Secretionofpigmentepithelium-derived factor
Mutagenic study
Hanshuang Shao, Iris Schvartz and Shmuel Shaltiel*
Department of Biological Regulation, Weizmann Institute of Science, Rehovot, Israel
Pigment epithelium-derivedfactor (PEDF), a neurotrophic
and antiangiogenic protein, is an extracellular component of
the retinal interphotoreceptor matrix which has been shown
to be secreted by human fetal retinal pigment epithelial cells.
It belongs to the serpin superfamily and contains the typical
exposed reactive center loop. The function of this loop is still
unknown. In this study we used site-directed mutagenesis of
the cDNA encoding PEDF to show that (a) truncation of the
C-terminal tail (Pro415–Pro418) of PEDF, (b) deletion of
the Pro373–Ala380 segment that resides within the reactive
center loop of the protein, and (c) alanine substitution of
amino-acid residues Asn391–Thr403 located within its
hydrophobic core inhibit PEDF secretion, but not its tran-
scription, by cells transfected with the various PEDF
cDNAs. On the basis of the crystal structure of PEDF, these
mutations are presumed to alter the protein conformation,
suggesting that conservation of the 3D structure of PEDF
is essential for its secretion. In addition, we show that
replacement of Gly376 and Leu377 with alanine prevents
PEDF secretion. As these two residues are located within the
highly exposed segment of the reactive center loop, we pro-
pose a novel function for this loop in PEDF. Our results
imply that the reactive center loop, specifically Gly376 and
Leu377, is involved in the interaction of PEDF with com-
ponents of the quality control system in the endoplasmic
reticulum, thus ensuring its efficient secretion.
Keywords: crystal structure; neurotrophic activity; pigment
epithelium-derived factor (PEDF); secretion; serpin.
Pigment epithelium-derivedfactor (PEDF) was originally
identified as an extracellular component of the retinal
interphotoreceptor matrix and found to be secreted by
human fetal retinal pigment epithelial cells [1,2]. It has
been shown to be a neurotrophic factor that induces
neurite outgrowth in cultured human retinoblastoma Y-79
cells [1,2]. The neurotrophic activity of PEDF was further
demonstrated by its ability to promote neuronal survival
of the cerebellar granule cells and of developing spinal
motor neurons [3], to protect neurons against rapid
glutamate toxicity [4], and to inhibit apoptosis induced
by hydrogen peroxide of rat retinal neurons [5]. Recently,
PEDF was shown to be a very potent inhibitor of
neovascularization in a murine model of ischemia-induced
retinopathy [6]. The inhibition of neovascularization was
associated with endothelial cell apoptosis [6], probably by
increasing Fas ligand (FasL) mRNA and surface FasL in
these cells [7].
Sequence analysis of intact human PEDF, a 50-kDa
glycoprotein of 418 amino-acid residues, shows a high
homology to the serpin (serine protease inhibitors) super-
family [8]. NMR measurements and analysis of the X-ray
structures revealed that all the known serpins contain an
exposed reactive center loop (RCL) [9], which is susceptible
to cleavage by specific proteases [10]. As a consequence of
this cleavage, the RCL of the inhibitory members of the
serpin superfamily is inserted into b-sheet A (as a new
strand) leading to a transition from a stressed (S) to a
relaxed (R) loop structure. Subsequently, the specific
protease, attached to the RCL, moves to the base of the
serpin, where it is partially unfolded resulting in inhibition
of its activity [11,12].
The serpin superfamily also contains noninhibitory
members, among which are ovalbumin, angiotensinogen
and PEDF [13]. Similarly to ovalbumin and angiotensino-
gen, PEDF does not undergo the S fi R transition upon
cleavage of its RCL [13]. The crystal structure of human
PEDF was recently solved to 2.85 A
˚
and revealed that the
RCL is highly exposed [14]. The function of the RCL of
PEDF has not yet been resolved.
The C-terminal amino-acid residues have been shown
to play an important role in the secretionof many proteins
[15–19]. Truncation of the four amino-acid residues
(391–394) at the C-terminus of a1-proteinase inhibitor
(A1Pi) prevented its secretion by cells transfected with the
mutant A1Pi cDNA [16]. Proline at position 391 was found
to be important for the A1Pi secretion as replacement of
Pro391 by various amino acid residues severely restricted its
secretion [17]. A possible mechanism for the impaired
secretion of the A1Pi variants was suggested to be associated
with loop–sheet polymerization, whereby the reactive center
loop of one molecule is inserted into the b-sheet of another
molecule [20–22].
Correspondence to I. Schvartz, Department of Biological Regulation,
Weizmann Institute of Science, Rehovot 76100, Israel,
Fax: + 972 8 934 4116, Tel.: + 972 8 934 2483,
E-mail: iris.schvartz@weizmann.ac.il
Abbreviations: PEDF, pigmentepithelium-derived factor;
serpin, serine protease inhibitor; RCL, reactive center loop;
A1Pi, a1-proteinase inhibitor; ER, endoplasmic reticulum.
Dedication: dedicated to the memory of our mentor and distinguished
scientist, Shmuel Shaltiel.
*Note: Deceased.
(Received 27 August 2002, accepted 18 November 2002)
Eur. J. Biochem. 270, 822–831 (2003) Ó FEBS 2003 doi:10.1046/j.1432-1033.2003.03374.x
In this study, we constructed a series of PEDF mutants,
expressed them in Chinese hamster ovary (CHO) cells, and
detected their secretion by these cells. The results of
Western-blot and Northern-blot analysis as well as of
immunofluorescence microscopy suggest that conservation
of the 3D structure of PEDF is essential for its efficient
secretion. In addition, we show that Gly376 and Leu377,
which are located within the RCL of PEDF, play an
important role in PEDF secretion. This is, to our know-
ledge, the first time that a physiological function for the
RCL of PEDF has been reported.
