillin; q-d – quinupristin- dalfopristin; tet – tetracycline; van – vancomycin; MDR – multi-drug resistant). 5SCIENCE OF THE TOTAL ENVIRONMENT XX (2009) XXX– XXX ARTICLE IN PRESS Please cite this article as: Graham JP et al., Antibiotic resistant enterococci and staphylococci isolated from flies collected near confined poultry feeding operations, Sci Total Environ (2009), doi:10.1016/j.scitotenv.2008.11.056 2.4. Species identification PCR was used to confirm the identities of the isolates to the genus level (Table 1). Single PCR and Multiplex PCR were used to identify four common species of enterococci (E. faecium, E. faecalis, E. gallinarum, and E. casseliflavus) and four common species of staphylococci (S. aureus, S. xylosus, S. saprophyticus, and S. epidermidis). ATCC strains used as positive controls and primer sequences are provided in Table 1. 2.5. Antibiotic resistance screening Phenotypic antibiotic resistance was defined by minimal inhibitory concentrations (MICs) which were determined using the agar dilution method on Mueller–Hinton agar (Becton Dickinson, Massachusetts) using Enterococcus faecalis ATCC 29212, Enterococcus faeciumATCC 19434, and Staphylococcus aureus ATCC 43300 strains according to CLSI guidelines (CLSI, 2005). The dilution ranges in μg/ml and resistance breakpoints were as follows (note: breakpoints for enterococci and staphylococci are the same unless otherwise stated): ciprofloxacin (0.12–8, 4), clindamycin (0.5–8, 2 for enterococci and 4 for staphylococci), tetracycline (1–32, 16), v a ncomycin (0.5–64, 3 2 for ente rococci and 16 for staphylococci), erythromycin (0.13–16, 8), quinupristin- dalfopristin (0.025–8, 4), penicillin (0.5–32, 16 for enterococci and 0.25 for staphylococci), and gentamicin (500–1000, 500 for enterococci). For staphylococci, no CLSI breakpoints have been establish ed for a number of drugs ( e.g. clindamycin , penicillin or vancomycin) and breakpoints as described by Aarestrup et al. (2000) wereused. When s trains of identical species from t he same farm having similar antibiograms (i.e. within two d ilutions) were found, only one isolate was used for the analysis – this was done to ensure that t he same i solate was not counted more than once. 2.6. Screening for resistance genes For each isolate exhibiting phenotypic resistance to eryth- romycin, quinupristin-dalfopristin, or tetracycline, the bacteria were harvested and cell walls were digested with lysozyme and proteins were subsequently digested with proteinase k and sodium dodecyl sulfate. DNA was isolated using a phenol-chloroform extraction and isopropyl alcohol precipitation method (Sutcliffe et al., 1996) and was quantified using a NanoDrop ® ND-1000 UV–V is Spectrophotometer (Wilmington, DE, USA). Each DNA sample was standardized to a final concentration of 20 ng/μl. Single PCR was used to screen isolat es that were phenotypically resistant to macrolides, lincosamides, tetracyclines, or streptogramins. Detection of the rRNA methylase genes (erm(A), erm(B), erm(C)), the acetyl transferase genes (vat(D) and vat(E)) , and the ABC porter genes (msr(A/B)and ms r(C)) was carried out using primers and PCR conditions previously described (Table 2). The PCR assay mix (total volume of 12.5 μl) included 1 U Takara Taq HotStart DNA Polymerase and 10X PCR Buffer (Takara Bio Inc, Otsu,Shiga,Japan),0.5μM of ea ch p rimer, 200 μMofeachdNTP and 40 ng of genomic DNA (i.e. 2 μl of sample). Most resistance genes were amplified with an initial denaturing cycle at 95 °C for 5 min followed by 25 cycles of 94 °C for 45 s, 52 °C for 45 s, and 72 °C for 1 min, with a final extension step at 72 °C for 10 min. Genes, msr(C) and msr(A/B) were amplified under different conditions: an initial denaturing cycle at 95 °C for 5 min was followed by 25 cycles of 93 °C for 30 s, 55 °C for 2 min, and 72 °C for 1.5 min, with a final extension step at 72 °C for 10 min. PCR products were run on a 2% agarose gel. The class 1 integrase gene was used for detection of the Tn916/Tn 1545 conjugative transposon family and the open reading frame gene (ORF1 3) was used for specific detection of Tn916 (Macovei and Zurek, 2006). 