Materials and methods
Materials
Full-length human PEDF cDNA was kindly provided by
Dr N. P. Bouck (North-western University, Chicago, IL,
USA). Transfomer
TM
Site-Directed Mutagenesis Kit was
purchased from Clontech. All oligonucleotide primers were
synthesized by the Expedite
TM
Nucleic Acid Synthesis
System (Workstation, Path Framinghan, MA,
1
USA) at the
Weizmann Institute of Science, Rehovot, Israel. Restriction
enzymes were purchased from Roche. Goat anti-(rabbit
IgG) conjugated to horseradish peroxidase were purchased
from Sigma. Midi-purification kit was purchased from
QIAGEN. DMEM/F-12 medium, MEM, and Lipofect-
AMINE reagent were purchased from Life Technologies
Inc.ECL,Ni
2+
-chelated Sepharose Fast Flow column and
Ready To Go random primer labeling kit were purchased
from Amersham Pharmacia Biotech. Bradford reagent was
purchased from Bio-Rad. Pfu DNA polymerase and SV
total RNA isolation kit were purchased from Promega.
Cy
TM
2-conjugated AffiniPure Goat anti-rabbit IgG
(H + L) was purchased from Jackson Laboratory
2
.All
other materials were the best commercially available grade.
Construction of the PEDF mutants
The full-length PEDF cDNA in pBluescript II SK (+)
was used as a template for mutagenesis. Replacement and
deletion of amino-acid residues of PEDF were performed
using an oligonucleotide site-directed mutagenesis kit.
PEDF cDNAs with the correct mutations were amplified
by PCR using the sense and antisense primers (Table 1).
Truncation of the C-terminus of PEDF was by PCR
amplification using the sense and truncation primers
listed in Table 1. Pure PCR products digested with
HindIII and EcoRI were ligated into the multicloning site
of pcDNA3. DNA sequencing analysis (PE-ABI 377
DNA sequencer) confirmed the nucleotide sequence of
the PEDF mutants.
Table 1. Oligonucleotide primers. Bold letters indicate mutated nucleotides; letters in parentheses indicate original nucleotides; letters with underline
are the recognition sequence by HindIII or EcoRI.
Oligonucleotide Sequence
PT121 5¢-
CGGGAATTCCCGTTAGGTACCATGGATGTCTGGGC-3¢
PT250 5¢-
CGGGAATTCCCGTTAAACAGCCTTAGGGTCCGACATC-3¢
PT350 5¢-
CGGGAATTCCCGTTAGGGTTTGCCTGTGATCTTGC-3¢
PT412 5¢-CGGGAATTCCCGTTAAATCTTGCCAATGAAGAGAAG-3¢
PT414 5¢-
CGGGAATTCCCGTTAGTCCAGAATCTTGCCAATGAAG-3¢
PT414-M 5¢-
CGGGAATTCCCGTTAATGGTGATGGTGATGGTGGTCCAGAATCTTGCCAATGAAG-3¢
PT415 5¢-
CGGGAATTCCCGTTAGGGGTCCAGAATCTTGCCAATG-3¢
PT416 5¢-
CGGGAATTCCCGTTACCTGGGGTCCAGAATCTTGCC-3¢
PT417 5¢-
CGGGAATTCCCGTTAGCCCCTGGGGTCCAGAATCTTG-3¢
PM44/45 5¢-
GTGGAGGAGGAGGC(A)TG(C)CTTTCTTCAAAGTCC-3¢
PM116/117 5¢-
CTTGATCAGCAGCG(C)CAGC(A)CATCCATGGTACC -3¢
PM246/247 5¢-CCCATGATGTCGGC(A)CG(C)CTAAGGCTGTTTTAC-3¢
PM372/373 5¢-
GGGGCGGGAACCG(A)CCG(C)CCAGCCCAGGGCTG-3¢
PM374/375 5¢-
GGAACCACCCCCGC(AG)CG(C)CAGGGCTGCAGCCTG-3¢
PM376/377 5¢-
CACCCCCAGCCCAGC(G)GGC(CT)GCAGCCTGCCCAC-3¢
PM378/379 5¢-
CAGCCCAGGGCTGGC(CA)GG(C)CTGCCCACCTCACC-3¢
PMD373-380 5¢-
GGGGCGGGAACCACCCACCTCACCTTCCCGC-3¢
PM391 5¢
-CTGGACTATCACCTTGC(AA)CCAGCCTTTCATCTTC-3¢
PM392 5¢
-GACTATCACCTTAACGC(CA)GCCTTTCATCTTCG-3¢
PM393 5¢
-CTATCACCTTAACCAGG(C)CTTTCATCTTCGTAC-3¢
PM392/393 5¢-
GACTATCACCTTAACGC(CA)GG(C)CTTTCATCTTCGTAC-3¢
PM391/392/393 5¢-CTGGACTATCACCTTGC(AA)CGC(CA)GG(C)CTTTCATCTTCGTACTG-3¢
PM394/395 5¢-
CCTTAACCAGCCTGC(TT)CGC(AT)CTTCGTACTGAGGG-3¢
PM396/397 5¢-
CCAGCCTTTCATCGC(TT)CGC(GT)ACTGAGGGACACAG-3¢
PM398/399 5¢-
GCCTTTCATCTTCGTAGC(CT)GGC(AG)GGACACAGACACAGG-3¢
PM400/401 5¢-
CTTCGTACTGAGGGC(A)CG(A)CAGACACAGGGGCCC-3¢
PM402/403 5¢-
GTACTGAGGGACACAGC(A)CG(A)CAGGGGCCCTTCTC-3¢
Sense primer 5¢-
CCCAAGCTTGGGAGGATGCAGGCCCTGGTGCTACTC-3¢
Antisense primer 5¢-
CGGGAATTCCCGTTAATGGTGATGGTGATGGTGGGGGCCCCTGGGGTCCAGAATC-3¢
Ó FEBS 2003 PEDF secretion by mutagenesis (Eur. J. Biochem. 270) 823
Transient expression of the PEDF mutants in CHO cells
CHO cells were grown in six-well tissue culture plates
(Nunc, Inc.) at 37 °Cina5%CO
2
incubator in DMEM/
F-12 medium containing 10% fetal bovine serum, 2 m
M
L
-glutamine and antibiotics (growth medium) until the cells
were 60–80% confluent. pcDNA3 (2 lg), carrying the
mutant PEDF cDNA prepared using the midi-purification
kit, was transfected into CHO cells using the Lipofect
AMINE reagent following the manufacturer’s instructions.
The transfected CHO cells were grown for 18 h in growth
medium (2 mL per well), and thereafter the medium was
replaced by serum-free DMEM/F-12 medium containing
2m
ML
-glutamine and antibiotics. After three days, the
medium was collected and assayed for PEDF immuno-
reactivity.
SDS/PAGE and immunoblotting
Samples (10 lL) of the conditioned medium of CHO cells
transfected with the cDNA of either wild-type (wt)PEDF or
one of its mutants were subjected to SDS/PAGE (10% gel)
under reducing conditions using the buffer system of
Laemmli [23]. To determine the intracellular content of
the different PEDF mutants, CHO cells (1 · 10
6
) transfected
with a PEDF cDNA were lysed with 200 lL Laemmli’s
sample buffer, boiled for 3 min, and then subjected (5 lg
total proteinÆ10 lL
)1
) to SDS/PAGE under reducing con-
ditions as above. Subsequently, the proteins were trans-
ferred to a nitrocellulose membrane as described previously
[24]. Immunoblotting was carried out using rabbit poly-
clonal antibodies, raised against the denatured plasma
PEDF (1 : 1000 final dilution). We have shown these
antibodies to be highly specific for recombinant PEDF
(unpublished). The procedure was followed by incubation
of the membrane with goat anti-(rabbit IgG) conjugated
to horseradish peroxidase. The signal was detected on Fuji
X-ray film using the ECL detection reagents.
Purification of the PEDF mutants
The medium of CHO cells transfected with a secreted form
of PEDF mutant was collected (2 mL) and clarified by
centrifugation (600 g for 5 min). The supernatant was
appliedtoaNi
2+
-chelated Sepharose Fast Flow column
(1 mL) equilibrated with 50 m
M
phosphate buffer, pH 8.0,
containing 0.3
M
NaCl. The column was washed extensively
with 5 m
M
imidazole, and the bound PEDF was eluted in
200 m
M
imidazole (0.2 mL). To purify the intracellular
truncated mutant PEDF 1–414, six histidine residues were
added to the C-terminus of this PEDF mutant by a second
PCR using the sense and PT414-M primers (Table 1). CHO
cells were transfected with this mutant and grown in growth
medium. After 2 days, the cells (4 · 10
7
) were lysed by
ultrasonic treatment in 1 mL RIPA buffer (50 m
M
Tris/
HCl, pH 8.0, 150 m
M
NaCl, 1 m
M
EGTA, 1% Triton
X-100, 0.1% SDS and 1% sodium deoxycholate) in the
presence of protease inhibitors (0.1 m
M
phenyl-
methanesulfonyl fluoride, 1 l
M
pepstatin, 1 m
M
benzami-
dine, 10 l
M
leupetin and 1 lgÆmL
)1
aprotinin). The cell
lysate was centrifuged (10 000 g for 10 min at 4 °C). The
supernatant was collected and purified on a Ni
2+
column as
described above. Purified PEDF mutants were dialyzed
against NaCl/P
i
, and the protein concentration was deter-
mined using the Bradford reagent.
Northern-blot analysis
Total RNA of transfected CHO cells was isolated using SV
total RNA isolation kit and separated (10 lg) by 1%
formaldehyde/agarose gel electrophoresis in a minigel
system. The RNA was then transferred to a Hybond-N
membrane (Amersham Pharmacia Biotech). Thereafter, the
membrane was fixed for 2 h at 80 °C in a vacuum oven and
then hybridized with a PEDF cDNA probe labeled with
[a-
32
P]dCTP using the Ready To Go random primer
labeling kit. The membrane was extensively washed with
NaCl/Cit buffer (150 m
M
NaCl, 15 m
M
sodium citrate,
pH 7.0) containing 1% SDS at 60 °C, and finally exposed
to Fuji X-ray film at )80 °Cfor18h.
Immunofluorescence microscopy
CHOcellsgrownoncoverslipsingrowthmediumwere
transfected with the cDNA of either wtPEDF or one of its
mutants. After 48 h the cells were rinsed twice with NaCl/P
i
and fixed (30 min) in NaCl/P
i
containing 2% paraformal-
dehyde. The fixed cells were permeabilized by incubating
them in NaCl/P
i
containing 0.2% Triton X-100 (5 min on
ice). The permeabilized cells were washed with NaCl/P
i
(3 times, 10 min each wash), and incubated (at 22 °C) in
NaCl/P
i
containing 1% BSA. After 30 min, the cells were
incubated in NaCl/P
i
containing anti-PEDF Igs (1 : 500
final dilution; 1 h at 22 °C), and then washed (3 times,
10mineachwash)withNaCl/P
i
. Subsequently, Cy2-
conjugated AffiniPure Goat Anti-Rabbit IgG (H + L)
(1 : 250 final dilution in NaCl/P
i
) was added and incubated
for 45 min at 22 °C. The cells were washed (3 times, 10 min
each wash), and the coverslips were then transferred
inversely to a glass slide carrying a drop of MowiolÒ
44–88 and photographed (Nikon EFD 3).
Neurite outgrowth assay
Human Y-79 retinoblastoma cells (obtained from ATCC)
were assayed for neurite outgrowth as described previously
[25]. Briefly, 2 ml Y-79 cells (1 · 10
5
cellsÆmL
)1
)were
incubated in the presence of 20 n
M
either wtPEDF or a
PEDF mutant in MEM supplemented with nonessential
amino acids, 1 m
ML
-glutamine, antibiotics, 0.1% insulin–
transferrin–selenium (ITS)
3
,10m
M
Hepes, pH 7.5, and
1m
M
sodium pyruvate. After 7 days in culture, the cells
were transferred to poly(
D
-lysine)-coated plates, and their
neurite outgrowth was monitored by microscopy at various
periods of time.