3. Results Trapped flies were identified as members of Muscidae (house- flies) and Calliphoridae (blow flies and bottle flies) families. The number of flies and number of bacterial isolates recovered varied across the traps shown in Table 3. Fig. 3 – Percent of recovered staphylococcal isolates phenotypically resistant to antibiotics. Multi-drug resistance (MDR) indicates resistance to two more drugs. Only antibiotics with CLSI established breakpoints are presented. (cip – ciprofloxacin; ery – erythromycin; q-d – quinupristin-dalfopristin; tet – tetracycline; MDR – multi-drug resistant). 6 SCIENCE OF THE TOTAL ENVIRONMENT XX (2009) XXX– XXX ARTICLE IN PRESS Please cite this article as: Graham JP et al., Antibiotic resistant enterococci and staphylococci isolated from flies collected near confined poultry feeding operations, Sci Total Environ (2009), doi:10.1016/j.scitotenv.2008.11.056 Resistant enterococci and staphylococci persisted in the litter piles throughout the 120 da y study period. However, resistant enterocococci were isolated at fewer farms at later sampling events. For example, resistance to four drug s was not observed in enterococc i after day 60. T his was not the case, however, for staphylococci, where drug resistance to more than three drugs was observed from samples collected at day 120. After removing duplicate isolates (described in Met hods), a total of 106 enterococcal and 115 staphylococcal isolates were characterized from poultry litter samples, while 36 enterococcal and 29 staphylococcal isolates were characterized from fly samples. In both the fly and poult ry litter samples, Enterococcus faecalis represented the majority of the enterococcal species (70% in litter and 87% in flies). Most staphylococcal isolates did not correspond to the species primers in our study (Table 1) and were characterized to th e genus level only, with the exception of s even isolates of S. xylosus, five isolates of S. epidermidis, and three isolates of S. aureus. Approximately two-thirds of staphylococci and enterococci isolated from flies were o btained from the ho- mogenized samples (i.e., internalized bacter ia), and approxi- mately one-third were obtained from exterior washes. The results of resistance testing are shown in Figs. 2 and 3 (note: isolates were recovered from both antibiotic-amended and non-amended plates). Resistance to clindamycin was the most common resistance phenotype in enterococcal isolates Table 4 – Characteristics of individual isolates positive for resistance genes and/or mobile genetic elements Genus/species Sample location Phenotypic resistance a Mobile element Resistance genes Enterococcus faecium Farm C clin r , ery r , q-d r , tet r Tn916 erm(B) Farm C clin r , ery r erm(B) Farm C clin r , ery r , q-d r erm(B), vat(E), msr(C) Farm C clin r , ery r , pen r , q-d r erm(A) Farm C clin r , ery r , q-d r , tet r Tn916 Farm C clin r , tet r msr(C) Trap 2 clin r , ery r , q-d r Tn916 Trap 3 clin r , ery r , q-d r , tet r erm(B) Trap 6 clin r , tet r Tn916 msr(C) Trap 7 clin r , q-d r , tet r Tn916 msr(C) Enterococcus faecalis Farm A clin r , ery r , q-d r , tet r Tn916 erm(B) Farm B clin r , ery r , q-d r erm(B) Farm B clin r , ery r , q-d r , tet r Tn916 erm(B) Farm A clin r , tet r Tn916 Farm A clin r , ery r , q-d r , tet r Tn916 erm(B) Farm B clin r , ery r , q-d r erm(B) Farm C clin r , ery r , tet r Tn916 erm(B) Farm A clin r , ery r , q-d r , tet r Tn916 erm(B) Farm C clin r , q-d r Tn916 erm(B) Trap 1 clin r , q-d r erm(B) Trap 2 clin r , q-d r erm(B) Trap 2 clin r , ery r , q-d r , tet r erm(B) Trap 2 clin r , ery r , q-d r , tet r Tn916 erm(B) Trap 3 clin r , ery r , q-d r , tet r erm(B) Trap 6 clin r , pen r , tet r Tn916 erm(B) Trap 6 clin r , ery r , q-d r , tet r erm(B) Trap 7 clin r , ery r , q-d r erm(B) Trap 7 clin r , q-d r , tet r Tn916 Trap 7 clin r , ery r , q-d r , tet r Tn916 erm(B) Trap 7 clin r , ery r , q-d r , tet r Tn916 erm(B) Staphylococcus spp. Farm A ery r , tet r erm(A) Farm B ery r msr(A/B) Farm B clin r , ery r erm(A), erm(C) Farm B ery r erm(A) Farm B ery r , tet r erm(A) Farm C ery r msr(A/B) Farm C ery r erm(A), msr(A/B) Farm A ery r msr(A/B) Farm C q-d r erm(A) Trap 5 ery r msr(A/B) Note: only isolates exhibiting phenotypic resistance to erythromycin, quinupristin-dalfopristin, or tetracycline were screened for resistance genes. a Phenotypic resistance: e ry r – erythromycin resistant; q-d r – quinupristin-dalfopristin resistant; tet r – tetracycline resistant; clin r – clindamycin resistant; pen r – penicillin res istant. 7SCIENCE OF THE TOTAL ENVIRONMENT XX (2009) XXX– XXX ARTICLE IN PRESS Please cite this article as: Graham JP et al., Antibiotic resistant enterococci and staphylococci isolated from flies collected near confined poultry feeding operations, Sci Total Environ (2009), doi:10.1016/j.scitotenv.2008.11.056 from both fly and poultry litter samples. Resistance to the lincosamide class of antibiotics (which includes clindamycin) has been reported to be an intrinsic trait that is relatively common in E. faecalis (Hayes et al., 2004). Among the enterococcal isolates recovered from flies, resistance was more common for quinupristin-dalfopristin (94%), erythromy- cin (42%) and tetracycline (39%) than in isolates of poultry litter origin (Fig. 2). Very little resistance to penicillin and ciprofloxacin was observed for enterococcal isolates from either flies or litter ( Fig. 2). Further, no enterococcal isolates were found to be resistant to vancomycin. In staphylococcal isolates, phenotypic resistance to ery- thromycin was relatively more common in litter isolates (57%) than in isolates from flies (19%). The percentage of staphylo- coccal isolates resistant to quinupristin-dalfopristin and tetracycline was also higher in litter (30%) as compared to flies (10%). There are no established breakpoints for clinda- mycin and penicillin; however, approximately 90% of isolates from either flies or litter had an MIC value of less than 0.25 μg/ ml. One staphylococcal isolate from poultry litter exhibited high level resistance to vancomycin (64 μg/ml). Erm(B) was the resistance gene most commonly found in enterococci in both flies and poultry litter isolates (Table 4). Isolates found to carry erm(B) were also likely to be resistant to quinupristin-dalfopristin, erythromycin and clindamycin. This gene alters a site in 23S rRNA common to the binding of macrolides, lincosamides and streptogramin B antibiotics (Sutcliffe et al., 1996). The enterococcal gene, msr(C) was observed in two isolates from poultry litter and two i solates from fly samples. The nearly homologous staphylococcal gene, msr(A /B), was observed in four isolates from poultry litter and one isolate from fly samples. The msr genes encode an ABC porter for macrolide and streptogramin B antibiotics. The ORF13 gene, which is associated with the conjugative transposon Tn916, was found in nine enterococcal isolates from poultry litter and eight from fly isolates; Tn916 repre- sents a family of transposons commonly found to transfer antibiotic resistance genes. The combination of ORF13 gene and int gene, associated with Tn1545/916, were recovered from four enterococcal isolates from poultry litter and six from fly isolates, all of which also contained the erm(B) gene (Table 4). Two fly isolates from traps 6 and 7 placed in proximity, also contained the msr(C) gene in combination with Tn916. The percentage of phenotypically resistant enterococcal isolates – resistant to erythromycin, quinupristin-dalfopristin, or tetracycline – positive for resistance determinants was nearly identical among fly and poultry litter isolates (Fig. 4). 