Results
Truncation of the C-terminal tail of PEDF prevents
its secretion
Recent studies showed that PEDF is a potent inhibitor of
neovascularization [26]. In an attempt to localize the site in
PEDF that is responsible for this biological activity, we
824 H. Shao et al.(Eur. J. Biochem. 270) Ó FEBS 2003
constructed three truncated mutants: PEDF 1–121, PEDF
1–250, and PEDF 1–350 (Scheme 1), and expressed them in
CHO cells. After 3 days in culture, the conditioned medium
of the transfected cells was collected, and the presence of
PEDF was evaluated by immunoblotting using antibodies
to PEDF. To our surprise, none of the truncated mutants
was secreted by the transfected CHO cells as efficiently as
wtPEDF (Fig. 1), whereas their intracellular content
(Fig. 1) and mRNA level (data not shown) in CHO cells
were comparable to those of wtPEDF. These results
indicate that truncation of the C-terminal edge of PEDF
prevents its secretion.
To determine the minimum length required for PEDF
secretion, a series of C-terminal truncated mutants differing
in length by only one amino acid was constructed and
expressed in CHO cells (Scheme 1). As shown in Fig. 1, the
truncated mutants PEDF 1–417 and PEDF 1–416 were
secreted by the transfected cells to the same extent as
wtPEDF. However, PEDF 1–415 was secreted to a lower
extent than wtPEDF (Fig. 1), and shorter molecules, such
as PEDF 1–414 and PEDF 1–412, were not secreted at all
(Fig. 1). The intracellular level of each of these mutants in
the transfected CHO cells was similar to that of wtPEDF
(Fig. 1), suggesting that the truncated mutants are effect-
ively synthesized but are not efficiently secreted by the cells.
This was further confirmed by the finding that the mRNA
level of these mutants in the transfected CHO cells was
comparable to that of wtPEDF (Fig. 2).
To localize the intracellular pools of the PEDF mutants,
transfected CHO cells were examined by immunofluores-
cence microscopy. In cells expressing wtPEDF (Fig. 3B),
PEDF 1–417 (not shown), PEDF 1–416 (Fig. 3C), or
PEDF 1–415 (not shown), perinuclear spots with prominent
brightness and cytoplasmic reticular staining were observed,
which correspond to the Golgi apparatus and endoplasmic
reticulum (ER), respectively [17,19]. In cells expressing
PEDF 1–414 (Fig. 3D) and shorter molecules, such as
PEDF 1–412 (Fig. 3E), cytoplasmic reticular staining was
observed. It should be noted that no immunofluorescence
staining was observed in mock-transfected CHO cells under
the same experimental conditions (Fig. 3A). Therefore,
these results indicate that Pro415 is important for the
transport of PEDF from the ER to the Golgi apparatus,
and consequently for its secretion.
Scheme 1. Schematic presentation of the PEDF mutants. The reactive
center loop is indicated by a black area. The amino-acid substitutions
are identified by standard one-letter designations and are positioned
along the PEDF amino-acid sequence.
Fig. 1. Secretionof wtPEDF and its mutants
by transfected CHO cells. Upper panel,
samples (10 lL) of conditioned medium of
CHO cells transfected with the cDNA of
either wtPEDF or one of its mutants were
subjected to SDS/PAGE (10% gel) under
reducing conditions followed by immuno-
blotting with anti-PEDF Ig (1 : 1000 final
dilution) as described in Materials and meth-
ods. The PEDF band was visualized with ECL
reagents. Lower panel, transfected CHO cells
were lysed in 200 lL Laemmli’s sample buffer,
boiled for 3 min, and samples (5 lgtotal
proteinÆ10 lL
)1
) were subjected to SDS/
PAGE and immunoblotting as described in
the upper panel.
Ó FEBS 2003 PEDF secretion by mutagenesis (Eur. J. Biochem. 270) 825
Mutations within the RCL of PEDF affect its secretion
The crystal structure of human PEDF reveals that the
central segment of the RCL is highly exposed, presumably
to ensure its interaction with potential targets [14]. However,
such targets have not yet been discovered. To discover
whether the central segment of the RCL (residues 373–380)
is important for the secretionof PEDF, a deletion mutant,
PEDF D373–380, was expressed in CHO cells, and its
secretion by these cells was measured. As shown in Fig. 1,
PEDF D373–380 was ineffectively secreted by the transfected
cells. The intracellular content of this mutant (Fig. 1) and its
mRNA level in the cells (Fig. 2) were similar to those of
wtPEDF. The impaired secretionof PEDF D373–380 was
shown to be associated with its ineffective transport from
the ER to the Golgi apparatus as revealed by the
immunofluorescence staining (Fig. 3F). Therefore, these
results indicate that the deletion of the central segment of
the RCL prevents the PEDF secretion.
To specifically identify the amino-acid residues within this
segment that play a role in the PEDF secretion, we
constructed a series of mutants in which two consecutive
residues were replaced by alanine (PEDF T372/A P373/A,
PEDF S374/A P375/A, PEDF G376/A L377/A, and PEDF
Q378/A P379/A, Scheme 1). Expression of the mutants in
CHO cells showed that three of them (PEDF T372/A P373/
A, PEDF S374/A P375/A, and PEDF Q378/A P379/A)
were effectively secreted (Fig. 1), transcribed (Fig. 2) and
transported to the Golgi apparatus (Fig. 3G,H). In con-
trast, the PEDF mutant G376/A L377/A, although suc-
cessfully transcribed (Fig. 2), was not secreted (Fig. 1) and
was localized primarily in the ER (Fig. 3I), implying that
the amino-acid residues Gly376 and Leu377 may play an
important role in PEDF secretion.
Mutations within the hydrophobic core of PEDF impair
its secretion
A series of PEDF mutants was constructed in which
consecutive amino-acid residues between Asn391 and
Thr403 were replaced by Ala. These residues are located
within b-sheet B which has been shown to be involved in
formation of the hydrophobic core of PEDF [14]. To
determine whether this segment is important for the PEDF
secretion, we transfected CHO cells with the following
constructs: PEDF N391/A, PEDF Q392/A, PEDF L398/A
R399/A, PEDF D400/A T401/A, and PEDF D402/A
T403/A. The transfected cells secreted the PEDF mutants to
the same extent as cells transfected with wtPEDF cDNA
(Figs 1 and 3J,K). However, cells expressing PEDF mutants
in which Pro393, Phe394 or Phe396 were replaced by alanine
(PEDF Q392/A P393/A, PEDF N391/A Q392/A P393/A,
PEDF F394/A I395/A, and PEDF F396/A V397/A) did not
secrete them in measurable amounts. The impaired secretion
of these mutants was not due to inefficient transcription
(Fig. 2), but rather to ineffective transport from the ER
to the Golgi apparatus, as revealed by the immunofluo-
rescence microscopy (Fig. 3L–O). Note that the single-site
mutation of Pro393 to alanine (PEDF P393/A) significantly
reduced mutant secretion, but did not abolish it completely
(Fig. 1).
Replacement of Asp44 Pro45, Pro116 Asp117, and
Asp246 Pro247 with alanine did not affect PEDF
secretion
Analysis of the crystal structure of PEDF [14] also reveals
that segments I, II and III (Fig. 4) constitute three distinct
exposed loops in the PEDF molecule. To discover whether
these specific segments are involved in the PEDF secre-
tion, we constructed three mutants in which Asp44 Pro45,
Pro115 Asp116, or Asp246 Pro247 of segments I, II, and
III, respectively, were replaced by alanine and then
determined the secretionof these mutants by transfected
CHO cells. The secretionof each of these mutants
(Fig. 1), their transcription (Fig. 2), and their intracellular
localization (Fig. 3P) were essentially very similar to that
of wtPEDF.
Effect of PEDF mutants on Y-79 differentiation
One of the well-studied biological activities of PEDF is its
ability to induce neurite outgrowth in retinoblastoma cells
[2]. This activity was recently shown to be located at the
exposed parts of helices C and D and at loop 90 [14]. As a
few of the mutations described above were found to prevent
PEDF secretion, we aimed to test whether these mutations
would affect the ability of PEDF to induce retinoblastoma
differentiation. As shown in Fig. 5, the PEDF mutants
exhibited neurotrophic activity similar to that of wtPEDF,
indicating that these mutations do not essentially change the
ability of PEDF to induce Y-79 differentiation.
Discussion
In this study we produced a series of mutations in the
PEDF cDNA and determined their effect on the protein
Fig. 2. Northern-blot analysis of the transiently transfected CHO cells.
Total RNA (10 lg) from each transfected cell line was separated by 1%
formaldehyde/agarose gel electrophoresis, transferred to a Hybond-N
membrane, and hybridized with
32
P-labeled PEDF cDNA probe as
described in Materials and methods. The RNA level in the different
transfected cell lines was essentially identical, therefore only repre-
sentative samples are presented.
826 H. Shao et al.(Eur. J. Biochem. 270) Ó FEBS 2003
secretion. From our results we can divide the mutations
into two categories: (a) those that presumably bring
about a change in the 3D structure of PEDF, which
leads to inhibition of PEDF secretion; (b) those that do
not appear to confer a major change in the PEDF
structure, but affect PEDF secretion, probably through a
different mechanism.
Conservation of the 3D structure of PEDF is important
for its secretion
We have shown that truncation of the C-terminal tail of
PEDF before Pro415 inhibits PEDF secretion. This is in line
with the findings that truncation before Pro391 prevented
secretion of A1Pi [16]. Analysis of the 3D structure of PEDF
Fig. 3. Immunofluorescence microscopic localization of wtPEDF and its mutants. CHO cells transfected with the cDNA of either wtPEDF or one of
its mutants were fixed and examined by immunofluorescence microscopy using anti-PEDF Igs (1 : 500 final dilution) and Cy
TM
2-conjugated
AffiniPure Goat Anti-Rabbit IgG (H + L) (1 : 250 final dilution) as described in Materials and Methods. (A) Mock-transfected CHO cells;
(B) wtPEDF; (C) PEDF 1–416; (D) PEDF 1–414; (E) PEDF 1–412; (F) PEDF D373–380; (G) PEDF T372/A P373/A; (H) PEDF Q378/A P379/A;
(I) PEDF G376/A L377/A; (J) PEDF N391/A; (K) PEDF L398/A R399/A; (L) PEDF Q392/A P393/A; (M) PEDF N391/A Q392/A P393/A;
(N) PEDF F394/A I395/A; (O) PEDF F396/A V397/A; (P) PEDF D44/A P45/A.
Ó FEBS 2003 PEDF secretion by mutagenesis (Eur. J. Biochem. 270) 827
reveals that Pro415 is mostly buried and interacts primarily
with Phe231 and Leu223 (Fig. 4). Truncation of PEDF at
this site probably results in disruption of the hydrophobic
interactions imposed by Pro415 and exposure of Asp414
(a negatively charged amino acid) to the negatively charged
C-terminus. We therefore assume that this mutation brings
about a conformational change in the PEDF molecule that
leads to its inefficient secretion.
A conformational change in the 3D structure of PEDF is
also suggested to occur on replacement of Pro393, Phe394,
or Phe396 with alanine. These residues are located within
the central b-strand of b-sheet B (red segment in Fig. 4).
Analysis of the crystal structure of PEDF reveals that this
strand is important for the formation of the hydrophobic
core of PEDF. The two Phe residues, i.e. Phe394 and
Phe396, appear to interact with the hydrophobic aromatic
residues Phe362 and Trp364 located within b-sheet A [14].