4. Discussion This study strongly suggests that flies in intensive poultry production areas, such as the Delmarva Peninsula, can disperse antibiotic resistant bacteria in their digestive tracts and on their exterior surfaces. Dispersion of resistant bacteria from poultry farms by flies could contribute to human exposures, although at present it is difficult to quantify the contribution of flies. Flies may also transfer bacteria from fields amended with poultry waste. Fly populations have been found to be higher near poultry farms as compared to nearby rural settings (Winpisinger et al., 2005). Although individual flies can travel as far as 20 miles, the majority of the species found in traps in this study generally do not travel more than 2 miles and their movement is oriented toward readily available food sources (Graczyk et al., 1999; Sawabe et al., 2006). Six of the eight classes of antibiotics screened in this study [penicillin, tetracyclines, macrolides, lincosamides, aminogly- cosides, and streptogramins] are used in poultry production, while fluoroquinolones were used until 2005 (Florini et al., 2005; Price et al., 2007). All of these drugs are categorized by the U.S. Food and Drug Administration as critically or highly important to human medicine (USFDA, 2003). Staphylococcal Fig. 4 – Percentage of enterococci isolates (phenotypically resistant to either erythromycin, quinupristin-dalfopristin, or tetracycline) positive for resistance determinants. 8 SCIENCE OF THE TOTAL ENVIRONMENT XX (2009) XXX– XXX ARTICLE IN PRESS Please cite this article as: Graham JP et al., Antibiotic resistant enterococci and staphylococci isolated from flies collected near confined poultry feeding operations, Sci Total Environ (2009), doi:10.1016/j.scitotenv.2008.11.056 infections are often treated with penicillins, macrolides, lincosamide, aminoglycosides, and streptogramins, while enterococcal infections are usually treated with penicillins, aminoglycosides, tetracyclines and streptogramins (Bartlett et al., 2005). Of concern, streptogramins, which have been used in animal husbandry for near ly 30 years, were recently approved for treating patients with vancomycin resistant E. faecium or methicillin-resistant Staphylococcus aureus ( Jensen et al., 2002; McDermott et al., 2005). Enterococci resistance to streptogramins (quinupristin- dalfopristin), were found in both litter and flies. Quinupristin- dalfopristin resistant enterococci in our study commonly had erm (A) and erm(B) resistance genes. Streptogramin A (i.e. dalfopristin) resistance in E. faecium, isolated from the poultry environment, has been found to be highly associated with the vat(E) gene, while Streptogramin B (i.e. quinupristin) resistance has been linked to the erm(B) gene (Jensen et al., 2002). The emergence of streptogramin-resistant E. faecium,associatedwiththeerm genes conferring resistance to streptogramin B ,andvat genes conferring high-level resistance to streptogramin A , is a serious public health concern, and is thought to be a consequence of the use of virginiamycin for growth promotion over the past 30 years (Smith et al., 2003). The absence of vancomycin resistant enterococci in our study was not a surprise, given that vancomycin has never been approved for use in U.S food animal production. In contrast, vancomycin resistant enterococci have been frequently reported in European studies, where avoparcin (an analog of vancomycin) was used in animal feeds until 1997 (Aarestrup et al., 2001). It was surprising, however that we cultured one staphylococcal isolate from the poultry litter that exhibited high-level resistance to vancomycin (N 64 μg/ml). Most conjugative transposons of the Tn916 family encode resistance to tetracycline or minocycline a lone, and tetracy cline resistance is now relatively common. Although increased prevalence o f resistance and the availability of a variety of other broadly active antibiotics have reduced the importance of tetracycline as a