Mutations to alanine are assumed to result in loss of these
hydrophobic interactions that are essential for the correct
folding of PEDF. In addition, our results indicate that
deletion of the central segment of the RCL (Pro373 through
Ala380) prevents PEDF secretion. As the RCL connects
between the b-strand of two b-sheets, A and C [14], our
results suggest that deletion of these amino-acid residues,
which occupy a gap of 17.6 A
˚
in the polypeptide chain
(Fig. 4), prevent the correct folding of PEDF.
The importance of correct folding of secretory or
membrane proteins for their efficient secretion has been
previously documented [27–29]. Hammond & Helenius [28]
described a stringent quality control system in the ER and in
downstream compartments of the secretory pathway. This
system ensures secretionof correctly folded and assembled
proteins by promoting their proper folding and by retaining
misfolded and incompletely assembled proteins, which are
eventually degraded [28]. This quality control system
includes lumenal and membrane-bound chaperones that
have been shown to play a role in several human diseases.
For example, genetic variants of human A1Pi that are
unable to fold into the native conformation of the protease
were shown to be bound to the membrane-associated
chaperone calnexin [30]. Similarly, a cystic fibrosis trans-
membrane conductance regulator (CFTR) mutant (DF508)
was found to be bound to a cytosolic chaperone, Hsc70, and
recently Hsc70 together with a cochaperone molecule
(CHIP) were shown to target aberrant forms of the CFTR
for proteosomal degradation [31]. In line with these findings,
we propose that the misfolded PEDF mutants described in
our study may be retained in the ER by chaperones and
then destined for degradation. A possible candidate for
retaining the PEDF mutants is BiP, a lumenal chaperone
shown to bind proteins with exposed hydrophobic domains
on their surface [32,33].
Gly376 and Leu377 play an important role in PEDF
secretion
Substitution of alanine for Thr372 Pro373, Ser374 Pro375,
or Gln378 Pro379 did not affect PEDF secretion. How-
ever, replacement of Gly376 and Leu377 with alanine
prevented it (Fig. 1). As these amino-acid residues are
located within the RCL, which has been shown to be very
exposed in the 3D structure of PEDF [14], we suggest that
these residues are not involved in intramolecular interac-
tions, but rather play a role in intermolecular associations,
Fig. 4. View ribbon diagram of human PEDF. The 3D structure of
PEDF (Protein Data Bank Code: 1IMV) was further analyzed using the
Insight II program (MSI/Biosym Technology, San Diego, CA, USA).
The blue segment indicates the C-terminal tail of PEDF (Pro415-
Pro418). The red segment indicates the hydrophobic core of PEDF. The
distance between the Ca atoms at the ends of the unstructured central
segmentoftheRCLofPEDFis17.6 A
˚
. The pink segment indicates the
neurotrophic activity region of PEDF (residues 78–121). Segment I, II
and III designate three exposed loops in PEDF (see Results).
5
Fig. 5. Neurotrophic activity of wtPEDF and its mutants in human
retinoblastoma Y-79 cells. Y-79 cells (2 mL; 1 · 10
5
cellsÆmL
)1
)were
incubated in the presence of either wtPEDF or one of its mutants (final
concentration 20 n
M
) as described in Materials and methods. Neurite
outgrowth was monitored by microscopy at various periods of time,
and photographed day 10 after plating. (A) Serum-free medium; (B)
wtPEDF; (C) PEDF D44/A P45/A; (D) PEDF P116/A D117/A; (E)
PEDF D246/A P247/A; (F) PEDF T372/A P373/A; (G) PEDF T374/
A P375/A; (H) PEDF G376/A L377/A; (I) PEDF Q378/A P379/A; (J)
PEDF D373–380; (K) PEDF Q392/A; (L) PEDF P393/A; (M) PEDF
Q392/A P393/A; (N) PEDF N391/A Q392/A P393/A; (O) PEDF
F394/A I395/A; (P) PEDF F396/A V397/A; (Q) PEDF L398/A R399/
A; (R) PEDF D400/A T401/A; (S) PEDF D402/A T403/A; (T) PEDF
1–414.
828 H. Shao et al.(Eur. J. Biochem. 270) Ó FEBS 2003
for example, with cargo receptors or escort proteins, which
are known to escort proteins out of the ER to the Golgi
apparatus [27]. Our results imply, for the first time, a novel
function for the RCL of PEDF, namely, binding to
components of the secretory pathway to ensure efficient
secretion of PEDF.
Ó FEBS 2003 PEDF secretion by mutagenesis (Eur. J. Biochem. 270) 829
Neurotrophic activity of PEDF
The neurotrophic activity of PEDF was originally demon-
strated by its ability to induce neurite outgrowth in human
retinoblastoma cells [2]. From studies with synthetic
peptides, this activity was located at the N-terminal edge
of PEDF (residues 78–121) [34]. Recently, Simonovic et al.
[14] mapped the neurotrophic activity of PEDF to the
exposed parts of helices C and D and to loop 90. We
examined whether the mutations that we produced (trun-
cation of the C-terminal tail of PEDF, deletion of the
central segment of its RCL, or alanine substitution along the
PEDF molecule) affect the neurotrophic activity of PEDF.
As none of the mutations was shown to inhibit Y-79
differentiation, we suggest that these mutations, although
they induce conformational changes in the PEDF molecule
as discussed above, do not significantly affect the exposed C
and D helices, and hence do not lead to inhibition of the
neurotrophic activity. It should be noted that Pro116 and
Asp117 are located within the segment found to be
responsible for the neurotrophic activity of PEDF [34].
However, replacement of these two amino-acid residues
with alanine was not shown to affect this activity, suggesting
that they do not play a major role in the neurotrophic
activity of PEDF.