therapeutic alternative, it remains a first- and second-line t reatment for many urogenit al infecti ons (Rice, 1 998). The clustering of resistance genes on the same t ransposable elements can affect the persistence o f antibiotic re sistance, such that elimina ting only one an tibioti c may not reduce t he pre- valence o f the cluster. The er m(B) gene, for example, i s c ommonly linked with Tn154 5/Tn 916, w hich encodes tetracycline resistance and predominates i n clinically i mportant Gram-positive ba cteria (Clewe ll et al., 1995; Rice, 1998). The continued dissemination of mobile genetic elements that have broad host-range, such as Tn916 family, which includes Tn 1545, in the microbial environ- ment is a serious problem. One o f t he li mitations of this study is that a small number of sampling sites were used and fly and litter samples were not collected from the same sites. This may account for the differences observed between the p henotypic resi stance patte rns of is olates from flies and litter. However, be cause flies can travel as much as 20 miles, it is not possible to ascertain associ- ations between a specific sample of flies and a specific farm. An additional l imitation was the limited c oagulase-negative Staphylococcus species characterized in the analyses. Other species, such as S. sciuri, S. lentus,andS. simulans would have been likely candidates, as s hown by Sim jee et al. (2007) in a study of poultry litter in Georgia. Additionally , no control sites were used. A proper control s ite would have been difficult to define in this setting as poultry production occurs throughout the Delmarva Peninsula, as well as land amendment with poultry wastes, and flies can potentially travel long distances. Another limitation w as that we could not obta in data on antibiotic use at any of the farms sampled since this information is not publicly available in the U.S. (Mellon et al., 2001). There is a lack of definitive i nformation on the overallv olume of antibiotics used as feed additives, and there are obstacles to this information since feed formulations are considered confidential b usiness informa- tion under U.S. law. Nonetheless, our data are consistent with studies highlighting the prevalence of resistant enterococci and staphylococci in the poultry environment (Hayes et al., 2004; Lu et al., 2003). 5. Conclusions The results of this study illustrate the persistence of resistant bacteria in the environment, and highlight the reservoir of resistance associated with the use of antibiotics as a feed additive in poultry production. Further, the carriage of antibiotic resistant enteric bacteria by flies in the poultry production environment increases the potential for human exposure to drug resistant bacteria. Acknowledgements Support for this research was received from the Center for a Livable Future at the Johns Hopkins Bloomberg School of Public Health. We would also like to thank Dr. Macovei, Dr. Jensen, Dr. McDermott, and Patti Cullen for providing control strains used in our analysis. REFERENCES Aarestrup FM, Agerso Y,Ahrens P, Jogensen J, Madsen M, Jensen LB. Antimicrobial susceptibility and presence of resistance genes in staphylococci from poultry. Vet Microbiol 2000;74:353–64. Aarestrup FM, Seyfarth A, Emborg HD, Pedersen K, Hendriksen R, Bager F. Effect of abolishment of the use of antimicrobial agents for growth promotion on occurrence of antimicrobial resistance in fecal enterococci from food animals in Denmark. Antimicrob Agents Chemother 2001;45:2054–9. Bartlett JG, Auwaerter PG, Pham PA. The ABX g uide diagnosis & treatment of infectious diseases. Montvale, NJ: Thomson PDR; 2005. Clewell D, Flannagan S, Jaworski D. Unconstrained bacterial promiscuity: the Tn916-Tn1545 family of conjugative transposons. Trends in Microbiol 1995;3:229–36. CLSI. Performance standards for antimicrobial susceptibility testing.15th informational supplement. Wayne, PA: Clinical and Laboratory Standards Institute; 2005. M100-S15. Delaware Population Consortium. Annual projections; 2002. http:// stateplanning.delaware.gov/information/dpc_projections.shtml [accessed 9 June 2008]. Deasy BM, Rea MC, Fitzgerald GF, Cogan TM, Ber esfor d TP. A rapid PCR based m ethod to distingu ish between Lactococcus and Enterococcus. Syst Appl Microbiol 2000;23:510–22. 