Possible clinical implications of the inefficient secretion
of PEDF variants
PEDF has been shown to be a very potent inhibitor of
angiogenesis in a murine model of ischemia-induced
retinopathy [6,35]. It has also been suggested to play a
role in the control of tumor growth [36]. Recently, we
have shown that PEDF is present in the blood of various
mammals and exhibits antiangiogenic activity similar to
that observed with the PEDF isolated from bovine eyes
(unpublished). On the basis of our present results, we
hypothesize that similar mutations along the PEDF
molecule may occur in nature and may have clinical
implications. This possibility is supported by the findings
that individuals homozygous for the production of an
A1Pi variant (A1PiZ) have 15–20% of the normal serum
levels of the protease [37]. The A1PiZ variant contains an
amino-acid substitution at position Glu342, which leads to
limited transport of the protease from the ER to the Golgi
apparatus and thereby to its inefficient secretion by the
liver [38]. Consequently, the proteolytic activity of elastase
released from activated neutrophils is not adequately
inhibited, leading to severe lung damage culminating in
pulmonary emphysema [37]. The reduced secretion of
PEDF mutants as observed in the present study may
affect its antiangiogenic activity and may thus have
pathological consequences.
Acknowledgements
We thank Dr Rony Seger for critical reading of the manuscript and
for his suggestions and comments. We also thank Dr Miriam
Eisenstein for her help in analyzing the 3D structure of PEDF, and
Dr Dalia Seger for her careful reading of the manuscript. This
research was supported in part by the Israel Science Foundation,
Award no. 415/99.
References
1. Tombran-Tink, J. & Johnson, L.V. (1989) Neuronal differentia-
tion of retinoblastoma cells induced by medium conditioned by
human RPE cells. Invest. Ophthamol. Vis. Sci. 30, 1700–1707.
2. Tombran-Tink, J., Chader, G.G. & Johnson, L.V. (1991) PEDF:
a pigmentepithelium-derivedfactor with potent neuronal differ-
entiative activity. Exp. Eye Res. 53, 411–414.
3. Houenou, L.J., D’Costa, A.P., Li, L., Turgeon, V.L., Enyadike,
C.,Alberdi,E.&Becerra,S.P.(1999)Pigmentepithelium-derived
factor promotes the survival and differentiation of developing
spinal motor neurons. J. Comp. Neurol. 412, 506–514.
4. Taniwaki, T., Hirashima, N., Becerra, S.P., Chader, G.J., Etche-
berrigaray, R. & Schwartz, J.P. (1997) Pigment epithelium-derived
factor protects cultured cerebellar granule cells against glutamate-
induced neurotoxicity. J. Neurochem. 68, 26–32.
5. Cao, W., Tombran-Tink, J., Chen, W., Mrazek, D., Elias, R. &
McGinnis, J.F. (1999) Pigmentepithelium-derivedfactor protects
cultured retinal neurons against hydrogen peroxide-induced cell
death. J. Neurosci. Res. 57, 789–800.
6. Stellmach, V.V., Crawford, S.E., Zhou, W. & Bouck, N. (2001)
Prevention of ischemia-induced retinopathy by the natural ocular
antiangiogenic agent pigmentepithelium-derived factor. Proc.
NatlAcad.Sci.USA98, 2593–2597.
7. Volpert,O.V.,Zaichuk,T.,Zhou,W.,Reiher,F.,Ferguson,T.A.,
Stuart, P.M., Amin, M. & Bouck, N.P. (2002) Inducer-stimulated
Fas targets activated endothelium for destruction by anti-angio-
genic thrombospondin-1 and pigmentepithelium-derived factor.
Nat. Med. 8, 349–357.
8. Steele, F.R., Chader, G.J., Johnson, L.V. & Tombran-Tink, J.
(1993) Pigmentepithelium-derived factor: neurotrophic activity
and identification as a member of the serineprotease inhibitor gene
family. Proc. Natl Acad. Sci. USA 90, 1526–1530.
9. Whisstock,J.,Skinner,R.&Lesk,A.M.(1998)Anatlasofserpin
conformations. Trends Biochem. Sci. 23, 63–67.
10. Lawrence, D.A., Ginsburg, D., Day, D.E., Berkenpas, M.B.,
Verhamme, I.M., Kvassman, J.O. & Shore, J.D. (1995) Serpin-
protease complexes are trapped as stable acyl-enzyme inter-
mediates. J. Biol. Chem. 270, 25309–25312.
11. Huntington, J.A., Read, R.J. & Carrell, R.W. (2000) Structure of a
serpin-protease complex shows inhibition by deformation. Nature
(London) 407, 923–926.
12. Egelund, R., Petersen, T.E. & Andreasen, P.A. (2001) A serpin-
induced extensive proteolytic susceptibility of urokinase-type
plasminogen activator implicates distortion of the proteinase
substrate-binding pocket and oxyanion hole in the serpin
inhibitory mechanism. Eur. J. Biochem. 268, 673–685.
13. Becerra, S.P., Sagasti, A., Spinella, P. & Notario, V. (1995) Pig-
ment epithelium-derivedfactor behaves like a noninhibitory
serpin. Neurotrophic activity does not require the serpin reactive
loop. J. Biol. Chem. 270, 25992–25999.
14. Simonovic, M., Gettins, P.G. & Volz, K. (2001) Crystal structure
of human PEDF, a potent anti-angiogenic and neurite
growth-promoting factor. Proc. Natl Acad. Sci. USA 98, 11131–
11135.
15. Chen, H.W., Chan, W.Y., Chen, C.L., Mansfield, B.C. & Chou,
J.Y. (1993) The carboxyl-terminal domain of the human preg-
nancy-sepcific glycoprotein specifics intracellular retention and
stability. J. Biol. Chem. 268, 22066–22075.
16. Brodbeck, R.M. & Brown, J.L. (1992) Secretionof alpha-
1-proteinase inhibitor requires an almost full length molecule.
J. Biol. Chem. 267, 294–297.
17. Brodbeck, R.M. & Brown, J.L. (1994) Study of the roles of proline
391 and a highly conserved sequence in the carboxyl-terminal
region of members of the serpin family in the secretionof alpha
1-proteinase inhibitor. J. Biol. Chem. 269, 17252–17256.
830 H. Shao et al.(Eur. J. Biochem. 270) Ó FEBS 2003
18. Ghigo, J.M. & Wandersman, C. (1994) A carboxyl-terminal four-
amino acid motif is required for secretionof the metalloprotease
PrtG through the Erwinia chrysanthemi protease secretion path-
way. J. Biol. Chem. 269, 8979–8985.