9SCIENCE OF THE TOTAL ENVIRONMENT XX (2009) XXX– XXX ARTICLE IN PRESS Please cite this article as: Graham JP et al., Antibiotic resistant enterococci and staphylococci isolated from flies collected near confined poultry feeding operations, Sci Total Environ (2009), doi:10.1016/j.scitotenv.2008.11.056 Dutka-Malen S, Evers S, Courvalin P. Detection of glycopeptide resistance genotypes and identification to the species level of clinically relevant enterococci by PCR.J Clin Microbiol 1995;33:24–7. Erb A, Sturmer T, Marre R, Brenner H. Prevalence of antibiotic resistance in Escherichia coli: overview of geographical, temporal, and methodological variations. Eur J Clin Microbiol Infect Dis 2007;26:83–90. Florini K, Denison R, Stiffler T, Fitzgerald T, Goldburg R. Resistant bugs and antibiotic drugs. Washington, DC: Environmental Defense; 2005. Fotedar R, Banerjee U, Singeh S, Shriniwas SL, Verma AK. The housefly (Musca domestica) as a carrier of pathogenic micro- organisms in a hospital environment. J Hosp Infect 1992;20:209–15. Graczyk T , Cr anf ield M, Fayer R, B ixler H . House flies (Mus ca domestica) as transport hosts of Cryptosporidium parvum. Am J Trop Med Hyg 1999;61:500–4. Graham JP, Boland JJ, Silbergeld EK. Growth promoting antibiotics in food animal production: an economic analysis. Public Health Rep 2007;122:79–87. Graham JP, Tuchmann JL, Price LB, Otte JM, Pfeiffer DU, Tiensin T, et al. The animal-human interface and infectious disease in industrial food animal production: rethinking biosecurity and biocontainment. Public Health Rep 2008;123:282–99. Hald B, Skovgard H, Bang D, Pedersen K, Dybdahl J, Jespersen J, et al. Flies and Campylobacter infection of broiler flocks. Emerg Infect Dis 2004;10:1490–2. Hayes JR, English L, Carr LE, Wagner DD, Joseph SW. Multiple-antibiotic resistance of Enterococcus spp. isolated from commercial p oultry production environments. Appl Environ Microbiol 2004;70:6005–11. Islam M, Jennie M, Doyle MP, Sharad PC, Millner P, Jiang X. Persistence of Salmonella enterica serovar Typhimurium on lettuce and parsley and in soils on which they were grown in fields treated with contaminated manure composts or irrigation water. Foodborne Pathog Dis 2004;1:27–35. Jensen LB, Hammerum AM, Bager F, Aarestrup FM. Streptogramin resistance among Enterococcus faecium isolated from production animals in Denmark in 1997. Microb Drug Resist 2002;8:369–74. Kariyama R, Mitsuhata R, Chow JW, Clewell DB, Kumon H. Simple and reliable multiplex PCR assay for surveillance isolates of vancomycin-resistant enterococci. J Clin Microbiol 2000;38:3092–5. Levy S, Marshall B. Antibacterial resistance worldwide: causes, challenges and responses. Nature Med 2004;10:122–9. Likirdopulos CA, Simmons OD, Watson DW, Sobsey MD. Collection methods for evaluating microbial indicator concentrations of houseflies (Musca domestica) on swine farms in Eastern North Carolina. Animal Waste Management Symposium; 2005. Lu J, Sanchez S, Hofacre C, Maurer JJ, Harmon BG, Lee MD. Evaluation of broiler litter with reference to the microbial composition as assessed by using 16S rRNA and functional gene markers. Appl Environ Microbiol 2003;69:901–8. Macovei L, Zurek L. Ecology of antibiotic resistance genes: characterization of enterococci from houseflies collected in food settings. Appl Environ Microbiol 2006;72:4028–35. McDermott P, Cullen P, Hubert SK, McDermott SD, Bartholomew M, Simjee S, et al. Changes in antimicrobial susceptibility of native Enterococcus faecium in chickens fed virginiamycin. Appl Environ Microbiol 2005;71:4986 –91. Mellon M, Benbrook C, Benb rook KL. Hogging it: estimates of antimicrobial a buse in liv estock. Cambridge: U CS P ublications; 2001. Moore PA, Daniel TC, Sharpley AN, Wood CW. Poultry manure management: environmentally sound options. J Soil Water Conserv 1995;50:321–7. Morot-Bizot S, Talon R, Leroy S. Development of a multiplex PCR for the i dentification of Staphylococcus genus and four staphylococcal species isolated from food. J Appl Microbiol 2004;97:1087–94. Nandi S, Maurer JJ, Hofacre C, Summers AO. Gram-positive bacteria are a major reservoir of Class 1 antibiotic resistance integrons in poultry litter. Proc Natl Acad Sci U S A 2004;101:7118–22. Nichols GL. Fly transmission of Campylobacter. Emerg Infect Dis 2005;11:361–4. NRC (National Research Council). The use of drugs in food animals: benefits and risks. Washington DC: National Academy Press; 1999. Paudel KP, Adhikari M, Martin NR. Evaluation of broiler litter transportation in northern Alabama, USA. J Environ Manage 2004;73:15–23. Price LB, Roess A, Graham JP, Baqar S, Vailes R, Sheikh KA, et al. Neurologic symptoms and neuropathologic antibodies in poultry workers exposed to Campylobacter jejuni. J Occup Environ Med 2007;49:748–55. Rice L. Tn916 family conjugative transposons and dissemination of antimicrobial resistance determinants. Antimicrob Agents Chemother 1998;42:1871–7. Sawabe K, Hoshino K, Isawa H, Sasaki T, Hayashi T, Tsuda Y, et al. Detection and isolation of highly pathogenic H5N1 Avian Influenza A viruses from blow flies collected in the vicinity of an infected poultry farm in Kyoto, Japan, 2004. Am J Trop Med Hyg 2006;75:327–32. Silbergeld EK, Graham JP, Price LB. Industrial food animal production, antimicrobial resistance, and human health. Annu Rev Public Health 2008;29:151–69. Simjee S, M cDe rm ott PF, White DG, Hofacre C, Ber ghau s R D, Carter PH, et al. Antimicrobial susceptibility and distribution of antimicrobial-resistance genes among Enterococcus and coagulase-negative Staphylococcus isolates recovered from poultry litter. Avian Dis 2007;51:884–92. Smith DL, Johnson JA, Harris AD, F uruno JP, Perencevich EN, Morris JG. Assessing risks for a pre-emergent pathogen: virginiamycin use and the emergence of streptogramin resistance in Enterococcus faecium. Lancet Infect Dis 2003;3:241 –9. Soltani M, Beighton D, Philpott-Howard J, Woodford N. Mechanisms of resistance to quinupristin-dalfopristin among isolates of Enterococcus faecium from animals, raw meat, and hospital patients in Western Europe. Antimicrob Agents Chemother 2000;44:433–6. Sutcliffe J, Grebe T, Tait-Kamradt A, Wondrack L. Detection of erythromycin-resistant determinants by PCR. Antimicrob Agents Chemother 1996;40:2562–6. USFDA (United States Food and Drug Administration). Guidance for Industry #152: Guidance on evaluating the safety of antimicrobial new animal drugs with regard to their microbiological effects on bacteria of human health concern. Washington, D.C.: U.S. Food and Drug Administration; 2003. Winpisinger KA, Ferketich AK, Berry RL, Moeschberger ML. Spread of Musca domestica (Diptera: muscidae), from two caged layer facilities to neighboring residences in rural Ohio. J Med Entomol 2005;42:732–8. Wondrack L, Massa S, Yang B, Sutcliffe J. Clinical strain of Staphylococcus aureus inactivates and causes efflux of macrolides. Antimicrob Agents Chemother 1996;40:992–8. 10 SCIENCE OF THE TOTAL ENVIRONMENT XX (2009) XXX– XXX ARTICLE IN PRESS Please cite this article as: Graham JP et al., Antibiotic resistant enterococci and staphylococci isolated from flies collected near confined poultry feeding operations, Sci Total Environ (2009), doi:10.1016/j.scitotenv.2008.11.056 . Antibiotic resistant enterococci and staphylococci isolated from flies collected near confined poultry feeding operations Jay P. Graham ⁎ ,. as: Graham JP et al., Antibiotic resistant enterococci and staphylococci isolated from flies collected near confined poultry feeding operations, Sci Total