19. Katsumi, A., Kojima, T., Senda, T., Yamazaki, T., Tsukamoto,
H., Sugiura, I., Kobayashi, S., Miyata, T., Umeyama, H. & Saito,
H. (1998) The carboxyl-terminal region of protein C is essential for
its secretion. Blood 91, 3784–3791.
20. Lomas, D.A., Evans, D.L., Finch, J.T. & Carrell, R.W. (1992) The
mechanism of Z alpha 1-antitrypsin accumulation in the liver.
Nature (London) 357, 605–607.
21. Lomas, D.A., Evans, D.L., Stone, S.R., Chang, W.S. & Carrell,
R.W. (1993) Effect of the Z mutation on the physical and
inhibitory properties of alpha 1-antitrypsin. Biochemistry 32,
500–508.
22. Lomas, D.A., Elliott, P.R., Sidhar, S.K., Foreman, R.C., Finch,
J.T., Cox, D.W., Whisstock, J.C. & Carrell, R.W. (1995) alpha 1-
Antitrypsin Mmalton (Phe52-deleted) forms loop-sheet polymers
in vivo. Evidence for the C sheet mechanism of polymerization.
J. Biol. Chem. 270, 16864–16870.
23. Laemmli, U. (1970) Cleavage of structural proteins during the
assembly of the head of bacteriophage T4. Nature (London) 227,
680–685.
24. Gechtman, Z., Belleli, A., Lechpammer, S. & Shaltiel, S. (1997)
The cluster of basic amino acids in vitronectin contributes to its
binding of plasminogen activator inhibitor-1: evidence from
thrombin-, elastase- and plasmin-cleaved vitronectins and anti-
peptide antibodies. Biochem. J. 325, 339–349.
25. Becerra, S.P., Palmer, I., Kumar, A., Steele, F., Shiloach, J.,
Notario, V. & Chader, G.J. (1993) Overexpression of fetal human
pigment epithelium-derivedfactor in Escherichia coli. A function-
ally active neurotrophic factor. J. Biol. Chem. 268, 23148–23156.
26. Dawson, D.W., Volpert, O.V., Gillis, P., Crawford, S.E., Xu, H.,
Benedict, W. & Bouck, N.P. (1999) Pigment epithelium-derived
factor: a potent inhibitor of angiogenesis. Science 285, 245–248.
27. Ellgaard, L., Molinari, M. & Helenius, A. (1999) Setting the
standards: quality control in the secretory pathway. Science 286,
1882–1888.
28. Hammond, C. & Helenius, A. (1995) Quality control in the
secretory pathway. Curr.Opin.CellBiol.7, 523–529.
29. Lodish, H., Berk, A., Zopursky, S.L., Matsudaira, P., Baltimore,
D. & Darnell, J. (2000) Protein sorting: organelle biogenesis and
protein secretion. In Molecular Cell Biology (Tenney, S., ed),
4
pp.
675–750. W.H. Freeman, New York.
30. Le, A., Steiner, J.L., Ferrell, G.A., Shaker, J.C. & Sifers, R.N.
(1994) Association between calnexin and a secretion-incompetent
variant of human alpha 1-antitrypsin. J. Biol. Chem. 269, 7514–
7519.
31. Meacham, G.C., Patterson, C., Zhang, W., Younger, J.M. & Cyr,
D.M. (2001) The Hsc70 co-chaperone CHIP targets immature
CFTR for proteasomal degradation. Nat. Cell Biol. 3, 100–105.
32. Blond-Elguindi, S., Cwirla, E., Dower, W.J., Lipshutz, R.J.,
Sprang, S.R., Sambrook, J.F. & Gething, M.J. (1993) Affinity
panning of a library of peptides displayed on bacteriophages
reveals the binding specificity of BiP. Cell 75, 717–728.
33. Flynn, G.C.P.J., Flocco. M.T. & Rothman, J.E. (1991) Peptide-
binding specificity of the molecular chaperone BiP. Nature
(London) 353, 726–730.
34. Alberdi, E., Aymerich, M.S. & Becerra, S.P. (1999) Binding of
pigment epithelium-derivedfactor (PEDF) to retinoblastoma
cells and cerebellar granule neurons. J. Biol. Chem. 274, 31605–
31612.
35. Duh, E.J., Yang, H.S., Suzuma, I., Miyagi, M., Youngman, E.,
Mori, K., Katai, M., Yan, L., Suzuma, K., West, K., Davarya, S.,
Tong, P., Gehlbach, P., Pearlman, J., Crabb, J.W., Aiello, L.P.,
Campochiaro, P.A. & Zack, D.J. (2002) Pigment epithelium-
derived factor suppresses ischemia-induced retinal neovascular-
ization and VEGF-induced migration and growth. Invest.
Ophthalmol. Vis. Sci. 43, 821–829.
36. Chader, G.J. (2001) PEDF: raising both hopes and questions in
controlling angiogenesis. Proc. Natl Acad. Sci. USA 98, 2122–
2124.
37. Fagerhol, M.K. & Cox, D.W. (1981) The Pi polymorphism:
genetic, biochemical, and clinical aspects of human alpha 1-anti-
trypsin. Adv. Hum. Genet. 11, 1–62.
38. McCracken, A.A., Kruse, K.B. & Brown, J.L. (1989) Molecular
basis for defective secretionof the Z variant of human alpha-1-
proteinase inhibitor: secretionof variants having altered potential
for salt bridge formation between amino acids 290 and 342. Mol.
Cell Biol. 9, 1406–1414.
Ó FEBS 2003 PEDF secretion by mutagenesis (Eur. J. Biochem. 270) 831
. structure; neurotrophic activity; pigment
epithelium-derived factor (PEDF); secretion; serpin.
Pigment epithelium-derived factor (PEDF) was originally
identified. Secretion of pigment epithelium-derived factor
Mutagenic study
Hanshuang Shao, Iris Schvartz and Shmuel Shaltiel*
Department of Biological